ID: 1061912001

View in Genome Browser
Species Human (GRCh38)
Location 9:133729888-133729910
Sequence TCAGCTCTGCTGACACCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 347
Summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 311}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061911992_1061912001 25 Left 1061911992 9:133729840-133729862 CCGGCCCACAGCACTTGCCCACA 0: 1
1: 0
2: 6
3: 36
4: 366
Right 1061912001 9:133729888-133729910 TCAGCTCTGCTGACACCTGGTGG 0: 1
1: 0
2: 3
3: 32
4: 311
1061911997_1061912001 8 Left 1061911997 9:133729857-133729879 CCCACACTCCTGCGGGCAGAGCA 0: 1
1: 0
2: 0
3: 52
4: 133
Right 1061912001 9:133729888-133729910 TCAGCTCTGCTGACACCTGGTGG 0: 1
1: 0
2: 3
3: 32
4: 311
1061911994_1061912001 20 Left 1061911994 9:133729845-133729867 CCACAGCACTTGCCCACACTCCT 0: 1
1: 1
2: 2
3: 46
4: 445
Right 1061912001 9:133729888-133729910 TCAGCTCTGCTGACACCTGGTGG 0: 1
1: 0
2: 3
3: 32
4: 311
1061911991_1061912001 29 Left 1061911991 9:133729836-133729858 CCATCCGGCCCACAGCACTTGCC 0: 1
1: 0
2: 0
3: 17
4: 187
Right 1061912001 9:133729888-133729910 TCAGCTCTGCTGACACCTGGTGG 0: 1
1: 0
2: 3
3: 32
4: 311
1061911993_1061912001 21 Left 1061911993 9:133729844-133729866 CCCACAGCACTTGCCCACACTCC 0: 1
1: 0
2: 1
3: 27
4: 300
Right 1061912001 9:133729888-133729910 TCAGCTCTGCTGACACCTGGTGG 0: 1
1: 0
2: 3
3: 32
4: 311
1061911998_1061912001 7 Left 1061911998 9:133729858-133729880 CCACACTCCTGCGGGCAGAGCAC 0: 1
1: 0
2: 2
3: 41
4: 243
Right 1061912001 9:133729888-133729910 TCAGCTCTGCTGACACCTGGTGG 0: 1
1: 0
2: 3
3: 32
4: 311
1061911999_1061912001 0 Left 1061911999 9:133729865-133729887 CCTGCGGGCAGAGCACAGACAGC 0: 1
1: 0
2: 1
3: 29
4: 266
Right 1061912001 9:133729888-133729910 TCAGCTCTGCTGACACCTGGTGG 0: 1
1: 0
2: 3
3: 32
4: 311

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061912001 Original CRISPR TCAGCTCTGCTGACACCTGG TGG Intronic
900380411 1:2381375-2381397 TCCACGCTGCTGACACCTGCAGG - Intronic
901221991 1:7588487-7588509 TCAGCTCAGCTGTCAAATGGAGG - Intronic
902183597 1:14708640-14708662 ACAGCTCTGCTTACACATGGTGG + Intronic
902816308 1:18918579-18918601 CCACCCCTGCTGACACCTAGGGG - Intronic
903387139 1:22934698-22934720 CAAGCTCCGCTGACACCTTGAGG - Intergenic
903656144 1:24949865-24949887 TCAGCTATGCTGACCCCTCCTGG - Intronic
904442012 1:30538160-30538182 CCAGCTCTGCTGCCAAGTGGAGG + Intergenic
906203695 1:43975661-43975683 ACAGCTGTACTGTCACCTGGGGG + Intronic
906750136 1:48251503-48251525 ACAGCACTGCTGAGACCTAGGGG - Intergenic
908595813 1:65687847-65687869 TGTGCTCTGCTGCCACCTGCTGG + Intergenic
909314606 1:74199743-74199765 TCAGCTTTTCTGACAGCTGTTGG - Exonic
911103537 1:94112222-94112244 TCAGGTCTGCAGACACCTCAGGG + Intronic
913259238 1:116983344-116983366 TCAGTGCTGCTGTCACCTGCAGG - Intronic
915724701 1:158008973-158008995 TCAGCTCTGCTGTCACCTCGGGG + Intronic
916179497 1:162071019-162071041 TCAGCCTTGCTCACACCTGATGG - Intronic
916695870 1:167235851-167235873 TCTGTTCTGCTGAGACCTAGTGG + Intronic
918202350 1:182279311-182279333 TCAGCTCTGGTGTCTACTGGTGG - Intergenic
919915322 1:202135345-202135367 TCGGCTCTGCTGCCACCGTGTGG + Intronic
919971211 1:202580467-202580489 TCAGTTCTGTTAACACCTGTAGG - Exonic
920891913 1:209995251-209995273 TCACCTCTTGTGACACCTGTAGG + Intronic
921821742 1:219624545-219624567 TCAGCTCTGGTAACCCCTGTGGG - Intergenic
923044168 1:230343194-230343216 TCAGCACCGCTGACCCCTGTGGG + Intronic
923270566 1:232351894-232351916 TTAGCTCCTCTCACACCTGGAGG + Intergenic
1062923591 10:1297920-1297942 CCAGCCCTGCCCACACCTGGAGG + Intronic
1062932840 10:1363902-1363924 TCCGCGCTGCTGGTACCTGGAGG + Exonic
1063014130 10:2057848-2057870 TCTGCTCTGCTGACACCCCAGGG - Intergenic
1065173425 10:23054189-23054211 GCAGCTCTTCTGACACCTTGCGG + Intergenic
1069614944 10:69801252-69801274 CCAGCTCTGCTGCCCCCTGGAGG + Intergenic
1070250367 10:74767731-74767753 TAAGCCCTGCTGAAAACTGGAGG - Intergenic
1071000720 10:80827953-80827975 CCATCTGTGCTGACACCTGCTGG + Intergenic
1072051911 10:91713095-91713117 ACAGCCCTGCTGACACCCTGAGG + Intergenic
1073177704 10:101566521-101566543 TCAGCGCGGCTGACAGCGGGAGG - Intergenic
1073510816 10:104041287-104041309 TAAGCTCGGCTCTCACCTGGTGG + Exonic
1074914025 10:117938550-117938572 TCAACCCTGCTGACACCTTGAGG - Intergenic
1076494104 10:130885557-130885579 TCAGCTCTGCCAACACCAGCTGG - Intergenic
1076620925 10:131787187-131787209 TAAAATCTGCTGCCACCTGGTGG + Intergenic
1076652373 10:131998759-131998781 ACAGTTTTGCTGACACGTGGTGG + Intergenic
1080442704 11:32310110-32310132 TCTGCTCTGCTCAGACCTGGGGG - Intergenic
1081207762 11:40294251-40294273 GTGGCTCTGCTGCCACCTGGAGG + Intronic
1083152338 11:60799678-60799700 TGAGCTCTGCAAATACCTGGGGG - Intronic
1083250151 11:61461147-61461169 TCAGCCCTGCTGCCTCCTAGCGG - Intronic
1083582739 11:63835493-63835515 TGAGCTCTGCAGACATCTAGGGG - Intergenic
1083810863 11:65105959-65105981 TCAGCTCTGGAGGCTCCTGGAGG - Intronic
1083877311 11:65531120-65531142 TCAGCTCACCTGACTTCTGGGGG + Intronic
1084028922 11:66469493-66469515 TGAGCTCTTCTCACACATGGGGG - Intronic
1089188217 11:116635476-116635498 TCAGCTCCTCTGGCACCTGCTGG + Intergenic
1090844913 11:130522443-130522465 TCAGCCCTGCTGTCATCAGGAGG - Intergenic
1093127383 12:15347074-15347096 TCATCTTAGCTGAGACCTGGAGG - Intronic
1094363092 12:29651095-29651117 TCACCTCTGCTCAGACCTGGAGG - Intronic
1095497938 12:42805098-42805120 TGATCACTGCAGACACCTGGTGG + Intergenic
1096705878 12:53421741-53421763 TCTCCTCTGCTGACCTCTGGTGG + Intergenic
1096759882 12:53832336-53832358 GCAGCTCACCTGAGACCTGGGGG - Intergenic
1096865703 12:54561463-54561485 TCAGTTCTACTGGGACCTGGAGG + Intronic
1098031287 12:66257396-66257418 TCAGCTATGCTGTCAGCTGGGGG - Intergenic
1099286517 12:80718756-80718778 TCAGCTCCTCTGACACCCAGAGG - Intronic
1099877116 12:88421077-88421099 TCAGCTCAGTTGATACCTTGGGG + Intergenic
1100574603 12:95878605-95878627 TCAGCTCTGCTGCTATTTGGGGG - Intronic
1101144551 12:101829036-101829058 TCACCTCTCATGACACCTGTTGG + Intronic
1101818306 12:108162748-108162770 TGACCTCTGCTCAGACCTGGAGG + Intronic
1106125553 13:26897715-26897737 TAAGCTCTGCTTCCACCTGAGGG + Intergenic
1106189193 13:27436214-27436236 ACTGCTCGGCTGACACCTTGGGG - Intronic
1106236206 13:27862651-27862673 TCACCTCAGCTGACACCACGAGG - Intergenic
1107305763 13:39016978-39017000 GCAGCACTGCTGCCATCTGGAGG + Intronic
1108831676 13:54487064-54487086 CTACCTCTGCTGTCACCTGGCGG + Intergenic
1110608680 13:77464061-77464083 TGAGTCCTGCTGAAACCTGGTGG + Intergenic
1112412513 13:99176571-99176593 TCAGCACTGCTGCCACTTGTTGG + Intergenic
1113077060 13:106477421-106477443 CCAGATTTGCAGACACCTGGTGG - Intergenic
1113672816 13:112186388-112186410 TCAGATACGTTGACACCTGGGGG - Intergenic
1113850705 13:113416035-113416057 TCAGCTCTGCCGCCGCCTGGGGG - Intergenic
1117242601 14:53850023-53850045 TCAGCACTCCTGACAACTGGGGG - Intergenic
1117466738 14:56001480-56001502 ACAGCTCTGGGGGCACCTGGAGG - Intergenic
1117667918 14:58076758-58076780 TCAGGTCTGCTGTCATCAGGTGG - Intronic
1117821626 14:59656412-59656434 GCAGCACTGCAGCCACCTGGAGG - Intronic
1121047628 14:90799627-90799649 CCAGCTCTGTTCACACCTCGGGG - Intronic
1122058583 14:99121721-99121743 TGAGCCCTGCGGATACCTGGGGG - Intergenic
1122179854 14:99947058-99947080 TCTGCTCTTCTGCCACCAGGTGG - Intergenic
1122370238 14:101225539-101225561 TCACCCCTGCTGACTCCTGGCGG + Intergenic
1122723883 14:103737802-103737824 TCACCTCTGCAAACAGCTGGTGG - Exonic
1125478430 15:40063356-40063378 TCAGCGATGCTGACAGCAGGAGG - Intergenic
1125503857 15:40255557-40255579 TCTGCTCAGCTGTCACCTGCGGG - Intronic
1125887753 15:43241249-43241271 TGAGCTCTGCTTACGCCAGGAGG + Intronic
1126288880 15:47048446-47048468 CCAGTTCTGCAGAAACCTGGGGG + Intergenic
1128111409 15:65078383-65078405 TGGGCTCTGCTGAGAGCTGGTGG + Intergenic
1128721033 15:69948395-69948417 GCTGTTCAGCTGACACCTGGAGG - Intergenic
1129579753 15:76795381-76795403 TCAGCCCAACTGACACCTGTGGG + Exonic
1129605813 15:77024461-77024483 GCAGCTCGGCTGCCCCCTGGCGG - Intronic
1129705089 15:77789752-77789774 CCAGCCCTGCTGACACCTTGGGG + Intronic
1131109519 15:89756321-89756343 TGGGCTCTGCTGACAGCTGCAGG - Intergenic
1132079155 15:98850409-98850431 TGGGTTCTGCAGACACCTGGGGG + Intronic
1132309239 15:100844863-100844885 TGACCTCAGATGACACCTGGAGG + Intergenic
1132663537 16:1071860-1071882 CGAGTTCTGCTGTCACCTGGGGG + Intergenic
1132680070 16:1136529-1136551 TCACCTGTGCAGACACCTGCTGG + Intergenic
1133035596 16:3032362-3032384 TCGGCTCTGCTGATGCCTTGTGG + Intronic
1133484955 16:6210866-6210888 TCAGCTGAGCTGACACCTCTAGG - Intronic
1134469653 16:14512538-14512560 TCTGCTCTAAAGACACCTGGGGG + Intronic
1135022800 16:18976977-18976999 TCAACTCTCCTGACACCAGCTGG - Intergenic
1135516905 16:23143711-23143733 TCAGCACTACTGACACTTTGGGG + Intronic
1135962069 16:27003331-27003353 TGGCCTCTGTTGACACCTGGTGG - Intergenic
1136045260 16:27610188-27610210 TCCTCCCTGCTGCCACCTGGGGG - Intronic
1137760417 16:50935729-50935751 ACAGGTCAGCAGACACCTGGTGG + Intergenic
1139620518 16:68137385-68137407 TCAGCTCTGTTGTTACCTGTGGG + Intronic
1141568225 16:84917901-84917923 CCATCTCTGCCGACACCTCGGGG - Intronic
1141664956 16:85461267-85461289 ACAGCGCTGCTGGCACCTGGTGG - Intergenic
1141761573 16:86032244-86032266 TCAGCACTGCTGATTCCTGCGGG - Intergenic
1142114200 16:88347960-88347982 TCTGGGCTCCTGACACCTGGCGG - Intergenic
1142144864 16:88488691-88488713 TCCCCTCTGCTGGCAGCTGGGGG - Intronic
1142401542 16:89861221-89861243 TCACCTTTGCTGACATCTTGAGG + Intronic
1142613289 17:1120986-1121008 TCATCTCAGCTGACAAGTGGGGG - Intronic
1142708305 17:1709978-1710000 TCAGCTCTGGAGACGCCCGGCGG + Intronic
1143585798 17:7849529-7849551 TCGGCCCGGCTGACACCCGGTGG - Exonic
1143620001 17:8075328-8075350 TCATCTCTGCAGAGACCTGGAGG - Intronic
1144322548 17:14143885-14143907 TTAGCACTCCTGACACCTGTTGG - Intronic
1144679586 17:17183939-17183961 TCAGCCCTGCTGACTCCCTGTGG - Intronic
1146690996 17:34876093-34876115 CCAGGTCTGCTGACAACTGAGGG + Intergenic
1146793758 17:35767099-35767121 TGCCCTCTGCTGACACCTGCTGG - Intronic
1147978897 17:44262812-44262834 TCAGCAGTGCTCCCACCTGGAGG - Intronic
1147988638 17:44320421-44320443 TCAGCACTGCAGCCACCTGGTGG + Exonic
1148194005 17:45700238-45700260 TCAGTTCTGTTGAGCCCTGGAGG + Intergenic
1150131606 17:62672200-62672222 TCAGCTGGGGTGGCACCTGGAGG - Intronic
1151389865 17:73779058-73779080 AAAGCTCTGCTGACATCTGATGG - Intergenic
1152681959 17:81673062-81673084 TCGGCTCTGCTGACTCCCGGGGG - Exonic
1153571903 18:6482285-6482307 TCAGCTCTTCTGAAAACTGCAGG + Intergenic
1155437891 18:25832212-25832234 GCAGTTCTGCTGCCACATGGGGG - Intergenic
1156295941 18:35791023-35791045 TCAGCCTTGCTGCCACCTTGAGG - Intergenic
1157194254 18:45607769-45607791 TCAGGGCTGCTGTCACCTGAAGG + Intronic
1157379959 18:47205093-47205115 TGACCTCTGCTGTCCCCTGGTGG + Intergenic
1157446335 18:47749265-47749287 TGAGCTCTGCTGACCCCTGGCGG + Intergenic
1157602849 18:48904891-48904913 CAAGCTCTGGTAACACCTGGTGG + Intergenic
1157651384 18:49335851-49335873 TCACCTAGGCTGACACCTAGTGG + Intronic
1157907769 18:51584994-51585016 TCAGACCTGCTGAGACCTGGGGG - Intergenic
1160411807 18:78680097-78680119 TCAGCAGTGCTGAGACATGGGGG + Intergenic
1161860310 19:6792912-6792934 TCAGCGCTGTTGACATTTGGTGG - Intronic
1162119728 19:8456240-8456262 CAAGCTCTGCTGCCACCAGGAGG + Intronic
1162822501 19:13231530-13231552 TCAGCACTGTTGACATTTGGGGG - Intronic
1162840829 19:13355322-13355344 TCAGCTCTGCTAACATCTTGGGG + Intronic
1163322010 19:16580340-16580362 TGAACTCTGCTAACACCTGAAGG - Intronic
1165154375 19:33778234-33778256 AGAGCGCTGCTGCCACCTGGCGG - Intergenic
1165406968 19:35636987-35637009 GGAGCTCTGCTGGCACCTGGAGG - Intronic
1165459239 19:35934767-35934789 ACAGCTATGCTAAAACCTGGTGG - Intergenic
1167039287 19:47013137-47013159 GGCGCTCTGCTGACCCCTGGTGG - Intergenic
1167167006 19:47805100-47805122 TAAGCTCTGCTTACACCTATAGG - Intronic
1167192981 19:48004605-48004627 ACAGGTAAGCTGACACCTGGAGG - Intronic
1167837398 19:52085437-52085459 CCAGCTCTGCTGTCCCCTTGGGG + Intronic
1168241761 19:55092311-55092333 GCAGCTCTGCATACAGCTGGGGG + Exonic
1168486666 19:56768361-56768383 TCATCTCTGCTGGCCCCTGTAGG - Intergenic
925406362 2:3607842-3607864 TTTGCTCTTCTGACACCTGACGG + Intronic
925680458 2:6415732-6415754 TCAGCTCTTCTGCCAGCTGGTGG + Intergenic
925828018 2:7869421-7869443 GCAGCTGTGTTGCCACCTGGAGG + Intergenic
927208892 2:20626821-20626843 TCTGCTCCTCTGAGACCTGGAGG + Intronic
927414741 2:22867318-22867340 TCAGCTATTCTGATACCTTGAGG - Intergenic
929008186 2:37415652-37415674 TCAGCTCTGTCAACACCGGGTGG + Intergenic
929907216 2:46056727-46056749 TCAGCCCTGCTACCACCTGCTGG - Intronic
930046222 2:47175738-47175760 GCTGCTCTGCTGGCACCTGCAGG - Intronic
930981360 2:57529599-57529621 TGAGTTCTCCTGACATCTGGTGG - Intergenic
931451441 2:62370477-62370499 TCAGCACTACTGACATTTGGGGG - Intergenic
932505011 2:72220401-72220423 TCATCTCTGCTGCCCCCAGGGGG - Intronic
932735304 2:74250288-74250310 TAAGATCTGCCGCCACCTGGTGG - Intronic
933042639 2:77487948-77487970 TGAGGTATGCTGACAACTGGAGG - Intronic
933254093 2:80060803-80060825 TCAACACTCCTGACAGCTGGTGG - Intronic
934949625 2:98567434-98567456 CCAGCTCTGCTCACACCTTTGGG - Intronic
934952497 2:98586936-98586958 TCTGGTCTGCTGTCTCCTGGAGG - Intronic
936032653 2:109084750-109084772 TCATTTCTGCTGACAAGTGGTGG - Intergenic
937013294 2:118581011-118581033 CCTGTTCTGCTCACACCTGGGGG + Intergenic
937810461 2:126194280-126194302 CCAGCTCTGCTGGAACCTGCAGG + Intergenic
938186210 2:129234242-129234264 ACAGCTCTGGTGACATCTGCAGG + Intergenic
938766959 2:134466328-134466350 TCAGGTGTGCTGCCACCAGGTGG + Intronic
943078069 2:183222301-183222323 GCAGCTCTGCTCACAGATGGTGG + Intergenic
945592009 2:211745493-211745515 TGAAGTCTACTGACACCTGGTGG - Intronic
946382396 2:219358197-219358219 TCAGCGCTGATGACAGCGGGGGG - Intergenic
946432308 2:219632255-219632277 TCAGCTCCACGAACACCTGGGGG - Exonic
948354257 2:237365214-237365236 ACAGCCCTGCCGACACCTCGAGG + Intronic
1170787084 20:19476989-19477011 CCAGCTCAGCTGACACCCGTAGG - Intronic
1171351490 20:24506450-24506472 TCAGCTGTGGTGGCACCAGGGGG - Intronic
1171800278 20:29606620-29606642 CCAGTTCTGCAGAAACCTGGGGG + Intergenic
1171843822 20:30250083-30250105 CCAGTTCTGCAGAAACCTGGGGG - Intergenic
1172330632 20:34073993-34074015 TCAGCTCTGCTACCGACTGGTGG - Intronic
1173142081 20:40493409-40493431 TTAGGTCTGCAAACACCTGGGGG + Intergenic
1173149834 20:40557549-40557571 GCAGCCCTGCTGACACCTTGAGG - Intergenic
1173202742 20:40966224-40966246 GGAGCTCTGCTGTTACCTGGTGG - Intergenic
1173283407 20:41649164-41649186 TCAGCTGTGCCCACACATGGGGG + Intergenic
1174424408 20:50421991-50422013 TCAGCTGTGCTGCCTCCTGAGGG - Intergenic
1174513999 20:51077144-51077166 CCAGCTCTCCTGACACCAGTGGG - Intergenic
1178488680 21:33034248-33034270 TGAGCCCTGCTGAGTCCTGGAGG + Intergenic
1179054354 21:37916985-37917007 TGAGCTTTGCTTGCACCTGGTGG + Intergenic
1179570665 21:42276888-42276910 TCAGATGTGCCGACACCTGCAGG - Exonic
1180090633 21:45532172-45532194 GCAGCATTGCTAACACCTGGTGG - Intronic
1181342570 22:22194382-22194404 TCAGTGTTGCTGACACCTTGGGG - Intergenic
1181422214 22:22810147-22810169 GCAGCTCTGCTGCCCCCTGCTGG - Intronic
1181819238 22:25462711-25462733 GATGCTTTGCTGACACCTGGTGG - Intergenic
1181951414 22:26556599-26556621 TCACCTATGTTGTCACCTGGAGG + Intronic
1182791321 22:32955434-32955456 TGAGCCATGCGGACACCTGGGGG + Intronic
1183626113 22:39003259-39003281 TCAGCTCTTCTGCCCCCTTGCGG + Intergenic
1184072465 22:42154548-42154570 TCCCCTCTGCTGACACCAGAAGG - Intergenic
1184112998 22:42406124-42406146 ACAGCTCACCTGACACCTGCGGG + Intronic
1184669757 22:46006510-46006532 TCCCCTCTGCTGCCCCCTGGTGG - Intergenic
1184691050 22:46117398-46117420 TCAGGTCTGATGAGGCCTGGGGG + Intergenic
1185165137 22:49256947-49256969 CCAGCTGTGCTGGCATCTGGTGG - Intergenic
1185228295 22:49666155-49666177 TCAGCTCAGTAGACTCCTGGAGG - Intergenic
950520271 3:13493962-13493984 GCAGATCTTCTGACATCTGGGGG + Intronic
951905862 3:27706967-27706989 TCAGCTCTATTGACATTTGGAGG - Intergenic
953996321 3:47522722-47522744 CGTGCTCTGCAGACACCTGGGGG - Intergenic
954072178 3:48151025-48151047 TTACCTTTGCTGACACCTGCAGG - Intergenic
954146694 3:48637923-48637945 TCAGCTTTTCTGTCTCCTGGGGG - Exonic
955412027 3:58661924-58661946 GCTGCTCTGCTGGGACCTGGAGG - Intronic
956634057 3:71345721-71345743 TCAGCACTGCTGAGAGCAGGCGG + Intronic
956716658 3:72085670-72085692 TCGGCTCTGCTGACTCCCAGGGG - Intergenic
956717068 3:72088106-72088128 TCAGCTCTGCTGACTCCCAGGGG - Intergenic
956737322 3:72247735-72247757 CCAGTTCTCCTGACAGCTGGTGG - Intergenic
956783137 3:72620271-72620293 TCAGGACTGCTTCCACCTGGAGG - Intergenic
957568705 3:81918144-81918166 TCATCTCTGCTGACAGGTGATGG + Intergenic
957964729 3:87307508-87307530 TCATCACTCTTGACACCTGGTGG + Intergenic
958855322 3:99377310-99377332 TCAGCTCTGCTGAAAGCAGCAGG - Intergenic
961646031 3:128393251-128393273 TCAGCTCTGCAGGTGCCTGGGGG - Intronic
962342985 3:134601002-134601024 TCCGCACTTCGGACACCTGGGGG + Intronic
965800166 3:172484285-172484307 TGAGCTATGCAGACATCTGGAGG + Intergenic
967197306 3:187039583-187039605 GCAGCAGTGCAGACACCTGGAGG + Intronic
967929646 3:194681453-194681475 TCAGTTCTGCTGAGCTCTGGGGG + Intergenic
968457828 4:707713-707735 ACAGCTCTGTTTTCACCTGGGGG + Intronic
968457838 4:707749-707771 ACAGCTCTGTTTTCACCTGGGGG + Intronic
968857336 4:3136614-3136636 TCAATTCTGCTGCCACCTGGAGG + Intronic
969115476 4:4868352-4868374 TCTGCTGTGCTGACACCAGAGGG + Intergenic
969342271 4:6549634-6549656 TGGGCTCTGATGACACCTGCTGG + Intronic
969610416 4:8224937-8224959 GGAGCACTGCTGACACCTGAGGG - Intronic
969648649 4:8449116-8449138 TCAGCACTGCTGGGACCTGGGGG + Intronic
975514800 4:75234747-75234769 TCACTTCTGCAGGCACCTGGAGG - Intergenic
975559785 4:75698402-75698424 GCAGCCCTGCTGACACCTAGAGG + Intronic
976586383 4:86801779-86801801 TGGGCTCTGCTGACCCATGGAGG - Intronic
979067017 4:116150346-116150368 TCTGCTCTGGTGACATCTAGAGG + Intergenic
980180271 4:129392955-129392977 TCCTCTCTGCTGAGAACTGGGGG + Intergenic
981168241 4:141588640-141588662 TCAGCTATGCTGAGATCTGCTGG - Intergenic
981692869 4:147528846-147528868 GCAGCTCTGAGGACACCTGTAGG + Intronic
981739239 4:147985097-147985119 GCAGATCTCCTGGCACCTGGAGG - Intronic
983008106 4:162510360-162510382 TCAGCTCTCCTGACCCCTTCAGG + Intergenic
984045836 4:174797230-174797252 TCAGCTCTGTTGAAACTAGGAGG - Intronic
985042201 4:185902810-185902832 TCACCTCTGCTGACAGCAGTTGG + Intronic
986064123 5:4219399-4219421 GCAGCCCTGCTGAAAACTGGAGG - Intergenic
986285568 5:6355996-6356018 CCAGCCCTGCTGACACCTTCAGG - Intergenic
987979862 5:25068922-25068944 GCAGCTCTGCTGAATGCTGGTGG + Intergenic
989332502 5:40276272-40276294 TCATCTTTGGAGACACCTGGGGG + Intergenic
990671626 5:58137002-58137024 TCAGCTCTTAGGGCACCTGGAGG + Intergenic
991220806 5:64213774-64213796 GAAGCTCTGCTGACAGGTGGTGG + Exonic
991565106 5:67997006-67997028 TCAGGGCTGATGACACCTTGAGG + Intergenic
992723016 5:79579077-79579099 TCACATTTGCTGAAACCTGGAGG + Intergenic
993138040 5:83995253-83995275 TCAGCTCCCCTAACACCAGGGGG + Intronic
994214943 5:97127097-97127119 ACATCTCTGCTGACTTCTGGAGG - Intronic
994840622 5:104920725-104920747 TGGGCTCTGTTGACACCTAGTGG - Intergenic
994873998 5:105392254-105392276 GCACCTGTGCTGGCACCTGGAGG - Intergenic
995857952 5:116613673-116613695 TCAGCTCTCCTGATACCCAGTGG + Intergenic
996091937 5:119359802-119359824 TCAGCTCTGATGAAACCAAGGGG + Intronic
997398175 5:133581239-133581261 CTAGCTCTGCTGACCACTGGGGG - Intronic
997481467 5:134188265-134188287 TCAGCTCAGCTGGTGCCTGGTGG + Intronic
997625481 5:135328063-135328085 TCAGCCCGGGTGACAGCTGGGGG - Intronic
997657149 5:135563932-135563954 ACAGCTCTGCAGACAGCTGGGGG + Intergenic
997694251 5:135849191-135849213 TCAGCTCTGTAGACAAGTGGAGG - Intronic
999080861 5:148842378-148842400 TAAGCTCTGCTGTGACCTCGAGG - Intergenic
999153770 5:149443670-149443692 TCAGCTCCGCTGCCTCCTGCCGG + Intergenic
999369886 5:151048254-151048276 CCAGCTCTGCTGACTCCACGTGG - Intronic
1000118101 5:158172144-158172166 TCAGATCTTCTGACTCCTGAAGG + Intergenic
1002276447 5:178107184-178107206 CCAGCTCTGCTGACTCGGGGAGG + Intergenic
1002836372 6:868591-868613 TCTGCTCTGCTGTCCCCGGGTGG - Intergenic
1003552887 6:7114559-7114581 TCAGCTCTGCTGACGTATGGGGG - Intronic
1005840071 6:29738564-29738586 GCAGCTGTGCTCACACCTGGAGG - Intergenic
1006314039 6:33279844-33279866 TAAGCTCTGCAGGTACCTGGGGG + Exonic
1006560602 6:34908379-34908401 TCACCTCCGCTGACTCCTGCTGG - Intronic
1006913294 6:37578258-37578280 TCAGCTCTGCAGACGCCTGGGGG + Intergenic
1007054899 6:38873113-38873135 GCAGCTCTGCTCTCAGCTGGAGG + Exonic
1007511838 6:42380082-42380104 TCAGCCATGCAGATACCTGGGGG + Intronic
1008513630 6:52299497-52299519 TCAGCTGTGCTTACAGCTGTGGG + Intergenic
1010125953 6:72432011-72432033 TCAGCTCTTCTGACACCCTTAGG - Intergenic
1013543767 6:111135873-111135895 TCAGCTCTGCTCACAGCAGAGGG + Intronic
1014232130 6:118915500-118915522 TCTGATCTGCTGTCACCTGAGGG - Intronic
1014518132 6:122404144-122404166 TCATCTCTGCTGACATGAGGGGG - Intronic
1014722286 6:124932198-124932220 TCAGCCATGCTTACATCTGGAGG + Intergenic
1015960216 6:138640913-138640935 TCAGCTTTGCTGACATCAGTGGG + Intronic
1017999811 6:159569140-159569162 TTAGCCCCACTGACACCTGGAGG - Intergenic
1018623143 6:165751051-165751073 TGAGCTGTGCTGTCTCCTGGGGG + Intronic
1018824946 6:167401940-167401962 TCAGTTCTGCTGCATCCTGGTGG + Intergenic
1018825436 6:167405062-167405084 GCAGCCCTGCTGACGCCTGCTGG - Intergenic
1018972303 6:168538001-168538023 TGAGCTCTGCTGGAATCTGGGGG + Intronic
1019191670 6:170254774-170254796 TCATATCTTCTGACACCCGGGGG + Intergenic
1019303650 7:322272-322294 GGCGCTCTGCTGCCACCTGGTGG - Intergenic
1019517236 7:1445413-1445435 GGAGCACTGCTTACACCTGGGGG + Exonic
1020001251 7:4757210-4757232 TCAGCTTTCCTAACAGCTGGAGG - Intronic
1020680807 7:11234373-11234395 TCAGCTGTGCTGAATTCTGGAGG + Intergenic
1022341174 7:29469597-29469619 TGAGCCATGCTGACATCTGGAGG - Intronic
1022833473 7:34091497-34091519 TAAGGTATGCTGACACCAGGTGG + Intronic
1023179178 7:37464179-37464201 TCAGTTGTGCTGACTCCTTGAGG - Intergenic
1025292218 7:57739946-57739968 CCAGTTCTGCAGAAACCTGGGGG - Intergenic
1026759437 7:73115407-73115429 CTGGCCCTGCTGACACCTGGAGG + Intergenic
1026854351 7:73743198-73743220 TCAGCTGTGCTGGCACCAGTCGG + Intergenic
1026984296 7:74545370-74545392 ACAGTTCCGCTGCCACCTGGTGG + Intronic
1027087973 7:75278066-75278088 CTGGCCCTGCTGACACCTGGAGG - Intergenic
1028167681 7:87557016-87557038 TCATCTCAGCTGAGACCTGAGGG - Intronic
1029279152 7:99425502-99425524 GCAGCTCTGAGGCCACCTGGGGG + Exonic
1029394084 7:100295199-100295221 CTGGCCCTGCTGACACCTGGAGG - Intergenic
1034102060 7:148458466-148458488 AAAGCCCTGCTGACACCTGCTGG + Intergenic
1035412358 7:158655421-158655443 TCACTTCTGCAGACACCGGGTGG - Exonic
1035908803 8:3542922-3542944 GCAGCTCTCCTGAGACTTGGGGG + Intronic
1037853244 8:22350136-22350158 TCAGCTCTACTGACATTTGTGGG - Intronic
1037886040 8:22597007-22597029 TCACCTCTGGTCACAACTGGAGG + Intronic
1037950373 8:23015553-23015575 TCAGCTCTGAAGGCAGCTGGAGG + Intronic
1039012149 8:33105595-33105617 TGAGCTGTGCTGACAGCTGAAGG + Intergenic
1039093548 8:33858038-33858060 TCGGCTCCTCTAACACCTGGAGG + Intergenic
1039348419 8:36733965-36733987 CCAACCCTGCTGACACCTGTAGG + Intergenic
1039950796 8:42170978-42171000 TCATCTATGCTTACACCTGCAGG - Exonic
1042750783 8:72155362-72155384 GCAGCTCTGCTGCCACCTCCTGG + Intergenic
1043823796 8:84900895-84900917 TCAGCTCTGCTGAAACAGGCAGG + Intronic
1044666435 8:94639062-94639084 TCAGCTCTGCTGGGCCCAGGAGG - Intergenic
1046776545 8:118169786-118169808 ACAGCTTTGCTGACTCCTGGAGG - Intergenic
1048336323 8:133505011-133505033 CTAACTCTGCAGACACCTGGGGG + Intronic
1048614086 8:136055439-136055461 GCAGATCTGCTGCCACGTGGAGG + Intergenic
1048862919 8:138737095-138737117 ACAGCTCTGCAGGGACCTGGTGG - Intronic
1049271928 8:141700606-141700628 GCAGCTCTGCTGACAGCAGGAGG - Intergenic
1049694625 8:143977258-143977280 TGGGCTCTGCTGACCCCTGGTGG + Exonic
1049991848 9:998580-998602 CCGGCTCTGCTGCCCCCTGGAGG + Intergenic
1049991869 9:998678-998700 CCGGCTCTGCTGCCCCCTGGAGG + Intergenic
1049991890 9:998776-998798 CCGGCTCTGCTGCCCCCTGGAGG + Intergenic
1049991911 9:998874-998896 CCGGCTCTGCTGCCCCCTGGAGG + Intergenic
1049991932 9:998972-998994 CCGGCTCTGCTGCCCCCTGGAGG + Intergenic
1050171193 9:2818887-2818909 TCAGCTCTACTGATCCCAGGAGG + Intronic
1051093216 9:13434595-13434617 TCAGCCCTGCTTCCACATGGAGG + Intergenic
1052584990 9:30415302-30415324 CCAGCTGTGCTGAGACCTGCTGG - Intergenic
1057290397 9:93802659-93802681 ACAGCCCTGCTCACACCTGCTGG + Intergenic
1057528052 9:95819809-95819831 TCCCCTCTTCTGACACCTGAGGG - Intergenic
1057927994 9:99170084-99170106 GCAGCTCTGCTGACCCCTGAGGG + Intergenic
1058368897 9:104241793-104241815 TCAGCTCTGCTGGCAGCTGATGG + Intergenic
1059325742 9:113503216-113503238 TCAGCCCTGCTCTGACCTGGAGG - Intronic
1059329514 9:113525964-113525986 TCAGCCCTGCTGAAGCCTAGGGG - Intronic
1059456539 9:114403418-114403440 TGAGCTCTGCTGACCCAGGGTGG - Intronic
1059702093 9:116785123-116785145 TCAGTTCTACAGACACCTAGAGG - Intronic
1060794109 9:126503232-126503254 CGGGATCTGCTGACACCTGGTGG - Exonic
1060848502 9:126856494-126856516 TGAGCCCTGCTGACACCCGCTGG - Intergenic
1061008918 9:127943870-127943892 GCTGCTCTGCTGACTCCTGCTGG - Intronic
1061390920 9:130316606-130316628 GCAGCTCTGGAGACTCCTGGAGG - Intronic
1061912001 9:133729888-133729910 TCAGCTCTGCTGACACCTGGTGG + Intronic
1062104449 9:134745849-134745871 TCACCTCTTCTGGCTCCTGGTGG + Intronic
1062451638 9:136618207-136618229 TCTGGCCTGCTGTCACCTGGGGG + Intergenic
1062498200 9:136841454-136841476 TGGGCGCTGCTGACAGCTGGAGG - Intronic
1203621196 Un_KI270749v1:130752-130774 TCTGCTCTGCACACACCTTGGGG + Intergenic
1185629943 X:1508436-1508458 TCAGCACTGCTGACATTTTGGGG - Intronic
1186628822 X:11325951-11325973 TCAGCTCTATTGACATTTGGGGG - Intronic
1187253206 X:17618037-17618059 TCAGATCTGCTGACACATTTGGG + Intronic
1188197243 X:27251596-27251618 TAGTCTCTGCTGACACCGGGGGG + Intergenic
1189252949 X:39615020-39615042 TCAGCGCTGCTGGAACCAGGTGG + Intergenic
1190322210 X:49186015-49186037 TCAGCACTCCTGGGACCTGGTGG - Intronic
1195042768 X:101029282-101029304 TCAGCACTACTGACATTTGGGGG + Intronic
1200622043 Y:5462306-5462328 TCAGCTCTGAGGACATCTGTTGG + Intronic