ID: 1061912868

View in Genome Browser
Species Human (GRCh38)
Location 9:133734137-133734159
Sequence CAGCAGCCACACGTAGGGCT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 155}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061912855_1061912868 12 Left 1061912855 9:133734102-133734124 CCCCATGCCCCGGGTAGGGCTCT 0: 1
1: 0
2: 0
3: 6
4: 119
Right 1061912868 9:133734137-133734159 CAGCAGCCACACGTAGGGCTCGG 0: 1
1: 0
2: 0
3: 12
4: 155
1061912859_1061912868 5 Left 1061912859 9:133734109-133734131 CCCCGGGTAGGGCTCTGGCGAGG 0: 1
1: 0
2: 2
3: 3
4: 98
Right 1061912868 9:133734137-133734159 CAGCAGCCACACGTAGGGCTCGG 0: 1
1: 0
2: 0
3: 12
4: 155
1061912856_1061912868 11 Left 1061912856 9:133734103-133734125 CCCATGCCCCGGGTAGGGCTCTG 0: 1
1: 0
2: 0
3: 10
4: 113
Right 1061912868 9:133734137-133734159 CAGCAGCCACACGTAGGGCTCGG 0: 1
1: 0
2: 0
3: 12
4: 155
1061912861_1061912868 4 Left 1061912861 9:133734110-133734132 CCCGGGTAGGGCTCTGGCGAGGG 0: 1
1: 0
2: 2
3: 36
4: 228
Right 1061912868 9:133734137-133734159 CAGCAGCCACACGTAGGGCTCGG 0: 1
1: 0
2: 0
3: 12
4: 155
1061912863_1061912868 3 Left 1061912863 9:133734111-133734133 CCGGGTAGGGCTCTGGCGAGGGT 0: 1
1: 0
2: 1
3: 21
4: 122
Right 1061912868 9:133734137-133734159 CAGCAGCCACACGTAGGGCTCGG 0: 1
1: 0
2: 0
3: 12
4: 155
1061912857_1061912868 10 Left 1061912857 9:133734104-133734126 CCATGCCCCGGGTAGGGCTCTGG 0: 1
1: 0
2: 0
3: 11
4: 185
Right 1061912868 9:133734137-133734159 CAGCAGCCACACGTAGGGCTCGG 0: 1
1: 0
2: 0
3: 12
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061912868 Original CRISPR CAGCAGCCACACGTAGGGCT CGG Exonic
900275234 1:1821709-1821731 CAGCAGCCACAGGCAGGTCATGG - Intronic
901775140 1:11555447-11555469 AAGCAGACACACGCAGAGCTGGG - Intergenic
902016133 1:13308828-13308850 CATGAGCCACAGGTAGGGCAAGG - Intronic
903593805 1:24478862-24478884 AAGCTGCCACCCCTAGGGCTGGG + Intergenic
903656045 1:24949449-24949471 CAGCACCCACACCAAGGACTTGG + Intronic
903657860 1:24959890-24959912 CGGGAGCCACAGGGAGGGCTGGG - Intronic
904377509 1:30090897-30090919 CAGCAGCCCCTCGTAGCCCTGGG - Intergenic
905268442 1:36770945-36770967 CACCAGCCACACCAAGAGCTGGG - Intergenic
907284955 1:53373716-53373738 CTGCAGCCACACCGAGGGCTGGG + Intergenic
907675306 1:56512359-56512381 CCTCAGCCACACGAAGTGCTGGG - Intronic
907826067 1:58017887-58017909 CTGCAGCCTCAAGGAGGGCTGGG - Intronic
907905746 1:58782864-58782886 GAGCAGCCCCACGTCGGGCGAGG + Exonic
915107786 1:153545167-153545189 CAGCAGCCACACCCAGTTCTGGG - Intronic
915712159 1:157910559-157910581 AAGCAGCCCCAGGTATGGCTTGG + Intergenic
916588572 1:166167997-166168019 CAGGAGCCAAACATAGTGCTAGG + Intergenic
923557126 1:235010008-235010030 AGGCAGCCACAGGCAGGGCTTGG + Intergenic
924942077 1:248818904-248818926 CAGCAGGCACATGCTGGGCTGGG - Intronic
1063005298 10:1964713-1964735 CAGCAGCCTCTCGCATGGCTGGG - Intergenic
1064242110 10:13640205-13640227 AAGCCGCCACGCTTAGGGCTGGG - Intronic
1065136666 10:22677509-22677531 CAGCAGCCACACGTGGCTCGTGG + Intronic
1068827755 10:61458381-61458403 CAGCAGCCAGAACTAGGGCAAGG - Intergenic
1070782677 10:79146696-79146718 CACCAGACACAGGCAGGGCTGGG + Intronic
1073319469 10:102605795-102605817 CAGAAGCCAGAGGTTGGGCTGGG + Intronic
1075865352 10:125714142-125714164 CAGCAGCCACACACAGGACCAGG - Intergenic
1078225118 11:9384808-9384830 CCGCGGCCTCACGCAGGGCTGGG - Exonic
1083940011 11:65890717-65890739 CAGGAGCCCCACGTCGGGCCCGG - Exonic
1083950581 11:65953502-65953524 CAGGAGCCTCACGGAGGGCCAGG - Intronic
1084164776 11:67370422-67370444 CAGCAGCCAGAGGCAGAGCTGGG - Intronic
1087104866 11:94399038-94399060 CAGCAGACACAAGAAGGGGTAGG - Intronic
1090888656 11:130902560-130902582 AGGCAGACACACGTAGTGCTTGG - Intronic
1091603736 12:1933639-1933661 CAGCAGCCAAAGGAAAGGCTTGG + Intergenic
1091744541 12:2982678-2982700 CACCAGGGACACGTGGGGCTGGG + Intronic
1093636855 12:21480908-21480930 CAACAACCACCTGTAGGGCTGGG - Intronic
1096102934 12:48980352-48980374 CAGCACCCTCATGAAGGGCTTGG - Intronic
1098311886 12:69156909-69156931 CAGCTACCACCCCTAGGGCTAGG + Intergenic
1103225068 12:119280085-119280107 CAGCAGTCTGACGAAGGGCTCGG - Intergenic
1105797539 13:23870919-23870941 CCTCAGCCCCACATAGGGCTGGG - Intronic
1107522481 13:41197058-41197080 CAGAAGCCACATGTAGCTCTTGG + Intergenic
1110442222 13:75538318-75538340 CCGCAGCCAGACTGAGGGCTGGG - Intronic
1112372328 13:98804647-98804669 CAGCAGCCACACCCAGTCCTGGG - Intronic
1113655673 13:112066888-112066910 CAGCAGCCATACGCCGGGCCCGG - Intergenic
1114191164 14:20440402-20440424 TAGAAGCCAGAGGTAGGGCTGGG - Intergenic
1118447212 14:65862883-65862905 CAGCAGCAGCACCTAGGGCCTGG + Intergenic
1119717781 14:76870928-76870950 CTGCAGCCCCATGTAGTGCTTGG + Intergenic
1120891848 14:89498514-89498536 AAGCAGCCAGACAGAGGGCTGGG - Intronic
1120979663 14:90278857-90278879 CACCAGCCCCAGGTAGGGCCAGG + Intronic
1121743172 14:96268086-96268108 CAGCAGCCACACACAGGAGTAGG + Intronic
1122169773 14:99862785-99862807 AAGCAGCAGCACGTACGGCTGGG - Intronic
1122293539 14:100692629-100692651 CAGCAGCCGCAGGGAGGACTGGG - Intergenic
1122852850 14:104546263-104546285 CAGGAAGCACACGCAGGGCTGGG + Intronic
1122902268 14:104786823-104786845 CAGCAGCCAGGTGTAGGGCGCGG - Intronic
1123156459 14:106232002-106232024 CAGGAGCCAGACATAGGACTGGG - Intergenic
1127311152 15:57753321-57753343 AACCAGCCACGGGTAGGGCTGGG - Intronic
1128793216 15:70448226-70448248 CAGCAGTGACAAGGAGGGCTTGG + Intergenic
1131700190 15:94927184-94927206 CATCAGCCTCACGGAGTGCTGGG - Intergenic
1136280241 16:29204105-29204127 CAGCAGCCACAAGTGGGACTCGG - Intergenic
1137774724 16:51045387-51045409 CAGCAGCCTCATGAAGGGCTTGG + Intergenic
1138376859 16:56570132-56570154 GAGCAGCCCCAGGTTGGGCTGGG + Intergenic
1139472881 16:67187595-67187617 CAGCAGCCACCAACAGGGCTGGG + Exonic
1139652339 16:68368671-68368693 AGGCAGCCAGATGTAGGGCTGGG + Intronic
1140220886 16:73043036-73043058 CAGCAGCCAGGAGTAGGGGTGGG + Intronic
1142084603 16:88170047-88170069 CAGCAGCCACAAGCGGGACTCGG - Intergenic
1146952330 17:36915530-36915552 CATCAGCCACACGCTGGGTTAGG + Intergenic
1147649096 17:42051777-42051799 CAGCAGCCACTGGTGGGGCTGGG - Intronic
1148183078 17:45620609-45620631 CAGCGCCCACTCGTAGGCCTGGG + Intergenic
1148265773 17:46225082-46225104 CAGCGCCCACTCGTAGGCCTGGG - Intronic
1150063968 17:62093034-62093056 CATCATCCACACGTATTGCTTGG - Intergenic
1151535665 17:74737516-74737538 CAGCAGAGACACCTAGAGCTTGG - Intronic
1152307339 17:79529018-79529040 CAGCAGCCTCAGGTAGAGGTGGG + Intergenic
1157996485 18:52563503-52563525 CAGCAGGCACACATAAGGATGGG + Intronic
1161013517 19:1971297-1971319 CAGCAGCCTCCCCAAGGGCTGGG - Intronic
1161067938 19:2247723-2247745 CAGCAGGCACGGGTGGGGCTAGG - Intronic
1162019856 19:7863413-7863435 CAGCAGCCGCACCTGGGGCGGGG - Exonic
1162460600 19:10811869-10811891 TAGCATCCACACAGAGGGCTAGG - Intronic
1162474042 19:10889163-10889185 CAGCTGCCCCAAGTAGTGCTTGG + Intronic
1162750371 19:12825870-12825892 GAGCAGCCACCGGTAGGGCGTGG + Exonic
1165496307 19:36153951-36153973 TAAGAGCCACAAGTAGGGCTGGG + Intergenic
1165752036 19:38266077-38266099 CAGTAGCCACACGGAGACCTGGG + Intronic
1167499059 19:49835543-49835565 CAGCAGGCACCCCCAGGGCTGGG + Exonic
1167745927 19:51351839-51351861 CAGCAGGCTCAGGTAGAGCTGGG - Intronic
1168401528 19:56088320-56088342 CTCCAGACACACGTACGGCTTGG + Exonic
1168689447 19:58368064-58368086 CAGTGGGCACGCGTAGGGCTTGG + Exonic
925173668 2:1767668-1767690 CACCAGCCCCACGGAGGGCGTGG - Intergenic
927695106 2:25234512-25234534 CAGCAGCCACCCGAAGTGCAGGG + Intronic
927948141 2:27149632-27149654 CAGCAGCCAGTGGTAGGACTGGG + Intronic
930711033 2:54551347-54551369 CAGCAGCCAGAGCCAGGGCTGGG - Intronic
938408157 2:131044201-131044223 CAGCAGCCCCTCCTATGGCTGGG + Intronic
940855368 2:158724956-158724978 CACCAGCCACCTGAAGGGCTGGG - Intergenic
941620553 2:167773476-167773498 CAGCAGTCACACGTTAGGTTTGG + Intergenic
944222688 2:197317983-197318005 CAGCTACCACCAGTAGGGCTGGG - Intergenic
945929317 2:215839533-215839555 CAGCATCCACAATTAGGCCTGGG + Intergenic
947718468 2:232353302-232353324 CAGCTGCCTCACTCAGGGCTTGG - Intergenic
947742254 2:232490033-232490055 CAGCTGCCTCACTCAGGGCTTGG - Intergenic
949031643 2:241799931-241799953 CAGCGGCCAGATGTAGGGCTGGG - Intronic
1170429628 20:16264241-16264263 CAGCTGCCTCCCTTAGGGCTGGG - Intergenic
1170956391 20:20983897-20983919 CAGCAGCAAAATGTAGTGCTTGG + Intergenic
1171335259 20:24379777-24379799 CAGCAGCCACTCCCAGGGCATGG - Intergenic
1179444893 21:41424349-41424371 CAGGATCCACTCCTAGGGCTGGG - Intronic
1180248628 21:46564826-46564848 CACCAGCCACACTCAGGGTTGGG - Intronic
1184776610 22:46626564-46626586 CAGCTCCCACACGCAGGGCACGG - Intronic
949364959 3:3271104-3271126 CAGGAGGCACAAGTAGGGATGGG - Intergenic
952905582 3:38137456-38137478 CCGCAGCCAAACGGAAGGCTGGG + Intergenic
952945620 3:38476514-38476536 CAGCAACCACACCTGGTGCTCGG - Intronic
952964507 3:38612801-38612823 AAGCAGCCACACTTAGAACTGGG - Intronic
960611927 3:119562595-119562617 CAGCATCCACAGGGAGGGCTGGG + Intergenic
963924751 3:150939405-150939427 CAGCTACCACCCCTAGGGCTTGG - Intronic
967813055 3:193776403-193776425 CAGCAGGCACACTGAGGGATGGG + Intergenic
969411672 4:7032444-7032466 CACCAGGAACACGCAGGGCTGGG - Exonic
969670462 4:8587349-8587371 CAGCAGACACACTGAGGGCCTGG + Exonic
970031057 4:11675225-11675247 CAGAAGCCAGACATAGAGCTTGG + Intergenic
970544336 4:17112096-17112118 CAGCTACCACCCATAGGGCTGGG + Intergenic
973217258 4:47683262-47683284 CAGCAGCTACACCCAGGGTTAGG - Intronic
979624234 4:122827454-122827476 CAGAAACCACACGGAGCGCTAGG - Intronic
981546909 4:145903009-145903031 CAGCAGCCACACGTTGGAGCTGG - Exonic
983011141 4:162549320-162549342 CAGCAGCCCAACATAGGTCTTGG - Intergenic
985748517 5:1661399-1661421 CAGCAGCCAAATGGAGGGCCCGG - Intergenic
986394379 5:7314097-7314119 CAGCAGCCACAAATAGGACCAGG + Intergenic
989689886 5:44129123-44129145 GAGCAGGCACACGTAGGGAGGGG + Intergenic
993618323 5:90138662-90138684 CAGGAGCCACAGGCAAGGCTAGG - Intergenic
993749185 5:91645556-91645578 CAGCAGCCGCGGGTAGGCCTGGG - Intergenic
997613318 5:135230140-135230162 CTGCAGCCACACCTGGGGCCTGG - Intronic
998311570 5:141137431-141137453 CGGCAGCGGCAGGTAGGGCTGGG - Exonic
998315041 5:141174835-141174857 CGGGAGCCGCAGGTAGGGCTGGG - Exonic
998383642 5:141743435-141743457 CAGCAGGCATCCGGAGGGCTAGG - Intergenic
999429126 5:151510948-151510970 CAGGAGCCACATGCAGGGATTGG + Intronic
999431965 5:151532038-151532060 CTGCAGCCACAGGAGGGGCTGGG + Intronic
1000908919 5:166997109-166997131 CAGAAGCCACACCCAGGGCTGGG + Intergenic
1002798450 6:496517-496539 GAGCAGCCACAACTACGGCTAGG - Intronic
1006911358 6:37565767-37565789 CAGCAGCCTCAGGGAGGGCTGGG - Intergenic
1007416453 6:41694073-41694095 CAGCCGGCACAGGGAGGGCTAGG + Intronic
1007607163 6:43125378-43125400 CAGCACCCACTCCTGGGGCTGGG - Intronic
1007609903 6:43142575-43142597 CAGCAGCCACACATATCTCTGGG + Intronic
1008276621 6:49550707-49550729 CAGAGGCCACACCCAGGGCTTGG + Exonic
1008420612 6:51294873-51294895 CAGCAGCCACCAGTAGGCCCAGG + Intergenic
1011046784 6:83093195-83093217 CAGCACCCAAACATAGTGCTTGG + Intronic
1011258739 6:85450360-85450382 CAGCAGCAGCACGTTGGGTTCGG - Exonic
1011562786 6:88639778-88639800 CAGCAGCCACACTCAGAGCCAGG + Intronic
1016330470 6:142947395-142947417 CAGCAGTCACTCGTCGCGCTCGG - Intergenic
1017726915 6:157282660-157282682 CATCAGCCACACCAAGGTCTTGG + Intergenic
1017747705 6:157461595-157461617 CAGCAGCTACACCTTGGGTTAGG + Intronic
1019518929 7:1451961-1451983 CAGCAGCCACACGGTGGGGTGGG + Intronic
1019539204 7:1544215-1544237 CAGGAGCCCCACACAGGGCTGGG - Exonic
1021312657 7:19112527-19112549 CAGCGGCCAGACGCGGGGCTGGG + Intronic
1023968592 7:44976292-44976314 CAGCAGCCACAGGTAGGATGAGG - Intronic
1024469499 7:49752465-49752487 CAGGAGCCACACGTGTGGCCTGG - Intergenic
1024522690 7:50319933-50319955 GAGCAGCCACACATAGGTCCTGG - Intronic
1032223333 7:130010602-130010624 CAGCACCCGCACTCAGGGCTGGG - Intergenic
1035297720 7:157876645-157876667 CAGCGCCCCCACGTGGGGCTGGG + Intronic
1036776729 8:11617894-11617916 CAGCAGCCACAGGCAGGGCGGGG + Intergenic
1037192091 8:16138621-16138643 CATCAGCCACACGATGGCCTCGG - Intronic
1042435009 8:68753929-68753951 CAGCAGCCACTGAAAGGGCTTGG - Intronic
1043447038 8:80329217-80329239 CAGCATCTACCGGTAGGGCTTGG + Intergenic
1048963751 8:139600329-139600351 CAGCAGCCACAGGATGGGTTGGG + Intergenic
1049330178 8:142046256-142046278 CAGCAGCCACACTGGGGTCTGGG + Intergenic
1049612178 8:143560875-143560897 CCGCAGCCAAGCGCAGGGCTGGG - Intronic
1050339950 9:4626549-4626571 CAGCTTCCACCCCTAGGGCTGGG - Intronic
1053463501 9:38288603-38288625 CAGCTGCCAGACAGAGGGCTGGG - Intergenic
1059234417 9:112750424-112750446 CAGCAGCCACGCTTGGGGCTGGG - Intergenic
1059735334 9:117094449-117094471 CAGCAGTCAGAATTAGGGCTGGG - Intronic
1060409638 9:123391481-123391503 CAGCAGCTAAAGGTAGAGCTAGG + Intronic
1061912868 9:133734137-133734159 CAGCAGCCACACGTAGGGCTCGG + Exonic
1062726019 9:138074002-138074024 GAGCAGACACACGTAGGGCAGGG - Exonic
1187266194 X:17736794-17736816 CAGCACCCACAAGTTGGACTGGG - Intergenic
1191252056 X:58264432-58264454 CAGCAGCTACTCCGAGGGCTAGG + Intergenic
1192218153 X:69178195-69178217 GAGCAGCCAGAGGCAGGGCTTGG - Intergenic
1199720682 X:150541049-150541071 CAGGTGCCAGATGTAGGGCTGGG - Intergenic
1200118862 X:153781134-153781156 CAGTAGCAGCAGGTAGGGCTCGG + Exonic
1200127095 X:153820787-153820809 CAGCCGCCAGATGCAGGGCTGGG - Intronic