ID: 1061912910

View in Genome Browser
Species Human (GRCh38)
Location 9:133734305-133734327
Sequence ATGGGGAAGTGGCAAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1067
Summary {0: 1, 1: 0, 2: 11, 3: 114, 4: 941}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061912910 Original CRISPR ATGGGGAAGTGGCAAGAGGA AGG (reversed) Intronic
900278153 1:1846660-1846682 AGGGGGCTGAGGCAAGAGGATGG - Intronic
900760462 1:4467000-4467022 ATGGGGCAGTGGGAGGAGGTTGG - Intergenic
901286835 1:8087107-8087129 ATGGGGAAAAGGCAGGAGGGAGG - Intergenic
901669859 1:10849835-10849857 ATAGGGAAGTGGACAGTGGAAGG + Intergenic
901791442 1:11655303-11655325 AGGTGGGAGTGGCAAGAGGGTGG - Intronic
902242237 1:15096715-15096737 ATGGGGAAGAAGGAAGAGGGAGG + Intronic
902749738 1:18499451-18499473 ATGGGGACCTGGAAAGGGGAAGG - Intergenic
902798395 1:18814552-18814574 GTGGGGAAGTGGGAAGAGAAAGG - Intergenic
904106764 1:28091134-28091156 ATGGGAAAGTACAAAGAGGATGG - Intergenic
904344940 1:29861602-29861624 ATGGGGCAGTGGCAGAGGGATGG + Intergenic
904473033 1:30747600-30747622 TTGGGGAAGTGGCCAGGGGCAGG + Intronic
904807963 1:33145077-33145099 ATGGGGCAGTGGCAAGAGCCTGG - Intergenic
905294775 1:36947290-36947312 ATGGGGGCAGGGCAAGAGGAGGG - Intronic
905818222 1:40968530-40968552 TTGGGGAAGTGGTAATTGGAAGG + Intergenic
905830193 1:41059500-41059522 ATGGGGAGCTGGAAAGGGGATGG - Intronic
905886038 1:41492534-41492556 ATGGGGAGGTGGCGAGTAGATGG - Intergenic
905949883 1:41941205-41941227 ATGGGGCAGTGGGTAGAGTAGGG + Intronic
906069961 1:43008920-43008942 ATGGGAATGTGGGAGGAGGAGGG + Intergenic
906860497 1:49353882-49353904 TTGGGGAGCTGGAAAGAGGATGG - Intronic
907485947 1:54778231-54778253 TTGGGGAACTGGCATGAGGCTGG + Intergenic
908260397 1:62335763-62335785 ATGTGGAAGTGACAAGAGGGAGG + Intergenic
908262450 1:62349520-62349542 AGGGGGAAGTGGGGAGGGGAAGG + Intergenic
908387221 1:63654041-63654063 ACAGGGAAGTGGGGAGAGGAGGG + Intronic
908558183 1:65278964-65278986 ATGGGGAAGGGGATGGAGGAGGG - Intronic
908896777 1:68909963-68909985 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
909685110 1:78339294-78339316 ATGGGGAGGTGGGATGAGGAAGG - Intronic
909842193 1:80341881-80341903 AGGGGGAAGTGGGTAGAAGAGGG - Intergenic
909987173 1:82175227-82175249 ATGGGAAAATAGCAAGAAGATGG + Intergenic
910105939 1:83631232-83631254 GTGGAGAAGGGGCCAGAGGAAGG - Intergenic
910149623 1:84126342-84126364 ATGGGGAGCTGGAAAGCGGATGG + Intronic
910220177 1:84881738-84881760 ATTGGAAAGGGGGAAGAGGAGGG + Intronic
910265978 1:85338062-85338084 AAGGAATAGTGGCAAGAGGAAGG - Intronic
910370724 1:86512787-86512809 TTGGGGAAGAGGCATGTGGATGG + Intergenic
910478487 1:87633992-87634014 CCGGGGAAGTGAGAAGAGGATGG + Intergenic
910488899 1:87746347-87746369 ATGGGGAACTGGAAAGGAGATGG - Intergenic
910630009 1:89344631-89344653 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
910790422 1:91044399-91044421 TTGGGGAAGAGGCATGTGGATGG + Intergenic
910831010 1:91462765-91462787 TTGGGGAAGAGGCATGTGGATGG - Intergenic
910854390 1:91680228-91680250 ATGAGGAAGTGGGAGGAGAAAGG - Intergenic
911335439 1:96575177-96575199 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
911452594 1:98083884-98083906 AGGGGGAAGACGGAAGAGGAAGG - Intergenic
911533065 1:99069119-99069141 CTGGGGAAGTGCCAAAAAGATGG + Intergenic
911656972 1:100454901-100454923 AGGGGGAAATGGCAAAAGGCAGG - Intronic
911718690 1:101166202-101166224 ATAGAGAAGAGGCCAGAGGATGG - Intergenic
911948399 1:104139718-104139740 AGGGGGATGAGGCAGGAGGATGG - Intergenic
912041469 1:105396691-105396713 ATGGGGAATTGGAAAGGGGATGG + Intergenic
912041738 1:105398696-105398718 GTGGGGAATTGGAAAGGGGATGG + Intergenic
913185210 1:116364472-116364494 ATGGTGCAGTGGAAAGAGAAGGG + Intergenic
913519536 1:119631868-119631890 AGGGGGGCGTGGGAAGAGGAGGG - Intronic
913551259 1:119919149-119919171 ATGGGAAAGTGGGAAAAGGGAGG - Intronic
913666418 1:121052495-121052517 ATGGGCAGGTGGCACCAGGAAGG + Intergenic
914000365 1:143689559-143689581 ATGGGGAACTGGAGAGAGGAAGG + Intergenic
914801423 1:150965469-150965491 AGGGGGAAGAGGCCAGAGAAAGG + Exonic
914960105 1:152197504-152197526 AGGGGGAAGGGGAAAAAGGAAGG - Intergenic
915109254 1:153552705-153552727 GAGGGCAGGTGGCAAGAGGAAGG - Intergenic
915218688 1:154356761-154356783 GGAGGGAAGTGGGAAGAGGAGGG - Intergenic
915440905 1:155944967-155944989 GTGGGGGAGTGGAACGAGGAGGG + Intergenic
916005427 1:160655065-160655087 ATGGAGAAGAGGCAAGTGGATGG - Intergenic
916600377 1:166287564-166287586 TTGGGGTAGTGGGGAGAGGATGG - Intergenic
916620201 1:166488792-166488814 GTGGGGAAGTTGGAAGAGGATGG - Intergenic
916691089 1:167190629-167190651 ATGGGGGAATGGTAAAAGGAAGG - Intergenic
917211022 1:172632100-172632122 ATGGGGAACTGGAAAGGGGATGG - Intergenic
917468370 1:175304893-175304915 ATAGGGAAGTGGAAAAGGGAAGG + Intergenic
917589195 1:176459637-176459659 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
917657294 1:177138970-177138992 ATGGCGGAGTGGAAAGAGCATGG - Intronic
917794037 1:178520187-178520209 TTGGGGAAGGGGGATGAGGAAGG + Intronic
917865568 1:179191002-179191024 AAGGGGAAGTGGGAAGTGGCTGG - Intronic
918510243 1:185304734-185304756 GTTGGGAAGAGGCAAGAGAAAGG + Intronic
918652167 1:186978817-186978839 ATGGGGAAGTGGTAAAGGGAAGG + Intronic
918833982 1:189435533-189435555 AAGGGGAAGGGGAAGGAGGAAGG + Intergenic
919113919 1:193257372-193257394 AGGGGGAGGTGGTCAGAGGATGG + Intergenic
919457952 1:197842214-197842236 ATGTGGAGGAGGGAAGAGGAAGG + Intergenic
919555284 1:199045686-199045708 ATGGGGAAGGGGGAACAAGATGG + Intergenic
919842552 1:201619759-201619781 ATGAGGAAGAGGCAGGAGGCAGG + Intergenic
920290857 1:204922178-204922200 ATGGGAAAGTGCCAAGAGCGGGG - Intronic
921177934 1:212609451-212609473 ATGGGGAAGGGGCGAGAGGGCGG + Intronic
921331631 1:214044426-214044448 CTGGGGAAATGGCAAGAGTGGGG - Intergenic
921520928 1:216153073-216153095 ATGGGAAACTGGAAAGGGGATGG - Intronic
921632884 1:217456015-217456037 ATGGGGAGCTGGGAAGGGGACGG - Intronic
921685995 1:218089789-218089811 ATGGTGGAGTGGAGAGAGGAGGG - Intergenic
921747772 1:218756932-218756954 ATGGGGATGTGAAATGAGGATGG + Intergenic
921812188 1:219527628-219527650 AGGCGGCAGTGGGAAGAGGAGGG + Intergenic
922156093 1:223040649-223040671 ATGGGCAAGGGGCAGGGGGAGGG + Intergenic
922334298 1:224606376-224606398 ATGGGGAGCTGGAAAGGGGATGG + Intronic
922883064 1:228997150-228997172 CTGGGGAAGTGGCATGGGGTAGG + Intergenic
922994517 1:229945189-229945211 ATGGGGAATTGGGGTGAGGAGGG - Intergenic
923081852 1:230665187-230665209 ATGGTGCAGTGGAAAGAGCATGG + Intronic
923127764 1:231047329-231047351 AGGAGGAAGGGGAAAGAGGAGGG - Intergenic
923322426 1:232847875-232847897 CTGGGGAAGGAGCAAGAGCATGG + Intergenic
923409261 1:233691076-233691098 TTGGGGGAGTGGCCAGGGGAGGG - Intergenic
923611923 1:235503920-235503942 ACGGGGAAGTGAGAAGAGGCGGG + Intronic
923668109 1:236016372-236016394 GTGAGGAAGAGGCAAGAAGATGG + Intronic
923975481 1:239257319-239257341 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
924609237 1:245560094-245560116 CTGGAGAAGGGACAAGAGGAAGG - Intronic
924675942 1:246178127-246178149 AAGGTGAAATGGCAGGAGGAGGG + Intronic
1062826349 10:571554-571576 ATGGGGAAGTGCAGTGAGGAAGG - Intronic
1063142033 10:3264126-3264148 ATTGGCAAGTGGCAAAAGGAAGG - Intergenic
1063259995 10:4377240-4377262 TTTGGGAGGTGGCAAGAGGGAGG - Intergenic
1063877859 10:10498639-10498661 ATGGGGAAGAGGCTAGAGGAAGG - Intergenic
1063978699 10:11436874-11436896 CTGGGAAAGTGGCAGGATGAAGG + Intergenic
1064600178 10:16985398-16985420 ATGGGGAACTGGAAAGGGGATGG - Intronic
1064674897 10:17750665-17750687 TTGGGGTTGTGGGAAGAGGATGG - Intergenic
1065009138 10:21405964-21405986 ATGGGGAGTTGGAAAGGGGATGG - Intergenic
1065229590 10:23583644-23583666 ATGGGTGTGGGGCAAGAGGAGGG - Intergenic
1065454402 10:25891951-25891973 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1066251471 10:33637281-33637303 ATGGGGAGTTGGAAAGGGGATGG - Intergenic
1066259634 10:33716648-33716670 AAGGGGAAGAAGAAAGAGGAAGG - Intergenic
1066334650 10:34463259-34463281 AAGGGGAAGGGGGAAGAGGAAGG + Intronic
1067174478 10:43933941-43933963 ATGGGGAATTGGAAAGGGGATGG - Intergenic
1067226168 10:44377548-44377570 AGGGGGTAGTGGCAAGATGATGG + Exonic
1067267234 10:44756999-44757021 ATGGGGAGGTGAGAAGGGGATGG - Intergenic
1067344109 10:45425751-45425773 ATGGGGAAGAGGCAGGCTGATGG - Intronic
1067400098 10:45964674-45964696 ATGTGTAAGTGGCAAAATGAAGG - Intergenic
1067698946 10:48555056-48555078 ATTGGGATGTGGCAGGAGGAAGG - Intronic
1067868426 10:49933966-49933988 ATGTGTAAGTGGCAAAATGAAGG - Exonic
1067897627 10:50201161-50201183 ATGGGGAGCTGGAAAGGGGATGG - Intronic
1067913782 10:50374711-50374733 ATGGGCAAGTGGGGAGAGGCTGG - Intronic
1067978788 10:51057538-51057560 ATTGGGAAATGGCATGAGGAAGG - Intronic
1068269172 10:54697658-54697680 AAGGGGAAGGGGGAAGGGGAAGG + Intronic
1068447288 10:57139252-57139274 GTGGGGAAGAGGCATGTGGATGG + Intergenic
1068497902 10:57808387-57808409 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1068803954 10:61173713-61173735 AAGAGGAAGTGGGAAGAGGTGGG - Intergenic
1068907063 10:62338518-62338540 ATGGGGAACTGGAAAGGGGTGGG - Intergenic
1068922270 10:62497312-62497334 ATACGCAAGTGGGAAGAGGAAGG - Intronic
1069285893 10:66714935-66714957 AGGAGGAAGTGGAAAGAGAAGGG - Intronic
1069633398 10:69911191-69911213 ATTGAGAAGGGGCAAGGGGAAGG - Intronic
1070156166 10:73836862-73836884 ATGGGACTGGGGCAAGAGGAGGG - Intronic
1070399979 10:76044963-76044985 AGGGGAAAGTAGCAAGAGAAGGG - Intronic
1070647715 10:78212957-78212979 ATGAGGAAGAGGAAAGAAGAGGG - Intergenic
1071104672 10:82080459-82080481 ATGGGAAGGTGGCAGAAGGAGGG - Intronic
1071371070 10:84952400-84952422 ATGGGGTGGTGGAGAGAGGAGGG + Intergenic
1071388817 10:85149390-85149412 ATGGGAAATTGGCAAGGGGATGG - Intergenic
1071445964 10:85747522-85747544 AAGAGGAAGGGGCAGGAGGAAGG - Intronic
1071840920 10:89470377-89470399 AGGGGGAAGTGCCAAGAAGGAGG + Intronic
1072533335 10:96340076-96340098 ATGGGGGAGTGGCAAGAATGAGG + Intergenic
1072875030 10:99163417-99163439 CTGAGGAGGTGGAAAGAGGAAGG - Intronic
1072902332 10:99419533-99419555 ATGGAAGAGGGGCAAGAGGAAGG - Intronic
1073597718 10:104817400-104817422 AGGGGGAAGGGGGAGGAGGAGGG - Intronic
1073921999 10:108470085-108470107 AAGGGGAAGTGGCAAGCAAAAGG + Intergenic
1074157358 10:110810556-110810578 ATGGGGTAGGGGCAAGAACAGGG - Intronic
1074710418 10:116172685-116172707 ATGTGTAAGTGGAAAGTGGAGGG + Intronic
1075075742 10:119349153-119349175 CTGGAGAAGAGGCAGGAGGAAGG + Intronic
1076081631 10:127586869-127586891 ATGGGGAAGTGGTACCAGGAAGG - Intergenic
1076318886 10:129564230-129564252 AGGGGGAAGGGGGAAGAGGAGGG - Intronic
1076372582 10:129964762-129964784 AAGGAGAAGTGGGAAGAGGCAGG + Intergenic
1076569180 10:131421108-131421130 ATGGGGCAGGGCCAACAGGAGGG - Intergenic
1076783635 10:132738400-132738422 AGGGGGATGTGGCAAAGGGAGGG - Intronic
1076857240 10:133123447-133123469 GTGTGGATGTGGCATGAGGACGG - Intronic
1077195734 11:1279072-1279094 ATGGGGAAGGGACAGGAGGAGGG + Intronic
1077905566 11:6530252-6530274 GGGTAGAAGTGGCAAGAGGAGGG - Intronic
1078367713 11:10720490-10720512 ATGGGGAAGTGGAAAGCCCAAGG - Intergenic
1078391694 11:10940488-10940510 ATGGGAAAGTGGAAAGGGGAGGG - Intergenic
1078475955 11:11630351-11630373 AGTGGGAAGAGGCAAGAGGAAGG - Intergenic
1079241743 11:18726736-18726758 CTGTTGAAGTGGGAAGAGGAAGG - Intergenic
1079660910 11:23035552-23035574 AAGGGGAGGTGGAAAGAGGATGG - Intergenic
1080110094 11:28557051-28557073 ATGCAGAATTGGGAAGAGGAGGG - Intergenic
1080723830 11:34875094-34875116 ATGGGGAGCTGGAAAGAGGATGG - Intronic
1080896096 11:36449885-36449907 AAGGAGAAGTGGCAAAAGGTGGG - Intronic
1081121907 11:39277286-39277308 ATGGGGCTGTGGAAATAGGAAGG - Intergenic
1081312812 11:41593994-41594016 ATGGGGAGCTGGGAAGAGGATGG + Intergenic
1081427356 11:42940085-42940107 ATGGGGTAGGGGCAAGGGTAGGG + Intergenic
1081670620 11:44940231-44940253 ATGGGGAGGCTGGAAGAGGAAGG - Intronic
1081670844 11:44941706-44941728 ATGTGGCAGTGGCACCAGGATGG + Intronic
1082196800 11:49316257-49316279 AAGGGGAAGGGGTAAGGGGAAGG + Intergenic
1082244434 11:49905195-49905217 AGGGGGAAGGGGGAAGGGGAAGG + Intergenic
1082671779 11:56043675-56043697 ATGGGGAAGAGGTATGTGGATGG + Intergenic
1083655561 11:64227516-64227538 ATGGGGCAGGGGGAAGAGGTGGG + Intronic
1083883796 11:65560913-65560935 GTGGGGAAGAGCCAGGAGGACGG + Intergenic
1084038745 11:66529710-66529732 GTGGGGAGGGTGCAAGAGGAGGG - Intronic
1084215032 11:67642489-67642511 CTGGGGAAGTGGATGGAGGAAGG - Intergenic
1084561906 11:69910160-69910182 GTGGGGAGTGGGCAAGAGGAGGG - Intergenic
1085235159 11:75008974-75008996 AGGGGGAAGAAGTAAGAGGAGGG - Exonic
1085502660 11:77037978-77038000 AGGGGGAAGAGGGAGGAGGAGGG + Intronic
1086017668 11:82186528-82186550 ATGGGGTAATGGAAAGAGCAGGG - Intergenic
1086045253 11:82524820-82524842 GTGAGGAAGTGGCAGGAGGGAGG - Intergenic
1086586293 11:88456293-88456315 ATGATGAAGAGGGAAGAGGAGGG - Intergenic
1086644187 11:89198902-89198924 ATGGGGTAGGGGTAAGGGGAAGG - Intronic
1086799966 11:91160779-91160801 AATGGGAAGTGGCTACAGGATGG - Intergenic
1086855440 11:91860106-91860128 ATGTGGAAGAGGAAAGTGGAGGG - Intergenic
1086881002 11:92153118-92153140 ATGGGGAAGGTGAAAGAAGAAGG - Intergenic
1087346185 11:96973769-96973791 ATTGGGAAGAGGAAAGGGGAAGG + Intergenic
1088327298 11:108614029-108614051 ATGAGGCTGTGGCAGGAGGATGG + Intergenic
1088357852 11:108961815-108961837 TTTGGGAGGTGGCCAGAGGAAGG - Intergenic
1088450618 11:109977747-109977769 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1088723962 11:112618353-112618375 ATGGGGCAGTGGCCAGGGGTGGG - Intergenic
1088999363 11:115038198-115038220 CTGGGCAACTGGAAAGAGGAAGG - Intergenic
1089583690 11:119496927-119496949 ATGGGGATGAGTCTAGAGGAGGG - Intergenic
1089618355 11:119707924-119707946 CAGTGGTAGTGGCAAGAGGAAGG + Intronic
1089629142 11:119773035-119773057 CAGGGGAAGTGGAAAGAGGAGGG - Intergenic
1089681983 11:120123693-120123715 ACGGGGAAGTCGAAAGAGAAAGG - Intronic
1090554123 11:127855597-127855619 ATGGGGAGCTAGAAAGAGGATGG + Intergenic
1090678912 11:129031994-129032016 ATGGGGAGCTGGAAAGGGGATGG - Intronic
1090805510 11:130199705-130199727 AGGGGGAGGTGGGAAGATGAGGG + Intronic
1090865836 11:130699710-130699732 ACTGGGATCTGGCAAGAGGAAGG - Intronic
1091046538 11:132330591-132330613 GAAGGGAAGTGGCAAGGGGAGGG + Intronic
1091282005 11:134387199-134387221 AGGGGGAGGTGGGAAGTGGAGGG - Intronic
1091446363 12:546136-546158 GTCGGGAAGAGGGAAGAGGAGGG + Intronic
1091812891 12:3414720-3414742 ATGGGGAGTTGGAAAGGGGATGG + Intronic
1092055045 12:5501808-5501830 ATGTGGAAGGCGAAAGAGGAAGG + Intronic
1092656973 12:10696162-10696184 TTGAAGAAGTTGCAAGAGGAAGG - Intergenic
1092944734 12:13442176-13442198 AGGGAGAAGTGGAAAGAGAAGGG - Intergenic
1093001109 12:13997119-13997141 ATGGCTAAGTGGAAATAGGAAGG + Intergenic
1093092466 12:14937080-14937102 ATGGGGAAGGGGCAAGAGCATGG - Intronic
1093156651 12:15693894-15693916 ATGGAGGTGGGGCAAGAGGAGGG + Intronic
1093635287 12:21459330-21459352 ATGTGGAAGTTGCTAGAGGGTGG + Intronic
1093749237 12:22779559-22779581 ATGGGGAACTGGAAAGGGGATGG + Intergenic
1093751791 12:22808083-22808105 ATGGGGAACTGGAAACAGGATGG + Intergenic
1093769100 12:22998980-22999002 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1093937760 12:25019410-25019432 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1094583105 12:31752421-31752443 ATGGGGAATTGGAAAGGGGATGG + Intergenic
1095273328 12:40248922-40248944 ATGTGGAAGAGGCAACAGCATGG + Intronic
1095497424 12:42799534-42799556 ATGGAGAAGTGACTGGAGGAAGG - Intergenic
1095664960 12:44786875-44786897 ATGGGGTGGGGGCAAGATGAGGG + Intronic
1096112521 12:49037949-49037971 ATGGTGAATTGGCAAGGAGAAGG + Exonic
1096522545 12:52192252-52192274 GTGGGGAGTTGGCAAAAGGAAGG + Intergenic
1096666789 12:53171453-53171475 AGGGGGCGGTGGCAAGAGGAAGG + Intronic
1096675705 12:53224720-53224742 GCAGGGAAGTGGCAGGAGGAGGG - Intronic
1097156089 12:57013315-57013337 CTGGGCAAGTGGCAAGAGATAGG + Intronic
1098164833 12:67684417-67684439 TTGGGGGAGTGGGAAGAGGTAGG - Intergenic
1098185379 12:67890820-67890842 GTGAGGATGGGGCAAGAGGAGGG + Intergenic
1098255590 12:68611656-68611678 TGCGGGAAGTGGCAGGAGGAAGG + Intronic
1098757671 12:74386958-74386980 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1098758334 12:74391671-74391693 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1098969113 12:76830783-76830805 ATGTGTAAGTGGCAAGAAGCAGG + Intronic
1099208508 12:79756717-79756739 TTGGGGAAGAGGCAAGAACATGG - Intergenic
1099639206 12:85263021-85263043 ATGGGGAAGTGGCAAAAAGAAGG + Intronic
1099717287 12:86311795-86311817 ATGGGGAAGTGGGGAGATGGTGG - Intronic
1100680551 12:96915365-96915387 ATGGGGGAAGGGCTAGAGGAAGG + Intronic
1100690288 12:97032264-97032286 ATGGTAAAGTGGGAAGAGAAAGG + Intergenic
1101308843 12:103557711-103557733 ATGGGGAAGGGGAGACAGGATGG - Intergenic
1101378039 12:104187853-104187875 ATGGGGAGTTGGAAAGGGGATGG + Intergenic
1101469608 12:104984252-104984274 ATGGGGAATAGGAAAGGGGATGG + Intergenic
1101909973 12:108854023-108854045 AAGGAGAAGTGGAAAGAGCAGGG + Intronic
1102119627 12:110429993-110430015 CTGGAGAAGTAGGAAGAGGAGGG - Intergenic
1102509442 12:113404092-113404114 AAGGGGAAGTGGAAAGAGGGAGG - Intronic
1102786115 12:115606343-115606365 AGGGGGAAGGGGAGAGAGGAGGG + Intergenic
1102851217 12:116246854-116246876 GTGGGGAGGTGGGGAGAGGAGGG + Intronic
1103404642 12:120666781-120666803 TTGGGGCAGTGGCAACAGGGTGG + Intronic
1103458884 12:121088364-121088386 ATGCGGAAGTGGGAAGATGATGG - Intergenic
1103867289 12:124063177-124063199 ATGGGGGAGTCGAAAGAGCAGGG + Intronic
1104143132 12:126007153-126007175 ATGGGGAGTTGGAAAGGGGATGG + Intergenic
1104752620 12:131249582-131249604 AGGGGGAAGTTGCTGGAGGATGG - Intergenic
1106109521 13:26764327-26764349 ATTGGGAGTGGGCAAGAGGAAGG - Intergenic
1106124019 13:26885384-26885406 AGGGGAAAGTAGCAGGAGGAAGG + Intergenic
1106180964 13:27369037-27369059 ATGGGGAAGGGGTGAGAGTAGGG + Intergenic
1106597879 13:31161998-31162020 AAGCGGAAGTGGCACGTGGAGGG - Intronic
1106882604 13:34148316-34148338 AGGGTGGAGTGGCAAGAGGATGG - Intergenic
1107290918 13:38852121-38852143 GTGGGGGAGTGGCAGGAGGTGGG - Intronic
1107294389 13:38894320-38894342 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1107581196 13:41788715-41788737 GTGGGATAGTGGTAAGAGGAAGG - Intronic
1107631715 13:42349864-42349886 AGGGGGCATTGGAAAGAGGATGG - Intergenic
1107872985 13:44764149-44764171 AAGGGGAAGTGGCCAGTGGCCGG - Intergenic
1108159056 13:47618897-47618919 ATGGGGAGTTGGAAAGGGGATGG - Intergenic
1108164858 13:47681835-47681857 ATGGTGAAGTAGACAGAGGAGGG + Intergenic
1108511253 13:51157882-51157904 ATTTGTAAGTGGCAAGAGCAAGG + Intergenic
1108782373 13:53851789-53851811 AGGGGGCTGTGGCAGGAGGATGG + Intergenic
1108799810 13:54081728-54081750 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1109011473 13:56952698-56952720 ATGTGGTATTGGCAAAAGGATGG + Intergenic
1109048106 13:57439231-57439253 GTGGGGAAGTGAAAATAGGAGGG - Intergenic
1109097530 13:58136814-58136836 ATGGAGAAGTGGTAAGCAGAGGG + Intergenic
1109636462 13:65124452-65124474 AAGGGGAAGAGGAAACAGGAGGG - Intergenic
1109785201 13:67164847-67164869 ATTGGGTAGGGGCAAGAGGAGGG - Intronic
1110093408 13:71484264-71484286 ATGAGGATGAGGCAGGAGGATGG - Intronic
1110151008 13:72253205-72253227 TTGGGGTAGTGGTAAGAGGAAGG - Intergenic
1110433900 13:75458209-75458231 ATGGGGAGCTGGAAAGAGGATGG + Intronic
1110441033 13:75525324-75525346 ACAGGGAAGGGGAAAGAGGAAGG + Intronic
1110788358 13:79560185-79560207 AGGGGGAAGGGGGAAGTGGAGGG - Intergenic
1110849199 13:80224648-80224670 ATGAGGAAGTTGGAGGAGGAGGG + Intergenic
1111293891 13:86255599-86255621 ATGGGAAAGTAGAGAGAGGAAGG - Intergenic
1111374091 13:87355156-87355178 CTGGGGGAGTGGGTAGAGGAAGG + Intergenic
1111451818 13:88428810-88428832 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1111850439 13:93566706-93566728 AAGGGGAGGGGGCAAGGGGAGGG - Intronic
1111912125 13:94324570-94324592 AAGGGGAGGTGTCAAGATGAGGG - Intronic
1112118059 13:96379069-96379091 GTGGAGAAATGGAAAGAGGATGG - Intronic
1112171493 13:96977180-96977202 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1112259765 13:97867666-97867688 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1112420888 13:99247585-99247607 ATGGGTAAGGGGCAAGGGGAGGG + Intronic
1112433165 13:99370750-99370772 GTGGAGAAGTGGCAAGCGGGAGG - Intronic
1112896574 13:104306579-104306601 ATGGGGACGTGGTGAGAAGATGG + Intergenic
1112930315 13:104727451-104727473 GTTGGCAAGTGGCAACAGGAGGG - Intergenic
1113055102 13:106259475-106259497 ATGGGGAATTGGAAAGGGGATGG + Intergenic
1113519453 13:110929295-110929317 TAGAGGATGTGGCAAGAGGAAGG + Intergenic
1113614673 13:111671701-111671723 ATGGGGGTTTGGCAGGAGGAGGG + Intronic
1113620142 13:111756615-111756637 ATGGGGGTTTGGCAGGAGGAGGG + Intergenic
1113678291 13:112223235-112223257 ACGGGGAAGTGGCATGGGGGTGG - Intergenic
1113936610 13:113998242-113998264 AGGGGGAGATGGGAAGAGGAGGG - Intronic
1114483008 14:23047123-23047145 CTGGGGAAGGGGAAAGAGGGAGG - Exonic
1114532815 14:23405988-23406010 CTGGGGATCTGGCAAGAGAAAGG - Intronic
1114695581 14:24624158-24624180 ATGGAGATGTGGCAAGATGGTGG - Intergenic
1114788190 14:25625214-25625236 AAGGAGAAGTGCCAAGAGAAGGG + Intergenic
1115365205 14:32549962-32549984 ATGTGGATCAGGCAAGAGGAAGG + Intronic
1116316934 14:43409052-43409074 ATGTGTCATTGGCAAGAGGACGG + Intergenic
1117029913 14:51657844-51657866 ATTGAGAATTGGTAAGAGGAAGG + Intronic
1117390357 14:55256544-55256566 ATGGAGAGCTGGAAAGAGGATGG - Intergenic
1117845955 14:59912227-59912249 ATTGGGCAGTGACAAGAAGAGGG - Intergenic
1117943997 14:60998483-60998505 ATGGGGAGCTGGAAAGGGGATGG - Intronic
1118475884 14:66116561-66116583 TTGGTGCAGTGGCAAGAAGAGGG + Intergenic
1118633294 14:67725391-67725413 ACAGGGAATTGGCAAGAGGATGG + Intronic
1119881954 14:78106649-78106671 AGAGGGTAGAGGCAAGAGGAGGG + Intergenic
1120218376 14:81704993-81705015 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1120464567 14:84840152-84840174 GTGGAGAAGTGGCAAGAGATAGG - Intergenic
1121270353 14:92633436-92633458 AGGAGGAGATGGCAAGAGGAGGG + Intronic
1121366652 14:93318329-93318351 ATTGGGAAGAGGCATGAGGGGGG + Intronic
1121585440 14:95060099-95060121 ATGGGGTGGTGGCAGGAGGATGG - Intergenic
1121722653 14:96121495-96121517 ATGTGAAAATGGCAAGAGGGTGG + Intergenic
1121777056 14:96598081-96598103 AGGGAGAAGGGGGAAGAGGAGGG - Intergenic
1121878166 14:97473838-97473860 GTGGGGAAGAGTCAGGAGGAGGG + Intergenic
1122476286 14:102011931-102011953 CTCGGGAAGTGGGAAGAGCATGG + Exonic
1122641693 14:103163788-103163810 AAGGAGAACTGGCAAGGGGATGG - Intergenic
1122910912 14:104827182-104827204 ATGAGGAGGTGGCAACAGCAGGG + Intergenic
1122983194 14:105200691-105200713 ATGGAGAAGGGCCCAGAGGATGG - Intergenic
1123539250 15:21271690-21271712 GTGGGGGAGAGGGAAGAGGAAGG - Intergenic
1125299937 15:38244678-38244700 ATGTTGCAGTGGGAAGAGGAGGG + Intergenic
1126047874 15:44660776-44660798 AAAGGGAAGCGGGAAGAGGAGGG - Intronic
1126256212 15:46628241-46628263 AAGGAGAAGTGGCAAGAAAAAGG - Intergenic
1126567420 15:50114559-50114581 ATAGGGAAGTGAGAAGAGGAAGG - Intronic
1126876327 15:53045565-53045587 ATGAGGCGGTGGGAAGAGGAAGG - Intergenic
1126897897 15:53279648-53279670 AGGGGGTAGGGGCAAGGGGAGGG - Intergenic
1126904437 15:53349204-53349226 ATTGTGAAGTGGCAGGAGAAAGG + Intergenic
1127602666 15:60553864-60553886 ATGGAGAAGTGACAAGATAAAGG - Intronic
1127882437 15:63170113-63170135 AAAGGGAGGTGGCAAGAGCATGG - Intergenic
1128252239 15:66171526-66171548 ATGGAGAGGTGGGAGGAGGAGGG + Intronic
1128314297 15:66650607-66650629 ATGGGGAAGTGGGACAGGGAGGG + Intronic
1128808455 15:70552475-70552497 ATGGTGAGGGGGCAAGAGCAGGG + Intergenic
1128941371 15:71790486-71790508 ATGAAGAACAGGCAAGAGGAAGG + Intergenic
1129230575 15:74195042-74195064 AAGGGGAAGTGGGCAGAGTAGGG - Intronic
1129450990 15:75651357-75651379 TTGGGGAGGTGGCAGGAGGAAGG - Intronic
1129659726 15:77546448-77546470 AAGGGGAAATGGAAACAGGAAGG - Intergenic
1129787618 15:78320075-78320097 ATGGGGAAGGGACAGGAGGTAGG + Intergenic
1129889976 15:79065531-79065553 CTGGGGCATTGGCAGGAGGAAGG + Intronic
1130459845 15:84152748-84152770 TTGGGGAAGTGGGGAAAGGAGGG + Intergenic
1130661368 15:85833756-85833778 ATGGGGAAGGGGCAGGTGGGCGG + Intergenic
1131007348 15:88988630-88988652 ATGGGGAGGTGACAAAAGGGTGG - Intergenic
1131616515 15:94022118-94022140 CTCGGGAAGTTGCAAGAGTAGGG + Intergenic
1131709515 15:95037817-95037839 ATGGGGAACTGGAAAGGGGATGG - Intergenic
1133493901 16:6297878-6297900 ATGGGGAGCTGGAAAGGGGATGG - Intronic
1133808772 16:9145267-9145289 ATGGGGAATTGGAAAGGGGATGG - Intergenic
1133859380 16:9579946-9579968 ATGGAGAAATGGTTAGAGGATGG - Intergenic
1133989290 16:10692198-10692220 ATGGGGGAGTGAGAAGAGAATGG + Intronic
1134034038 16:11015914-11015936 ATGGGGCAGAGGCCAGAGGCTGG + Intronic
1134347975 16:13409216-13409238 ATGGGGAACTGGAAGGGGGATGG - Intergenic
1134419452 16:14071803-14071825 AGTGGGAGGTGGGAAGAGGAAGG - Intronic
1134549481 16:15132352-15132374 AGGGGGGAGGGGCAAGGGGAGGG + Intronic
1134873680 16:17676191-17676213 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1134904840 16:17971506-17971528 AAGGGGAAGAGGAAAGAAGATGG + Intergenic
1135124854 16:19800134-19800156 ATGGGAAAGTAGAGAGAGGAAGG + Intronic
1135186103 16:20317050-20317072 AAGGGGAAGGGGAAAGAGAACGG - Intronic
1135407426 16:22207910-22207932 CTGGGGAAGAGGCAGGTGGAAGG + Intronic
1135672511 16:24387296-24387318 ATGGGGAGTTGGAAAGGGGATGG + Intergenic
1135674848 16:24406635-24406657 ATGGGGAATTAGAAAGGGGATGG - Intergenic
1135884173 16:26290211-26290233 ATGAGGGAGTGGCAAGATCACGG + Intergenic
1136088557 16:27902645-27902667 ATGGGGAGGGGACAAGAGCAGGG + Intronic
1136746803 16:32597860-32597882 ATGGGTAAGTGGCACAGGGATGG + Intergenic
1137483408 16:48871332-48871354 CTGGAGAAGAGGAAAGAGGAAGG + Intergenic
1137537532 16:49338813-49338835 AGTGGGAAGTGGCAAGGGAATGG + Intergenic
1137854763 16:51783371-51783393 GTGGGGAATTGGGAATAGGAAGG - Intergenic
1138641853 16:58393895-58393917 AGGGGGAAGTGGGAAAAGGAAGG - Intronic
1138672836 16:58629563-58629585 ACGGGGAAGTGGGACGAGGCGGG - Intronic
1138695488 16:58808887-58808909 TTTGGGATGGGGCAAGAGGAAGG - Intergenic
1139088203 16:63614690-63614712 ATAGGGAACTGGAAAGAGAAAGG - Intergenic
1139142972 16:64290813-64290835 ATGGAGAAGTGGGAAGAGAGAGG + Intergenic
1139189951 16:64850862-64850884 AGGGGGAAATAGGAAGAGGATGG + Intergenic
1139634158 16:68247851-68247873 TTTGGGAAGTGGCGAGAGCATGG + Intronic
1139946317 16:70644861-70644883 AGGAGGAAGTAGGAAGAGGAAGG + Intronic
1140246206 16:73252343-73252365 CTGGGGTAGTGGCATGGGGACGG + Intergenic
1140321630 16:73958061-73958083 ATGGGGTGGTGGGGAGAGGAGGG + Intergenic
1140332249 16:74069553-74069575 ATGGGGCAGGGGCAAGGAGAGGG + Intergenic
1140334723 16:74094709-74094731 TTGGGGAAGTGAAAAAAGGAAGG - Intergenic
1140461749 16:75145729-75145751 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1140685134 16:77426104-77426126 ATTGTGAAGTGCCAAGAGGTAGG - Intronic
1140788071 16:78362935-78362957 ATGGGACAGTGTCCAGAGGAAGG + Intronic
1140894361 16:79311940-79311962 ATGGCGGAGAGGGAAGAGGAGGG + Intergenic
1141114433 16:81296312-81296334 ATGGAGAAGTGGAAAGACTAGGG - Intergenic
1141527801 16:84623649-84623671 ATGGGATAGTGGCTGGAGGAGGG - Intergenic
1141724428 16:85777793-85777815 TTGGGGAGGTGGTAAGAGGGAGG + Intronic
1142105034 16:88298116-88298138 GTGGGGGACTGTCAAGAGGATGG - Intergenic
1142180701 16:88668230-88668252 ATGGGGGGAGGGCAAGAGGAGGG - Intergenic
1142180724 16:88668306-88668328 ATGGGGGGAGGGCAAGAGGAGGG - Intergenic
1203048933 16_KI270728v1_random:857064-857086 ATGGGTAAGTGGCACAGGGATGG + Intergenic
1142755753 17:2015490-2015512 TTGGAGAGGTGGCAAGAGGAGGG + Intronic
1142784584 17:2210585-2210607 ATGGGGAAAGAGAAAGAGGAGGG + Intronic
1143352473 17:6298821-6298843 AGGGGAAGGTGGCATGAGGATGG - Intergenic
1143381310 17:6498022-6498044 ATGGGGGCGTGGGCAGAGGAAGG + Intronic
1143459714 17:7094434-7094456 ATGGGGAATCAGGAAGAGGAAGG - Intergenic
1143537771 17:7551371-7551393 GTGGGGAAGCAGCAAGAGGCTGG - Intronic
1143591827 17:7889585-7889607 GTGGGGAAGGGGCAAGTTGAGGG + Intronic
1143704549 17:8687577-8687599 AGGGGAGAGTGGGAAGAGGAGGG - Intergenic
1143734040 17:8897834-8897856 ATGGTGGAGTGGAAAGATGAGGG + Intronic
1144140263 17:12341206-12341228 ATGGGGATGTGGCAGGAAGCAGG + Intergenic
1144219353 17:13086099-13086121 ACGGGGAGGGGGCAGGAGGAGGG - Intergenic
1144461614 17:15463194-15463216 ATGGGGAAGTGGGTAGGGGAGGG + Intronic
1144462249 17:15467596-15467618 TTGGGGCAGGGGCAAGAGGATGG - Exonic
1144468706 17:15517828-15517850 ATGGTGCAGTGGGAAGAGAATGG - Intronic
1144554308 17:16268347-16268369 AAGAGGAAGTGGCAACAGAAGGG - Intronic
1145011775 17:19372402-19372424 AGAGGGAAGTGGCAGGAGGGAGG - Intronic
1145051194 17:19662593-19662615 ATGGGGAAGAGGCACAAGAAAGG - Intronic
1145058197 17:19716663-19716685 ATGAGTAAGGGGCAGGAGGAGGG + Intronic
1146034279 17:29391495-29391517 ATGGGGAAGGGGGAAGGGTACGG - Intronic
1146182750 17:30708360-30708382 AAGGGGGAGGGGCAAAAGGAGGG - Intergenic
1146263127 17:31434383-31434405 CAGGGAAAGTGGCAAGTGGAGGG + Intronic
1146263908 17:31438566-31438588 ATGGGGGTGTGGAGAGAGGAAGG - Intronic
1146297786 17:31663168-31663190 AAGGGGAATTTGCAAGAGTAGGG - Intergenic
1147471520 17:40666484-40666506 ATGGGGAAGGTGCAGGAGGTAGG - Intergenic
1147754180 17:42757355-42757377 AAGGGGAAGGGGAAAAAGGAAGG - Intergenic
1148255799 17:46130791-46130813 ATGAGGGAGGGGAAAGAGGAGGG - Intronic
1148553620 17:48564831-48564853 ATGGCGAGGGGGCAATAGGAAGG + Intronic
1148680039 17:49468378-49468400 AGGGGCAAGTGGCCAGAGGTGGG + Intronic
1148756210 17:49974249-49974271 GTGGGGGAGTGGCAAGACCAAGG - Exonic
1150266652 17:63836539-63836561 ATGGGGAAGGGGAAGGAGAAAGG + Intronic
1150455158 17:65301304-65301326 ATGGGGAAGTGGCATCGGGAGGG + Intergenic
1150868371 17:68878225-68878247 CTGGGGAAGTGGCAGTAGGTAGG + Intronic
1150931524 17:69590241-69590263 ATGGGGAGCTGGGAAGGGGATGG + Intergenic
1150983697 17:70171250-70171272 AGGGGGAAGTGGGGAGGGGAGGG - Intronic
1151239107 17:72744025-72744047 ATGGGGAGGTGGAGAGAGGCAGG - Intronic
1151269086 17:72979173-72979195 AAGGAGAAGTGGCAAGCGAAGGG - Intronic
1151272319 17:73006456-73006478 AAGGGGAAGGGAGAAGAGGATGG + Intronic
1151657939 17:75504330-75504352 ATGGAAAGGTGGCAGGAGGAAGG + Intronic
1152368320 17:79870220-79870242 GAGGGGAAGTGGGAGGAGGAAGG - Intergenic
1152377963 17:79928394-79928416 ATGGGGAAGTGGGAGTGGGAGGG + Intergenic
1152609196 17:81307387-81307409 AAGGGGAAGGGGGAAGAGAAAGG - Intergenic
1153521002 18:5953850-5953872 AGTGAGAAGTGGGAAGAGGAAGG + Intergenic
1153681457 18:7504823-7504845 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1154980891 18:21501404-21501426 ATGGGTGAGGGGCAAGAGGAGGG - Intronic
1155434813 18:25801374-25801396 ATGTGTAAGTGCCAAGAGGCAGG + Intergenic
1155683705 18:28520914-28520936 ATGGGGAGCTGGAAAGAGGATGG - Intergenic
1155807111 18:30185151-30185173 AAGGGGAAGTGAAAAGGGGATGG - Intergenic
1156232900 18:35172236-35172258 CTGGGGCAGTGGCAGGAGCATGG - Intergenic
1156504346 18:37579603-37579625 CTGGGGAAGAGCAAAGAGGAAGG + Intergenic
1156519357 18:37708727-37708749 ATAGAGAAGTGGAGAGAGGAAGG - Intergenic
1156648464 18:39196369-39196391 GGGGGGAAGTGACAACAGGATGG + Intergenic
1156723926 18:40104582-40104604 AAGGGGAAGGGGCAAGAGAATGG + Intergenic
1156933907 18:42679337-42679359 ATGGTGAGGTGGCAAGAGTATGG - Intergenic
1157442546 18:47721774-47721796 CTCGGGGAGGGGCAAGAGGAAGG + Intergenic
1157647653 18:49292967-49292989 GTGGGTAAGGGGCTAGAGGAGGG - Intronic
1158281944 18:55838124-55838146 AGGGGGAAGAAACAAGAGGAAGG + Intergenic
1158450282 18:57557881-57557903 AGGATGAAGTGGCAGGAGGATGG + Intronic
1158542071 18:58366144-58366166 ATGGGGGTGTGGCCAGAGAATGG + Exonic
1158543224 18:58375135-58375157 ACGGGGAGATGGCATGAGGAGGG - Intronic
1158848758 18:61472423-61472445 ATCTGGAACTGGCAAAAGGAGGG + Intronic
1158968542 18:62644671-62644693 AAGGGGAGCTGGAAAGAGGATGG - Intergenic
1159399256 18:67909031-67909053 ATGTGGAAATGTCAAGAGAATGG - Intergenic
1159447392 18:68557524-68557546 GTGGGGAATTGGAAAGGGGATGG + Intergenic
1159708358 18:71720990-71721012 ATGAGAAATTGGCAAGATGATGG - Intergenic
1159726578 18:71967858-71967880 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1159912756 18:74161989-74162011 ATGGGGAATGTGCAAAAGGAAGG + Intergenic
1159923355 18:74246617-74246639 ATGGGGAGGTGGGAAGACAATGG - Intergenic
1159923387 18:74246717-74246739 ATGGGGAGATAGCAGGAGGATGG - Intergenic
1160127468 18:76189597-76189619 ATGGGGAGATGGAAAGTGGATGG - Intergenic
1160848988 19:1180670-1180692 CTGGGGAAGTGGGTGGAGGAAGG - Intronic
1161258362 19:3322108-3322130 ATGGGGACATGGAAGGAGGAGGG + Intergenic
1161716726 19:5880512-5880534 GTGGGGAAGGGGCAGGGGGAGGG - Intronic
1161955216 19:7490171-7490193 TTGGAGAAGTGACAAGACGAAGG - Intronic
1162032751 19:7924593-7924615 AGGGGCAAGTGGCAGGAGGGCGG + Exonic
1162194372 19:8972951-8972973 AGGGGGAAGTGGAAGAAGGATGG + Exonic
1164511862 19:28904109-28904131 ATGGGGAAGTGGAAGAAGAAAGG - Intergenic
1164680544 19:30131170-30131192 AGGGGGAAGGGGAAAGAGGGAGG - Intergenic
1164781631 19:30897584-30897606 CTGGGGAGATGGCCAGAGGAGGG - Intergenic
1165332589 19:35149253-35149275 GTGGGGTGGGGGCAAGAGGAGGG - Intronic
1165347796 19:35259712-35259734 TTGGGGATGTAGCAAGAGGTGGG - Intronic
1165380013 19:35472577-35472599 ATGGGGTGGGGGCAAGAGGCAGG - Intergenic
1165384605 19:35502942-35502964 ATAGGGCAGTAGCAGGAGGAGGG - Intronic
1165840587 19:38787221-38787243 GTGGGGAGGGGGCAAGAGGCTGG + Intergenic
1165951391 19:39475625-39475647 GTGGGGAAGAGGCAGGAGGCAGG + Intronic
1166083078 19:40457352-40457374 AAAGGGAAGTGGCATGAGGGAGG - Intronic
1166656188 19:44613780-44613802 GTGGGGAAGTGGCCAGGGTAGGG + Intronic
1166727540 19:45037872-45037894 ATGAGGAAGGGCCAAGGGGATGG - Exonic
1166825684 19:45607514-45607536 ATGGGGAAGGGACAAAAGGTGGG + Intronic
1166911343 19:46160481-46160503 ATGGGCAAGAGTGAAGAGGAAGG + Intronic
1167080508 19:47274022-47274044 ATGGGGAGGGGGCGTGAGGAGGG + Intergenic
1167236537 19:48319168-48319190 AGAGGGAGGAGGCAAGAGGATGG - Intronic
1167435164 19:49474859-49474881 ATGGGGAGATGGACAGAGGAGGG + Intronic
1167633476 19:50639751-50639773 CTGGGGCTGTGGCAGGAGGAGGG + Intronic
1167640285 19:50678003-50678025 GTAGAGAAGTGGCAAGTGGAAGG + Intronic
1167640460 19:50678791-50678813 ATGGGGAGGGGTCAAGATGATGG + Intronic
1167640567 19:50679051-50679073 ATGGGGAGGGGTCAAGATGATGG + Intronic
1168233070 19:55045413-55045435 AAGGGGAAAGGGCTAGAGGAGGG - Intronic
1168416235 19:56170654-56170676 ATGTGGAAGCGGCCACAGGACGG - Intergenic
1168423407 19:56219919-56219941 ATGGGGAGGAAGGAAGAGGAGGG + Exonic
1202645244 1_KI270706v1_random:133234-133256 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
925183472 2:1831672-1831694 CTGGGAAAGTGGCGAGAGGCCGG - Intronic
925434410 2:3824726-3824748 CTAGGGAAGGGGCAAGAGCACGG - Intronic
925498730 2:4481122-4481144 ATAAGGAAGGGGCAAGGGGAAGG + Intergenic
925561739 2:5203579-5203601 GTGGGGATGTGGCTAAAGGAAGG - Intergenic
925867688 2:8243546-8243568 ATGGGTAAGTGGCAAGAGCTGGG - Intergenic
925886184 2:8395239-8395261 AAGGGGAGTTGGAAAGAGGAGGG - Intergenic
926119899 2:10236215-10236237 ATGGAGAAGAGGGAAGAGGGTGG - Intergenic
926393448 2:12417811-12417833 ATGGGGGAGGGGCAGGAGGGAGG - Intergenic
926660020 2:15454751-15454773 ATTGGGAAGTGGAGAAAGGAGGG - Intronic
926794595 2:16608473-16608495 ATGGCCAAGTGGAATGAGGACGG + Intronic
927409047 2:22804640-22804662 CTGTGAAAGTGGCAAGAGGCTGG + Intergenic
927513330 2:23658124-23658146 ATGGGGAGGAGGGTAGAGGAAGG - Intronic
927606632 2:24491731-24491753 TCGGGGAAGTGGGAGGAGGATGG - Intergenic
927620183 2:24647777-24647799 ATGTGAAAGTGGCAACTGGAAGG + Intronic
927932334 2:27053050-27053072 ATGGGGAAGGGGTAGGAGGTGGG + Exonic
928333707 2:30377654-30377676 ATGGGGAAGTGGAACAGGGACGG - Intergenic
928600422 2:32898985-32899007 ATGGGGGAGAAGCAAGAGGAGGG - Intergenic
928641942 2:33308463-33308485 ATGGGGGAGTCGGAAGAAGAGGG - Intronic
928664492 2:33537119-33537141 ATGGGGAGCTGGAAAGGGGATGG + Intronic
928869662 2:35961502-35961524 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
928960132 2:36915882-36915904 AAGGGGAAGAGGGAAAAGGAAGG + Intronic
929092440 2:38232809-38232831 ATGGGGAAGTGGGGAGGGCAAGG - Intergenic
929175001 2:38967300-38967322 CTGGAGAAGGGGGAAGAGGAAGG + Intronic
929606645 2:43239229-43239251 CTGGGGCAGTAGCAAGATGAAGG - Intronic
930088998 2:47518337-47518359 GTTGGGAGGTGGGAAGAGGAAGG + Exonic
930148295 2:48030701-48030723 ATGGGGAATTGACTAGATGAGGG + Intergenic
930207556 2:48603199-48603221 ATGGGGATGTGACAAGACAAAGG + Intronic
931492731 2:62767043-62767065 ATGAGGGAGAGGTAAGAGGAAGG + Intronic
931543873 2:63359078-63359100 GAGGGAAAGTGGAAAGAGGAAGG - Intronic
931688595 2:64816103-64816125 GTGGAGAAGTGGCAAGACAAAGG - Intergenic
932216506 2:69969640-69969662 CTGGGGCAGTGGGGAGAGGATGG - Intergenic
932797776 2:74712410-74712432 ATGGGGACATGGGAAGAGGGTGG + Intergenic
932808582 2:74805014-74805036 ATGGGGAAGTGGCAGGAGATAGG + Intergenic
932827269 2:74953025-74953047 ATGGGGAGTTGGAAAGGGGATGG + Intergenic
932838306 2:75058009-75058031 GTGGGGATGTGGCACGGGGAGGG - Intronic
932876498 2:75457787-75457809 CTGGGGAAATGGGAAGATGAGGG - Intergenic
933253029 2:80050018-80050040 TTGGGGTGGTGGGAAGAGGAAGG - Intronic
933425949 2:82112540-82112562 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
933473131 2:82753017-82753039 ATGGAGAAGAGGGAAGTGGAGGG + Intergenic
933946558 2:87291172-87291194 AAGGGGAATTGGCAAGGAGAAGG - Intergenic
934507649 2:94906820-94906842 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
934791760 2:97068090-97068112 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
934874912 2:97908571-97908593 ATGAGCAAGGGGAAAGAGGAGGG + Intronic
934898306 2:98138096-98138118 ATGTGGAAGAGGAAAGTGGATGG - Intronic
934969363 2:98750589-98750611 ATAGGGAGTTGGAAAGAGGATGG - Intergenic
935092014 2:99904693-99904715 CTGGGGAAGCGGCAAAGGGAAGG - Intronic
935735726 2:106105383-106105405 ATGCGGAGGTGGCAGGAGGAGGG + Intronic
935958172 2:108399242-108399264 ATGGGGAGGTAGCAAGGGGATGG - Intergenic
936333635 2:111570369-111570391 AAGGGGAATTGGCAAGGAGAAGG + Intergenic
936933576 2:117815333-117815355 GTGTGGAAGTGGGTAGAGGAAGG - Intronic
937060530 2:118977588-118977610 GTGGGGCTGTGGAAAGAGGATGG - Intronic
937538729 2:122923415-122923437 ATCGGGAATTGGAAAGGGGATGG + Intergenic
937760172 2:125591180-125591202 GTGGGTAGGGGGCAAGAGGAGGG + Intergenic
937979317 2:127605187-127605209 CTGGGCTAGTGGCCAGAGGAGGG + Intronic
937993628 2:127677590-127677612 AAGGGGAGGTGGCAGGTGGAGGG + Intronic
938180982 2:129182181-129182203 ATGAGGGAGTGGAAAGAGAAGGG - Intergenic
938240910 2:129741733-129741755 CTGGGGAACAGGCAGGAGGAAGG - Intergenic
938611142 2:132948775-132948797 GTGGGGAAAAGGCAAGAGAAGGG - Intronic
938872962 2:135500617-135500639 ATTGGGAAGAGGCAAGAGGGAGG + Intronic
939089790 2:137766303-137766325 CTGAGGAAATGGCAAAAGGATGG - Intergenic
939500266 2:142975334-142975356 ATGAGGAACTGGAAAGGGGATGG - Intronic
939669123 2:144987714-144987736 GTGGGGAATTGGGAAGAGTAGGG + Intergenic
939956166 2:148529236-148529258 AGGGGGGCGTGGCAAGGGGAGGG + Intergenic
940474604 2:154146834-154146856 GTGGAGAAGTGGCAAGACAAAGG - Intronic
940658698 2:156520057-156520079 ATGGGGAGCTGGAAAGGGGATGG + Intronic
940808932 2:158221184-158221206 CTGGGGAAGTGGCAGGAGATAGG + Intronic
941038216 2:160590564-160590586 AAGGGGAAGGGGGAAGAGGAAGG - Intergenic
941396474 2:164980257-164980279 GTGGGGAAGAAGGAAGAGGAAGG - Intergenic
941717529 2:168779713-168779735 ATGGGGAGTTGGAAAGGGGATGG - Intergenic
941998148 2:171621057-171621079 ATGGGGAATTTGAAAGGGGATGG + Intergenic
942045502 2:172097160-172097182 AGGGTGAAGGGGCCAGAGGAAGG - Intergenic
942173341 2:173308379-173308401 ATGGGGATCTGGAAAGAGAATGG - Intergenic
942462187 2:176175919-176175941 ATGGGGAAGTGGCAGAAGAAAGG + Intergenic
942601910 2:177650098-177650120 ATGGGGGAGTGGGAGGAGGGAGG - Intronic
942781809 2:179652606-179652628 ATGGCAAAGTGTCAAGAGCAAGG - Intronic
943214214 2:185009823-185009845 ATGGAGGTGTGGAAAGAGGAAGG - Intergenic
943328828 2:186534576-186534598 ATGGTAAAATGGCAAGAGGATGG + Intergenic
943430351 2:187792387-187792409 TAGGGGAAGTTTCAAGAGGAGGG + Intergenic
943600899 2:189919843-189919865 ATGGAGGAGGGGCAAGATGAAGG - Intronic
944024146 2:195143389-195143411 ATGGGGAGTTGGAAAGGGGATGG + Intergenic
944058688 2:195548699-195548721 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
944412364 2:199457462-199457484 CTGGGGAAGAGGGAAGGGGAAGG - Exonic
944810957 2:203327733-203327755 GTGGGGAAGTGCAAAGAGGCAGG + Intergenic
945047979 2:205798692-205798714 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
945483815 2:210370852-210370874 ATGGGGCTGAGGCAAGAGCAGGG - Intergenic
945701761 2:213179256-213179278 TTGGGGAAAGGGCAAGAGGAAGG + Intergenic
946032994 2:216719875-216719897 ATGGGGAAGGGGAAAGAAGGAGG - Intergenic
946512385 2:220372623-220372645 ATGGTGATGTTACAAGAGGATGG + Intergenic
946609397 2:221441440-221441462 ATGGGGAGCTGGAAAGGGGAAGG - Intronic
946708599 2:222484266-222484288 GTGGGGAAGGGGCAGCAGGAAGG - Intronic
946768991 2:223068751-223068773 CTGGGGGTGTGGGAAGAGGAAGG - Intronic
947127104 2:226881098-226881120 AAGGAGAAGTGCCAAGAGAAGGG + Intronic
947129167 2:226903988-226904010 ATGGGGAGGTGGAAGAAGGATGG - Intronic
947401132 2:229732558-229732580 ATGGGGAACTGGAAAGAGGATGG - Intergenic
948148135 2:235723927-235723949 GTGTGAAAGTGGCAAAAGGAGGG + Intronic
948288491 2:236806324-236806346 CCGGGGAGGTGCCAAGAGGATGG + Intergenic
948566787 2:238892277-238892299 ATGCGGAGGCGGCACGAGGAGGG + Intronic
948621550 2:239238410-239238432 ATGGGAAGGGGTCAAGAGGAGGG + Intronic
1169178637 20:3542593-3542615 AGGGGGAAGGGGGAAGGGGAAGG - Intronic
1169656551 20:7930572-7930594 ATGGGGAAGTGAGAAAAGAATGG + Intronic
1169875664 20:10294549-10294571 ATGTGGAAGTTGCAGGAGGATGG - Intronic
1170087348 20:12548983-12549005 TTTGGGAAGTGGTAAGAGGATGG - Intergenic
1170405645 20:16032853-16032875 ATGAGGAAAAGGTAAGAGGAAGG + Intronic
1170414338 20:16124094-16124116 AAAGGGAATTGGCAAGAGGAAGG - Intergenic
1170766972 20:19298567-19298589 ATGGGGAAGTGAGACCAGGAAGG + Intronic
1171139497 20:22728823-22728845 ATGGAGGACTGGAAAGAGGAGGG + Intergenic
1171177943 20:23068249-23068271 GTGGGGAAGGGCCAAGAGTAGGG - Intergenic
1171211566 20:23321011-23321033 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1171895207 20:30752154-30752176 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1171985003 20:31654032-31654054 GTGGGGAAGTGACACAAGGAAGG - Intergenic
1172548274 20:35778973-35778995 TTGGGGAAGGAGCAAGAGGAGGG + Intronic
1173063165 20:39681294-39681316 ATGGGGCTGTGCCAGGAGGAAGG + Intergenic
1173369928 20:42426417-42426439 ATGGGGAGGTGGAAAGGGGATGG - Intronic
1174897204 20:54462350-54462372 ATGGGGAAGAGGCAAAAGAGCGG - Intergenic
1174910376 20:54601672-54601694 ATGATGAAATGGCAGGAGGAGGG + Intronic
1174944884 20:54974149-54974171 ATGGGTAAGTGTCAAGTTGAAGG - Intergenic
1175356848 20:58375407-58375429 ATGGGGGAGGGGGAGGAGGAGGG - Intergenic
1175682827 20:61003593-61003615 ATTGAGAAGTGGCAGAAGGAGGG - Intergenic
1175735633 20:61385201-61385223 CTCTGGAAGTGGCAGGAGGAGGG + Intronic
1176097065 20:63349146-63349168 ATGGGCTGGTGGCAGGAGGACGG - Intronic
1176119790 20:63449085-63449107 CTGGGGCACTGGCAGGAGGACGG + Intronic
1176187170 20:63787070-63787092 GTGGGGTAGAGGCAAGAGGAAGG + Intronic
1176909776 21:14550458-14550480 AACAGGAAGTGGCAAGAAGATGG + Intronic
1176981525 21:15386790-15386812 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1178005962 21:28219804-28219826 TTGGGGAAGAGGAATGAGGATGG - Intergenic
1178094292 21:29197488-29197510 ATGGGGAGCTGGGAGGAGGATGG - Intronic
1178367483 21:31999445-31999467 TGGGGGAAGTGGGAAGTGGAAGG - Exonic
1178460268 21:32796261-32796283 GTGGGGAGGAGGCGAGAGGAGGG + Intronic
1178564303 21:33668964-33668986 AAGGGGATGTGGCAAGTGGATGG + Intronic
1178704438 21:34861688-34861710 TTGGCGAAGTGGCTGGAGGAAGG - Intronic
1178931060 21:36819781-36819803 ATGGGAAAGTGGAAAGAGTATGG - Intronic
1178940625 21:36902219-36902241 ATGGGGCAGTGGCTAGAGGGAGG + Intronic
1179081181 21:38172037-38172059 TTGGGGAAGAGGCATGAGGAGGG + Intronic
1179131187 21:38638803-38638825 AAGGGGATGTGGGAGGAGGAGGG - Intronic
1179579484 21:42331893-42331915 ATGGAGAAGTGATAAGGGGAAGG + Intergenic
1180356715 22:11849210-11849232 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1180381546 22:12143121-12143143 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1181080732 22:20413192-20413214 AAGGGGAAGGGGCAAGGGAAGGG + Intergenic
1181860690 22:25815717-25815739 ATGCGGAATTTACAAGAGGAAGG - Intronic
1181865405 22:25850925-25850947 GTGGGGAACTGGGAAGAGAAGGG - Intronic
1182329836 22:29543380-29543402 ATGGGGAGGAGGAAGGAGGAAGG + Intronic
1182778439 22:32848842-32848864 ATGGGGATGTGGTTAGAAGAAGG - Intronic
1182900337 22:33893274-33893296 CTGGGGTGGTGGGAAGAGGAAGG - Intronic
1182915099 22:34022073-34022095 ATGGGAAAGGGGCAAGTGAAAGG + Intergenic
1183025911 22:35065927-35065949 CTGGGGAACTGGCCAGAGCAGGG - Intergenic
1183166156 22:36148748-36148770 TTGGGGAAGTGGAAACAGCAGGG - Intronic
1183409858 22:37648452-37648474 TGGGGGAGGTGGCAGGAGGAAGG + Intronic
1183508178 22:38220749-38220771 AGGGGGAAGGGGCATGAGGCAGG + Exonic
1184227344 22:43136632-43136654 TTGGGGAAGTAGCAAATGGAAGG + Intronic
1184255949 22:43287064-43287086 CTGGGGCTGTGGCCAGAGGAGGG + Intronic
1184671013 22:46012402-46012424 GTGGGGAAGTGGCAGCGGGAGGG - Intergenic
1184949929 22:47834051-47834073 TTGGAAAAGTGGCAAGAGGAAGG + Intergenic
1185053601 22:48566514-48566536 ATGGGTGAGTGGAAAGATGAAGG + Intronic
1185089395 22:48757297-48757319 AGGAGGAAGAGGAAAGAGGAGGG + Intronic
1185305481 22:50113041-50113063 ACTGGGAAGTGGCATGAGGCAGG + Intronic
1185310257 22:50150371-50150393 ATGGGCAAGAGGCAAGGGGCAGG + Intronic
1185361940 22:50413673-50413695 AAGGGGAAGAAGGAAGAGGAGGG - Intronic
1185368733 22:50448775-50448797 AGGGGGAGGTGGCAAGAGGGAGG + Intronic
949392741 3:3580514-3580536 TGGGGGAAGTCGAAAGAGGAAGG + Intergenic
949493523 3:4610954-4610976 AGGGGGAAGGGGGAAGGGGAAGG - Intronic
949689667 3:6621295-6621317 ATGGGGAATTGGAAAGGGGATGG - Intergenic
949940177 3:9148724-9148746 ATGGGGTAGTGGAGAAAGGATGG - Intronic
950040726 3:9917564-9917586 ACGGGGAAGGGGCAAGAGCTGGG + Exonic
950314305 3:11986984-11987006 AAGGGGAAGAAGCAAGAGAAAGG - Intergenic
951004353 3:17599455-17599477 ATGGGGAGCTGGAAAGGGGATGG - Intronic
951535380 3:23735903-23735925 ATGGGGAATTGGGACCAGGAAGG + Intergenic
951604028 3:24411727-24411749 ATGGGGATGGAGAAAGAGGATGG + Intronic
952000565 3:28781115-28781137 ATGGAGAGAGGGCAAGAGGAAGG + Intergenic
952039212 3:29241318-29241340 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
952109775 3:30109118-30109140 ATGGGGAACTGCAAAGGGGATGG - Intergenic
952541582 3:34372994-34373016 GAGGGGATGTGCCAAGAGGAGGG + Intergenic
952749551 3:36814366-36814388 ATGGGGAGGAGGGAAGAGCAAGG - Intergenic
952759516 3:36901714-36901736 GTGGGGAAGGGGAGAGAGGATGG + Intronic
952960439 3:38586042-38586064 CTGGGGAAGGAGGAAGAGGAGGG + Intronic
954007590 3:47604317-47604339 TTGGGGAAGTGCTGAGAGGAGGG - Intronic
954539661 3:51385187-51385209 ATGGGGAAGTGGCATGTGGGAGG + Exonic
954613564 3:51958481-51958503 ATGGGAAAGGTGGAAGAGGAAGG + Intronic
954660780 3:52225774-52225796 AGAGGGGAGTGGAAAGAGGAAGG - Exonic
954985508 3:54787642-54787664 ATGGAGAAGTGACAAGACAAAGG + Intronic
955102382 3:55863009-55863031 ATGGGAAAATGGGAAGTGGAGGG - Intronic
955495759 3:59530602-59530624 AAGGAGAAGTGGCAAGTGAAGGG + Intergenic
955969202 3:64420135-64420157 GTGGGGAGGTGGGAAGAGAATGG + Intronic
956122206 3:65977704-65977726 ATTTGGTAGTGGCAGGAGGATGG - Intronic
956457139 3:69433500-69433522 GTGGGGAGGTGCCAAGCGGATGG - Intronic
956513574 3:70021152-70021174 GTGGGGAGGTGGGAAGAGAAGGG + Intergenic
956541436 3:70344417-70344439 ATGGGGAACTGGAAGGGGGATGG - Intergenic
956849697 3:73217711-73217733 AGGGGGAAGAGGGAAGGGGAGGG - Intergenic
957462875 3:80545119-80545141 ATAGGGAAGTAGAAAGAGAAGGG + Intergenic
957586530 3:82139413-82139435 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
957824495 3:85423069-85423091 ATGGGGAATTGGAGAGGGGATGG + Intronic
958023953 3:88028435-88028457 ATGGAGAACTGGAAAGGGGATGG - Intergenic
959065213 3:101648982-101649004 ATGGGGAGCTGGAAAGGGGATGG + Exonic
959164387 3:102758731-102758753 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
959375512 3:105584334-105584356 ATGGGGAGTTGGAAAGGGGATGG - Intergenic
959486634 3:106934500-106934522 GTGGGGAACTGGAAAGGGGATGG - Intergenic
959613922 3:108326016-108326038 CTGAGGCAGTGGCAAGAAGAGGG - Intronic
959651750 3:108757157-108757179 ATGAGAAGGAGGCAAGAGGACGG + Exonic
959694186 3:109231873-109231895 ATGGGGAGCTGGAAAGTGGATGG - Intergenic
960508970 3:118525615-118525637 ATGGGGAACTGGAAAAGGGATGG + Intergenic
960734783 3:120766869-120766891 AGGGGCAAGTGGCAAGGGGCAGG - Intronic
961503235 3:127352117-127352139 TTGTGGGAGTGGCAAGAGGAGGG + Intergenic
961623167 3:128240435-128240457 AAGAGGAAGTGGCAAGAGCAGGG - Intronic
961735237 3:128997277-128997299 ATGGGGAAGGGGCAAGAAGAAGG - Intronic
961916632 3:130382089-130382111 ATGAGGAAATGGGAACAGGAAGG + Intronic
961998505 3:131271026-131271048 TTGGGGAGTGGGCAAGAGGAAGG - Intronic
962367987 3:134798282-134798304 AAGGAGATGTGGCCAGAGGAAGG + Intronic
962895033 3:139706473-139706495 ATCGGGGAATGGCCAGAGGAGGG - Intergenic
963229173 3:142892444-142892466 GTGGGGCAGGGGAAAGAGGAAGG - Intergenic
963234713 3:142945532-142945554 ATGGGGAGGTGGAAGGGGGATGG + Intergenic
963656401 3:148056934-148056956 ATGGGATAGCAGCAAGAGGAGGG - Intergenic
964833332 3:160910251-160910273 AAGGGGAAGGGGAAAGGGGAAGG - Intronic
964990307 3:162802601-162802623 ATAGAGAAGAGGCAAGTGGATGG + Intergenic
965085319 3:164088750-164088772 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
965300827 3:167002553-167002575 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
966348126 3:179001278-179001300 ATGGGGAACTGGAAAGTGTATGG + Intergenic
966931229 3:184677112-184677134 AAGGGGAAGTTGCAGGAGGAAGG + Intronic
966940867 3:184746308-184746330 ATGGGGAGGTGGCGTGAAGAAGG - Intergenic
967303653 3:188040503-188040525 ATGGGCAAGAGGGAAGAGGCAGG + Intergenic
968229319 3:196996055-196996077 CTGGGGAAGAGGAAAGAGCAGGG - Intronic
968309555 3:197672406-197672428 GGGGGGAAGTGGGTAGAGGATGG - Intronic
968449677 4:669273-669295 ATGGGGTAGTGGCAGCAGCATGG - Intronic
968449697 4:669348-669370 ATGGGGTAGTGGGAATAGCATGG - Intronic
968449726 4:669440-669462 ATGGGGTAGTGGGAATAGCATGG - Intronic
968449739 4:669497-669519 ATGGGGTAGTGGGAATAGCATGG - Intronic
968449752 4:669554-669576 ATGGGGTAGTGGGAATAGCATGG - Intronic
968530033 4:1086737-1086759 ATGGGGTAGGGGTGAGAGGATGG + Intronic
968530095 4:1086908-1086930 ATGGGGTGGGGGCAAGAGGATGG + Intronic
968530199 4:1087212-1087234 ATGGGGTAGGGGAGAGAGGACGG + Intronic
968562584 4:1292416-1292438 CTGGTGAAGTGGGAAGAGAATGG + Intronic
968682586 4:1931367-1931389 TTTGGGCAGTGGCAAGAGGAGGG + Intronic
968807800 4:2786838-2786860 ATGGAGAAGTGGAAGGGGGAGGG + Intergenic
969344147 4:6560858-6560880 TTGGGGAGGTGGCAGGAGGCAGG - Intronic
969535722 4:7755156-7755178 ATTGGGCAGTGGCAAGGGGAGGG + Intergenic
969703129 4:8778614-8778636 ATGGGGCAGGGGCGAGAGGCAGG + Intergenic
969969080 4:11027543-11027565 TTGGGGATGGGGCAAGAGAAGGG - Intergenic
970578499 4:17451298-17451320 ATGGGGAATTGGAAAGGGGGTGG + Intergenic
970638422 4:18036250-18036272 ATGGGGCAGGGGCAAGGAGAAGG + Intergenic
970725299 4:19036799-19036821 GTGGGAAAGTGGAAAGAGAAAGG - Intergenic
970939620 4:21616133-21616155 ATGATGAAGATGCAAGAGGAAGG - Intronic
971088520 4:23310548-23310570 ATTGGGAAATGGCAGGAGGTTGG - Intergenic
971466404 4:26967799-26967821 AGGGGGAAGAGGAAAGTGGAGGG - Intronic
971558282 4:28040838-28040860 TTGGGGATGTGGGAGGAGGATGG + Intergenic
971631706 4:29000678-29000700 ATGGTGAAGAGGGAAGATGATGG + Intergenic
971742677 4:30540152-30540174 ATGGGGATCTGGAAAGGGGATGG + Intergenic
971787505 4:31123812-31123834 ATGGGGGTCTGGAAAGAGGATGG + Intronic
971840239 4:31842198-31842220 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
972216564 4:36904537-36904559 GAGGGGAGGTGGCAAGAGAATGG + Intergenic
972710742 4:41592062-41592084 AGGGAGAAGGGGCAGGAGGAGGG - Intronic
972828666 4:42788957-42788979 ATGGGGAAGAGGCATATGGATGG + Intergenic
973193125 4:47409377-47409399 ATGGGGAGCTGGAAAGAGGCTGG + Intronic
973578686 4:52318919-52318941 ATGAGAAAGAGGCAAGAGGTGGG + Intergenic
973650680 4:52994333-52994355 GCGGGGAAGTGGAAAGAGCACGG + Intronic
973829371 4:54742906-54742928 TTGGGGAAGGGTGAAGAGGAAGG + Intergenic
974463429 4:62220832-62220854 ATGGGCAATGGGCAACAGGAAGG + Intergenic
975533553 4:75425443-75425465 ATGGGGAAGTAAGAAAAGGAAGG - Intergenic
975684447 4:76905741-76905763 ATGGGGAGGAGGGAACAGGATGG + Intergenic
975707065 4:77121887-77121909 ATGGGGAATTGGAAAGGGGATGG + Intergenic
975979841 4:80144888-80144910 GTGGGGAAGTGAGATGAGGAAGG - Intergenic
975983963 4:80186333-80186355 GTAGGTAAGTGGAAAGAGGAAGG - Intronic
976579711 4:86721719-86721741 AGGGGGAAGGGGGAAGGGGAGGG - Intronic
976830461 4:89308443-89308465 ATGGGGTAGCGGGAAGGGGATGG - Intergenic
979480776 4:121214447-121214469 GTGGAGAAGAGGCAAGAGAATGG + Intronic
979728403 4:123992247-123992269 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
979919309 4:126478520-126478542 ATGGGGAGCTGGAAAGAAGATGG - Intergenic
980097039 4:128501894-128501916 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
980654803 4:135767512-135767534 AGGGGTAAGGGGAAAGAGGAGGG + Intergenic
980740009 4:136938293-136938315 CTGGGTAAGTGGAAAGAGAAGGG + Intergenic
980871459 4:138615753-138615775 ATGGGGACCTGGAAAGGGGATGG - Intergenic
981362769 4:143866549-143866571 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
981592247 4:146376602-146376624 ATGGGGAGCTGGAAAGGGGATGG - Intronic
981643351 4:146969990-146970012 AAGTGGAAGAGGCATGAGGAGGG + Intergenic
982517951 4:156375629-156375651 AGGGGTGAGGGGCAAGAGGAGGG + Intergenic
982643080 4:157986904-157986926 ATGGGGTAGTGATTAGAGGAGGG - Intergenic
982918461 4:161244615-161244637 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
983077354 4:163343278-163343300 GTGGGCAAGTGGCAGGAGCAGGG - Intronic
983134135 4:164058627-164058649 ATGGGGAGGTGGCAGGATGCAGG - Intronic
983698669 4:170564926-170564948 ATGGTGAAATGGAAAGAGCATGG - Intergenic
984098059 4:175455508-175455530 ATGGGGAACTGGAAAGGGGATGG + Intergenic
984129543 4:175856694-175856716 ATGGGGACCTGGAAAGGGGATGG + Intronic
984133290 4:175905110-175905132 CTGTGGAAGTGACAAGATGAAGG + Intronic
984278011 4:177633717-177633739 ATGGGGAATTGGAAAGGAGATGG - Intergenic
984718817 4:182951668-182951690 ATGCGGAGCTGGAAAGAGGATGG + Intergenic
984989387 4:185364239-185364261 ATGGGGGAGCGGAAAGAGGAGGG + Exonic
985228143 4:187784675-187784697 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
985269906 4:188184041-188184063 ATGGGGAGGTGGAGAGGGGATGG - Intergenic
985314426 4:188640481-188640503 ATGGAGAAAGGGCAAGAGGGAGG - Intergenic
986009532 5:3699843-3699865 ATGTGCAAATGGCAACAGGACGG - Intergenic
986946656 5:13029269-13029291 AAGGGGAAGGGGGAAGAAGAAGG + Intergenic
987026768 5:13934774-13934796 CTGGGGAGGTGGCAAGAGGCAGG + Intronic
987089339 5:14497374-14497396 AAGGGGAAGTGGCTAGATGTGGG + Intronic
987190225 5:15469921-15469943 ATGGGGAGCTGGTAAGGGGATGG + Intergenic
987268280 5:16278685-16278707 ATGGGGAATGGGAAAGGGGATGG - Intergenic
987715057 5:21557734-21557756 ATGGGGAGTTGGAAAGGGGATGG + Intergenic
987911656 5:24154838-24154860 ATGGGGGAGTGGCAAGAGTAGGG + Intronic
987926597 5:24350209-24350231 ATGGGGAACTGGAAAAGGGATGG + Intergenic
988276655 5:29089664-29089686 AAGAGGAAGTAGAAAGAGGAGGG - Intergenic
988499962 5:31776297-31776319 ATAGGGGAGTGGCAATGGGATGG - Intronic
988793401 5:34630125-34630147 CTGGGGAGGTGGGGAGAGGAGGG - Intergenic
989307413 5:39973993-39974015 TTGGGGAAGAGGCATGTGGATGG - Intergenic
989558597 5:42825591-42825613 ATGGGGAGCTGGAAAGCGGATGG - Intronic
990079843 5:51899500-51899522 ATGGGGAACTGGAAAGAGGATGG + Intergenic
990128405 5:52548322-52548344 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
990197822 5:53338215-53338237 CTGGGGAAGAGGCAAGTAGATGG + Intergenic
990379721 5:55210925-55210947 ATGGGGAGGTGGTAAGAGGAAGG + Intergenic
990386822 5:55272769-55272791 ATGGGGAACTGGGTAGAGAATGG + Intronic
990476018 5:56162405-56162427 TGGGGGAACTGGCAGGAGGAGGG + Intronic
990597931 5:57329925-57329947 ATGGGAAGGAGGCAGGAGGATGG - Intergenic
991207450 5:64065892-64065914 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
991425725 5:66489736-66489758 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
991639450 5:68738609-68738631 GTGGGGAAGTGGAAAGGGGTGGG - Intergenic
992226086 5:74620787-74620809 ATGGGGAGCTGGAAAGAGGATGG + Intergenic
992229047 5:74645304-74645326 AGGAGGAAGAGGCAGGAGGATGG - Intronic
992379570 5:76223916-76223938 ATGGGGAAGTGGTGGGGGGATGG + Intronic
993340376 5:86718249-86718271 ATGGGGAAGAGGGAGGAGGAAGG - Intergenic
993367384 5:87050333-87050355 TTGGGGAAGAGGTAAGTGGATGG - Intergenic
993401007 5:87450957-87450979 ATGGGGATGGGGCATAAGGATGG + Intergenic
993628900 5:90259831-90259853 ATTGGGGAGTGGGAGGAGGAAGG + Intergenic
994819290 5:104628132-104628154 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
994999029 5:107103482-107103504 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
995045686 5:107643689-107643711 ATGGGGGAGTGGGGACAGGAAGG + Intronic
995121131 5:108536202-108536224 ATGGAGAGCTGGAAAGAGGATGG - Intergenic
995372394 5:111433608-111433630 ATGGGGAAGTGGTAAGATTCTGG + Intronic
995837378 5:116412107-116412129 GTGGGGAGGGGGCCAGAGGAGGG - Intronic
996242064 5:121215915-121215937 ATGGGGAGCTGGGAAGAGAATGG - Intergenic
996418317 5:123234001-123234023 AAGGGGAAGGGGAAAGAGAAAGG - Intergenic
996576729 5:124983967-124983989 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
996710117 5:126535501-126535523 ATGGGGACCTGGCGAGGGGATGG + Intergenic
996872674 5:128208971-128208993 TTGGGTATGTGGCAGGAGGAAGG - Intergenic
996890332 5:128411427-128411449 ATGGGGAGGTGGAAAGCGGACGG + Intronic
996988232 5:129594786-129594808 TTGGGGAAGGGAGAAGAGGAGGG - Intronic
997766003 5:136503989-136504011 ATGGGGATGAGGCAGGAGGAAGG - Intergenic
998551422 5:143081263-143081285 ATTTAGAAGTGGGAAGAGGAGGG + Intronic
998791162 5:145767323-145767345 ATGGGGAGCTGGAAAGGGGATGG - Intronic
998864581 5:146484737-146484759 AAGGGGAAGTGGGAAAAGTAAGG - Intronic
998868521 5:146529853-146529875 ATGGGGAACTGGAAGGGGGATGG - Intergenic
999165952 5:149550007-149550029 ATGGGGAAGTGGGTAGAGGCAGG - Intronic
999212203 5:149899618-149899640 GAGAGGAGGTGGCAAGAGGATGG + Intronic
999666741 5:153920613-153920635 ATGGGGAGGTGGGAAGCAGAAGG - Intergenic
999668495 5:153937322-153937344 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
999860494 5:155640510-155640532 AAGGGGAAGAGAAAAGAGGAAGG - Intergenic
1000109681 5:158095943-158095965 GTGGGGGAGTGGAAAGAAGATGG + Intergenic
1000204672 5:159047522-159047544 ATGGGGGAGGGGCAACAGCAAGG + Intronic
1000233456 5:159336258-159336280 AAGGGGAGGTGGAAAGGGGAGGG - Intergenic
1000742511 5:164987230-164987252 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1000915440 5:167075458-167075480 ATGGGGATGTGGGAAGAAAAAGG + Intergenic
1000949424 5:167462566-167462588 ATGGGGAGCTGGAAAGGGGATGG + Intronic
1001594807 5:172891341-172891363 ATGGAGAAGAGGGAAGAGGATGG - Intronic
1001628717 5:173158594-173158616 AGGCGGAAGTGGCAGGAGGTGGG + Intronic
1002459946 5:179368379-179368401 CTGGGGATGTGGACAGAGGAGGG - Intergenic
1002762648 6:214046-214068 ATGGGGAGCTGGAAGGAGGAGGG - Intergenic
1002898298 6:1391612-1391634 CTGGGCAAGTGTTAAGAGGAGGG + Intronic
1003045733 6:2731286-2731308 AATGGGAACTGACAAGAGGATGG + Intronic
1003194015 6:3899011-3899033 ATGGGGAATTGGAAAGGGGATGG + Intergenic
1003332417 6:5140865-5140887 AGGTGGAAGTGGCATAAGGAAGG - Intronic
1003765965 6:9236817-9236839 AAGGGGAAATGGGAAGAGGTAGG - Intergenic
1003982781 6:11405075-11405097 ATGGGGAAGGGGATAGGGGAAGG + Intergenic
1004847490 6:19661588-19661610 ATGGGTTAGAGGAAAGAGGAAGG + Intergenic
1005169565 6:22967299-22967321 ATGGGGAAGAAGCACCAGGAAGG - Intergenic
1005399046 6:25412760-25412782 GTGGGGTAGTGGGAAGAGGCTGG + Intronic
1005900908 6:30215400-30215422 AGGGAGAAGTGGCATGAGGGAGG - Intergenic
1005976198 6:30801627-30801649 GTGGAGAAGTGGGCAGAGGAAGG + Intergenic
1006473279 6:34239997-34240019 AGGGGTAAGGGGAAAGAGGAGGG + Intronic
1006818642 6:36872530-36872552 ATAAGGAAGAGGCAAGAGAAAGG + Intronic
1006824328 6:36923321-36923343 GAGGGGAAATAGCAAGAGGAAGG - Intronic
1007094043 6:39202462-39202484 CTGGGGAAGGGGCAAGGTGAGGG + Intronic
1007115902 6:39343120-39343142 ATGGGCAGCTGCCAAGAGGACGG + Intronic
1007154498 6:39729270-39729292 ATGGGGAAGAGAGAAGAGAATGG + Intergenic
1007449138 6:41930105-41930127 GAGGGGAAGTGCCAAGAGGAGGG - Intronic
1007766933 6:44166157-44166179 TTGGGGCAGTGGCAAGAGGAAGG + Intronic
1007945796 6:45825881-45825903 ATGGGGATTGGACAAGAGGATGG - Intergenic
1008079291 6:47177940-47177962 TTGGGGAAGAGGCATGTGGATGG - Intergenic
1008963159 6:57287608-57287630 AGGGGGTGGGGGCAAGAGGAGGG + Intergenic
1009001666 6:57724310-57724332 ATGGGGAGTTGGAAAGGGGATGG - Intergenic
1009671935 6:66765169-66765191 ATTGGGAAGAGAGAAGAGGAAGG - Intergenic
1009698485 6:67142583-67142605 ATGGGGAACTAGAAAGGGGATGG - Intergenic
1010494222 6:76513818-76513840 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1010559501 6:77332818-77332840 ATGGGAAAGTGGGAAGGAGATGG - Intergenic
1011071518 6:83390811-83390833 ATGGGGAAGAGGGTAGAGGTAGG - Intronic
1011261696 6:85476696-85476718 ATGGGGAGCTGGAAAGGGGATGG + Intronic
1012545555 6:100415069-100415091 CTAGGGAAAAGGCAAGAGGAGGG + Intronic
1012587078 6:100936539-100936561 ATTGGGAGGTGGAAGGAGGAAGG + Intergenic
1012743694 6:103055046-103055068 ATGGGGAGGTGGAAAGCGGATGG + Intergenic
1012945458 6:105461162-105461184 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1013029596 6:106320268-106320290 ATGGGGCAGGGGAAAGAGGAGGG + Intronic
1014136170 6:117892510-117892532 AGGAGAAAGTGGCAAGAGAAGGG + Intergenic
1014332326 6:120085504-120085526 ATGGGGAGGGGGCAGGGGGAAGG - Intergenic
1014422866 6:121266911-121266933 GTGGGGAAGGGGCAAGGGGAGGG + Intronic
1014597937 6:123368825-123368847 ATGAGAAAGTGGCAAGAACAAGG - Intronic
1014635628 6:123843317-123843339 ATGGGGAGCTGGAAAGGGGATGG + Intronic
1014684369 6:124477709-124477731 AGGGGGAAGGGGGAAGAGTAAGG - Intronic
1015524695 6:134164929-134164951 ATGGGACAGTGGCAATAGAAAGG - Intergenic
1015858156 6:137647689-137647711 ATTAGGAAGTGGGAAGAAGAGGG + Intergenic
1016094054 6:140014509-140014531 AAGGGGAAGAGTCAAGAGGGAGG - Intergenic
1016236871 6:141878491-141878513 TTTTGGAAGTGGCAAGAGGCTGG + Intergenic
1016291580 6:142534066-142534088 TTGGAGAAGTGGCAAGGGGAAGG - Intergenic
1016855243 6:148662855-148662877 ATGGGGAAGGGGAAAGATCAAGG - Intergenic
1017262288 6:152401529-152401551 ATGGGCAAATAGAAAGAGGAAGG + Intronic
1017551988 6:155518793-155518815 AAGGAGAAGTGGTAAGAGGAAGG - Intergenic
1017586884 6:155936320-155936342 ATGAGTAAGTGGCAGAAGGAAGG + Intergenic
1017633611 6:156422844-156422866 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1017782359 6:157725794-157725816 ATGGGGAGTTGGAAAGGGGATGG - Intronic
1017804008 6:157927113-157927135 ATGGAAAACTGGAAAGAGGAAGG + Exonic
1018038046 6:159898545-159898567 AGGAGGAAGAGGCAGGAGGAGGG - Intergenic
1018083615 6:160279696-160279718 AAGGGTAGGGGGCAAGAGGAAGG - Intergenic
1018201437 6:161399168-161399190 ATGGGGAGCTGGAAAGGGGATGG - Intronic
1018280767 6:162183222-162183244 ATAGGGAAGATGTAAGAGGATGG + Intronic
1018501976 6:164421160-164421182 ATAGGGAAGTGGCCAGAGATTGG - Intergenic
1018542889 6:164902128-164902150 ATGGCAAAGTGGAAAGAGGGTGG + Intergenic
1018576112 6:165261974-165261996 AGGGGACAGTGGCAGGAGGAAGG + Intergenic
1019079463 6:169420424-169420446 ATGGTGAAGTGGCAAATGGTAGG - Intergenic
1019486505 7:1291937-1291959 AGAGGGAAGTGTGAAGAGGATGG - Intergenic
1019608248 7:1921012-1921034 GTGGGGAGGTGGGAAGAGGGCGG + Intronic
1019812070 7:3172110-3172132 AGGGAGAAGTGGGGAGAGGAGGG + Intronic
1020342795 7:7130977-7130999 AAGGGGAAGAGGAAAGAGAAGGG - Intergenic
1021041910 7:15872800-15872822 ATGGGGAGCTGGACAGAGGATGG - Intergenic
1021305396 7:19025248-19025270 GTGGAGAAGTGGCAAGATGGTGG + Intronic
1021798487 7:24281807-24281829 GTGAGGAAGAGGCAAAAGGAAGG + Intergenic
1021840447 7:24717843-24717865 AGAGGGAAGTGGGAAGAGGCCGG + Intronic
1022010883 7:26307324-26307346 ATGGGGAAGTTGGAAAAGGGGGG - Intronic
1022466507 7:30656030-30656052 ATGGGAAAGAGGGAAAAGGAAGG + Intronic
1022827357 7:34029424-34029446 ATGGAGGAGAGGCAAAAGGAAGG + Intronic
1022883185 7:34612204-34612226 ATGGGGATCTGGGAAGAGGCTGG + Intergenic
1022901072 7:34811256-34811278 ATGGGGAACTGGAAGGGGGATGG + Intronic
1022983201 7:35624366-35624388 ATGGGAAAGTGGCACAAGGGCGG + Intergenic
1022988071 7:35679822-35679844 ATAGGGAAGAAGTAAGAGGAAGG - Intronic
1023003739 7:35840179-35840201 AGGGGGAAGGGGGAGGAGGAGGG - Intronic
1023179135 7:37463668-37463690 GTGAGGAAGTGGGGAGAGGAAGG + Intergenic
1023300886 7:38769825-38769847 ATGGAGATGGGGCCAGAGGAGGG - Intronic
1023808280 7:43890656-43890678 GTGGGGAAGTGCCCAGAGGAGGG - Intronic
1024210998 7:47204009-47204031 AGAGGGAAGGGGAAAGAGGAAGG - Intergenic
1026238064 7:68545994-68546016 ATGGGAAAGTGGAGAGAGTAAGG - Intergenic
1026285045 7:68955407-68955429 AAGGGGAAGAGGCAGGGGGATGG + Intergenic
1026308833 7:69166264-69166286 ATGGGGAGGGGGGAAGGGGAGGG + Intergenic
1026613240 7:71879548-71879570 CTGGGGAAGTAACAACAGGAGGG - Intronic
1027533581 7:79367140-79367162 ATGGGTAAGTGGAAGGAAGAGGG - Intronic
1027900018 7:84100973-84100995 ATGGGGAAGTAGAAATAGCAGGG - Intronic
1028872287 7:95782799-95782821 ATGGGGAGCTGGAAAGGGGATGG + Intronic
1028931901 7:96422412-96422434 AGGGGTAAGTGGTAAGAGGGAGG + Intergenic
1029017277 7:97327507-97327529 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1029238390 7:99142665-99142687 ATGGGGGAGTGAGAAGAGGGTGG + Intronic
1029354377 7:100040647-100040669 AAGGAGAAGGGGGAAGAGGACGG + Exonic
1029367013 7:100123005-100123027 ATGGGGAAGGGGCCAGAGTGAGG + Intronic
1029408277 7:100390919-100390941 ATGGAGGAGTGGCCAGAGGTGGG + Intronic
1029600057 7:101558181-101558203 GTGGGGAAGGGGGATGAGGAAGG - Exonic
1029650278 7:101886717-101886739 ATGGAGAAGTGCCCAGAGCAGGG + Intronic
1029655888 7:101924156-101924178 ATGGGGAGGAGGACAGAGGATGG + Intronic
1030387166 7:108878209-108878231 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1030553660 7:110996292-110996314 ATGGGAAAGTGGCCTGTGGAGGG + Intronic
1030627163 7:111856737-111856759 ACGGGTAAGCGGGAAGAGGAGGG + Intronic
1030781370 7:113604273-113604295 ATGGGGCAGAGGCATGAGGGAGG + Intergenic
1030781848 7:113610679-113610701 ATGGGGAAGAGGGGAGAAGAGGG + Intergenic
1031041162 7:116839782-116839804 ATGAGGAAGAGGAAAGATGAGGG + Intronic
1031696178 7:124857682-124857704 AAGGGGAAGTGAAAAGAGGATGG - Intronic
1032414936 7:131728635-131728657 ATGGGTAAGTGGCCATGGGAGGG + Intergenic
1032425445 7:131819005-131819027 ATGGGGCAGGGGAAAGAGAAAGG + Intergenic
1032441276 7:131944826-131944848 AATGGGCAGTGGTAAGAGGAGGG - Intergenic
1033189001 7:139259303-139259325 AAGCGGAAGCGGAAAGAGGAAGG + Exonic
1033640900 7:143262738-143262760 ATGGGCAAGGGGCTAGAGAATGG + Intronic
1033767093 7:144505844-144505866 ATGGGGAGCTGGAAAGGGGATGG - Intronic
1033804362 7:144937525-144937547 AAGGGGAAGGGGGAAGGGGAAGG - Intergenic
1033804369 7:144937538-144937560 AAGGGGAAGGGGGAAGGGGAAGG - Intergenic
1033804387 7:144937580-144937602 AAGGGGAAGCGGAAAGAGAAGGG - Intergenic
1034004294 7:147451941-147451963 AAGGGGAAGAGGCAACAAGAAGG + Intronic
1034880568 7:154759441-154759463 AAGGGGCAGCGGCAATAGGACGG + Intronic
1035824397 8:2629083-2629105 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1035911147 8:3567525-3567547 ATGGGGGAGGGGAAAGAGAAAGG + Intronic
1036638168 8:10565437-10565459 ATGGGGGAGTGGGAAGAGTGGGG - Intergenic
1037000109 8:13707356-13707378 AGGGGGAAGTGGTAATGGGAAGG - Intergenic
1037485479 8:19342848-19342870 ATGGAGAAAGGGAAAGAGGAGGG + Intronic
1038395824 8:27244730-27244752 ATCAGAAAGTGGAAAGAGGAGGG + Intronic
1038471574 8:27827824-27827846 AAGGGGAAGTGGCAGGGGAAAGG - Intronic
1038544507 8:28414770-28414792 GTGGGGAAGTGGGCAGGGGAGGG - Intronic
1039464565 8:37775282-37775304 AAGGGTAAATGGCCAGAGGAAGG - Intronic
1039589392 8:38734035-38734057 ATGGGGAACTGGGGAAAGGAAGG + Intronic
1040536239 8:48313475-48313497 CAGTGGAGGTGGCAAGAGGAGGG - Intergenic
1040807657 8:51411326-51411348 TTGTGGAAATGGCAAGAGCAGGG - Exonic
1040946483 8:52890394-52890416 ATGGGAAAGAGGCAAGAGATGGG - Intergenic
1041370484 8:57154616-57154638 ATGGGGCAGTGGGATAAGGAGGG - Intergenic
1041646054 8:60253728-60253750 ATGGGAAAGTAGCATGAGGCAGG - Intronic
1042313950 8:67405762-67405784 CTGAGGAAGTGACTAGAGGAAGG - Intergenic
1042833155 8:73053434-73053456 ATGGGGAAGGAGGAGGAGGAGGG - Intergenic
1042954192 8:74230979-74231001 ATGGGGAAGACTCAAAAGGAAGG + Intergenic
1043934774 8:86130785-86130807 ATGGGGAAGAGGACAGAGGCAGG - Intronic
1044285887 8:90411817-90411839 TTGGGGAAGAGGTATGAGGATGG - Intergenic
1044461017 8:92443937-92443959 ATGGAGAAGTTTCAAAAGGACGG + Intergenic
1044540146 8:93399516-93399538 ATGGGGAAGCTGCAAGAAGAGGG + Intergenic
1045344912 8:101285174-101285196 GTGGGGAGGTGGCACGGGGAAGG - Intergenic
1045345753 8:101292091-101292113 ATGGAGCAGAGACAAGAGGATGG + Intergenic
1046708412 8:117481095-117481117 ATGTGGATGTGGAAAGAAGAAGG + Intergenic
1046795101 8:118363159-118363181 ATAGGGGAGTGGAAAGAGCATGG + Intronic
1047190001 8:122669691-122669713 TTGGGGAAGGGGCAGGATGAGGG - Intergenic
1047453486 8:124988209-124988231 CTGGGGAAGTGACCACAGGATGG - Intergenic
1047572264 8:126111867-126111889 ATGGGCAAGAGGGAGGAGGAAGG - Intergenic
1047871039 8:129082571-129082593 AGGGGGAAGGGTCCAGAGGACGG - Intergenic
1048650208 8:136467708-136467730 CTGGGGCAGAGGCAAGAGGAAGG + Intergenic
1048900364 8:139031737-139031759 ATGGGGAGCTGGAAAGGGGAAGG + Intergenic
1049092730 8:140528919-140528941 ATAGGGTAGTGGTAAAAGGATGG + Intergenic
1049350562 8:142162246-142162268 ATGGGTAAATGGATAGAGGATGG + Intergenic
1049357810 8:142197298-142197320 CTGGGGAGGAGGCAAGAGGCAGG - Intergenic
1049420617 8:142514937-142514959 TTGGGGCAGTGGCAGGACGAAGG + Intronic
1049832465 8:144710778-144710800 TTGGGGAAGAGGGATGAGGAAGG + Intergenic
1050715486 9:8519801-8519823 ACAGGGAAGTGGCAAGAGTCAGG + Intronic
1050831083 9:10014321-10014343 ATGGAGAAGTGGAAAGAATATGG - Intronic
1051005699 9:12340748-12340770 ATGGGGAAGTAGAAATAGGCTGG - Intergenic
1051771828 9:20587486-20587508 ATTGTGAAGTGGAAAGAGTAGGG - Intronic
1052395638 9:27934809-27934831 ATGGCAGAGTGGAAAGAGGATGG + Intergenic
1052750321 9:32483511-32483533 TTGGGGAAGTAGCAGAAGGATGG - Intronic
1052820169 9:33132213-33132235 GTTGTGAAGTGGGAAGAGGAGGG + Intronic
1053043881 9:34897380-34897402 CTGGGGAAGGGGCTAGAGAAGGG + Intergenic
1053113574 9:35482539-35482561 ATGGGGAAGGGAAAAGAAGATGG + Intergenic
1053357071 9:37455321-37455343 ATGGGGAGCTGGAAAGGGGATGG - Intronic
1054353444 9:64040613-64040635 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1054715807 9:68556952-68556974 AGTGGGCAGTGGCATGAGGATGG - Intergenic
1054723161 9:68623788-68623810 GTGGAGAAGGGGGAAGAGGAAGG + Intergenic
1055018225 9:71642191-71642213 ATGGGGGAGCAGGAAGAGGAGGG + Intergenic
1055063097 9:72091151-72091173 AGGAGGATGAGGCAAGAGGATGG + Intergenic
1056223009 9:84468348-84468370 ATGGGGAGGTGGGAAGGGGAGGG + Intergenic
1056318458 9:85414508-85414530 AGGGGAAACAGGCAAGAGGAAGG - Intergenic
1057067091 9:92064965-92064987 ATGTGGATGTGGCAACATGAAGG + Intronic
1057757885 9:97852291-97852313 ATGGGGGAGTGGGAAGAGAGCGG - Intergenic
1057908734 9:99002179-99002201 GGAGGGAAGTGGGAAGAGGAGGG - Intronic
1058257425 9:102785573-102785595 ATCTGGAAGTGGCAACAGGAAGG - Intergenic
1058442130 9:105019196-105019218 TTGGGGAAGTGGGTGGAGGAAGG - Intergenic
1058868871 9:109185633-109185655 AGGAGGAGGTGGCAAGAGAAGGG + Intronic
1059147679 9:111916325-111916347 ATGGGGAAAGTGAAAGAGGATGG - Intronic
1059441631 9:114310736-114310758 AAGAGGAAGAGGCAAGGGGAGGG + Exonic
1059721765 9:116966785-116966807 ATGGGGAAGGGGAAAGAGTGTGG - Intronic
1060150287 9:121284068-121284090 AGGGGGGCGTGGCAAGAGGAGGG + Intronic
1060190354 9:121588602-121588624 ATGGGGAAGAGGGAAGGGAAGGG + Intronic
1060214654 9:121731538-121731560 ATGGGGAAGTGGGAACAGAGTGG + Intronic
1060725384 9:126002674-126002696 ATGGGGAGGAGGCCAGGGGAGGG + Intergenic
1061726511 9:132584854-132584876 ATGGAGAAGGGGGAGGAGGAAGG + Intronic
1061912910 9:133734305-133734327 ATGGGGAAGTGGCAAGAGGAAGG - Intronic
1062182046 9:135196164-135196186 AAGGGGAAATGGGAAGGGGAAGG - Intergenic
1203695907 Un_GL000214v1:96717-96739 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1203741777 Un_GL000218v1:9723-9745 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1203701966 Un_KI270742v1:4313-4335 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1203640366 Un_KI270751v1:7346-7368 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1185796716 X:2971851-2971873 ATGGGGAGTTGGAAAGGGGACGG + Intergenic
1185975395 X:4714218-4714240 AAGGGGAACTGGAAAGGGGAGGG - Intergenic
1187324476 X:18273938-18273960 ATGGGGAATTGAAAAGGGGATGG - Intronic
1187943404 X:24403119-24403141 ATGGGGAGGGGGCAGGGGGAGGG - Intergenic
1187973275 X:24679949-24679971 ATGGAGAAGAGGAAAGGGGAAGG - Intergenic
1189044255 X:37573774-37573796 AAGGGGAAGAGGCAAGATTAAGG - Intronic
1189548887 X:42072588-42072610 GTGGGGAAGAGACAAGGGGAAGG + Intergenic
1189567995 X:42263522-42263544 ATGAGGATGTGGCAAGGGTATGG + Intergenic
1190303979 X:49072198-49072220 ACGGGGACGTGGCCAGTGGAAGG + Intronic
1190437306 X:50438213-50438235 GGGTGGAAGGGGCAAGAGGAGGG - Intronic
1190561947 X:51694974-51694996 ATGGGGAAGGGGAAGGAGAAGGG + Intergenic
1190912849 X:54788447-54788469 CTGGGGAAGAGGAGAGAGGATGG - Intronic
1190918105 X:54824923-54824945 CTGGGGAAGAGGAGAGAGGATGG + Intergenic
1191880639 X:65841205-65841227 ATGGGTATGAGGGAAGAGGATGG + Intergenic
1192089723 X:68140920-68140942 ATGGGGAATTGGAAAGGGGATGG - Intronic
1192963514 X:76153664-76153686 CTGGTGAAGTGTCAATAGGAAGG - Intergenic
1194066936 X:89272148-89272170 AAATGGAAGTGGCAAGAGTACGG + Intergenic
1194156112 X:90391255-90391277 ATGGGAAAATGGCAAGAGGAAGG - Intergenic
1194513333 X:94821623-94821645 GTGGGGAAGTGGTATGTGGATGG - Intergenic
1194956702 X:100189579-100189601 TTTGGGAAGTGGCAACAGGGAGG - Intergenic
1195013469 X:100755574-100755596 ATGGGGAAGAGGTATGTGGATGG - Intergenic
1195289072 X:103414195-103414217 ATGGCGATGTGGCAGGAGGAGGG + Intergenic
1195969082 X:110454751-110454773 ATTGGGAAGAGGCAAGGGGGAGG + Intronic
1195969707 X:110459984-110460006 ATGGAGAAGTGACAAGACAAAGG - Intergenic
1196393172 X:115231153-115231175 ATTAGGAAGAGACAAGAGGAAGG - Intronic
1196545042 X:116952843-116952865 ATGGTGTAGTGGAAAGATGATGG + Intergenic
1196812673 X:119641128-119641150 AAGGGGAAGTGGAATGAGGGGGG + Intronic
1196923397 X:120607787-120607809 TTGGGGAAGTGGGGGGAGGAAGG - Intronic
1196942555 X:120791620-120791642 GTTGGGAAGTGGCAAGGTGATGG - Intergenic
1197591956 X:128420012-128420034 ATGGGGAAGAGGTATGTGGATGG + Intergenic
1197744321 X:129920812-129920834 TTGGGGAAGAGCCATGAGGATGG + Intronic
1197997395 X:132392739-132392761 ATGGTGAAGAGGAAAGAGGAAGG - Intronic
1198157778 X:133979125-133979147 AAGTGGAAGTGGCAATAAGAAGG - Intronic
1198434590 X:136603833-136603855 ATGGTGAGGTGGACAGAGGAGGG - Intergenic
1199541511 X:148963009-148963031 TTGGGGATGTTGCAGGAGGAAGG + Intronic
1199575688 X:149311748-149311770 ATGGGGAACTGGAAAGGGGATGG + Intergenic
1199617744 X:149671374-149671396 TTGGGGAAGTGGATGGAGGAGGG + Intergenic
1199624898 X:149731875-149731897 TTGGGGAAGTGGATGGAGGAGGG - Intergenic
1200155359 X:153972099-153972121 GAGGGGAAGTGGCAAGATGGCGG - Intergenic
1200204992 X:154309355-154309377 TTGTGGATGTGGCAACAGGATGG + Exonic
1200323523 X:155214726-155214748 ATTTGGATCTGGCAAGAGGAAGG + Intronic
1200502458 Y:3968228-3968250 ATGGGAAAATGGCAAGAGGAAGG - Intergenic
1200721099 Y:6606310-6606332 AAATGGAAGTGGCAAGAGTACGG + Intergenic
1201155309 Y:11127177-11127199 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1201237610 Y:11926148-11926170 ATGGGGAGGTGACACCAGGAAGG - Intergenic
1201341804 Y:12942323-12942345 AAGGGGAAGGGGCAAGAAGAAGG + Intergenic
1201634301 Y:16105092-16105114 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1201751498 Y:17436650-17436672 ATGGGGAGATGGAAAGGGGATGG + Intergenic
1202379399 Y:24262418-24262440 TTGGGGAAGTGGGGAAAGGAGGG - Intergenic
1202491383 Y:25407703-25407725 TTGGGGAAGTGGGGAAAGGAGGG + Intergenic