ID: 1061912912

View in Genome Browser
Species Human (GRCh38)
Location 9:133734309-133734331
Sequence TGCCATGGGGAAGTGGCAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 368
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 338}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061912912 Original CRISPR TGCCATGGGGAAGTGGCAAG AGG (reversed) Intronic
900702946 1:4059205-4059227 GTCCCTGGGGAAGTGTCAAGTGG + Intergenic
901241054 1:7693672-7693694 TTCCATGGGGAAGAGGACAGTGG - Intronic
901483329 1:9540508-9540530 TGACAAGGGGAGGTGGCGAGGGG - Intronic
901565290 1:10109180-10109202 TGCTGTGAGGAAGTGGCAGGGGG + Intronic
901824021 1:11848729-11848751 TTCCCTGAGGACGTGGCAAGTGG + Intergenic
902715937 1:18272712-18272734 TGCCCTGGGGCAGTGGAGAGGGG + Intronic
903668892 1:25024056-25024078 TGCCGTGGGGATGGGGCAATGGG - Intergenic
904344939 1:29861598-29861620 TGCAATGGGGCAGTGGCAGAGGG + Intergenic
904373206 1:30063796-30063818 TGCGATGGGAAAATGGCCAGAGG + Intergenic
905219627 1:36435946-36435968 TTCCAAAGGTAAGTGGCAAGAGG + Intronic
906675848 1:47693230-47693252 TTCAATGGGGCTGTGGCAAGAGG - Intergenic
908558186 1:65278968-65278990 TGCCATGGGGAAGGGGATGGAGG - Intronic
908602810 1:65759349-65759371 TGCCTGGGGGAAGGGGCAAGGGG - Intergenic
908686034 1:66721138-66721160 TGATATGGGGATGTGGCAAATGG - Intronic
909980382 1:82093014-82093036 TGAGATGGGGATGTAGCAAGGGG - Intergenic
912942897 1:114060765-114060787 GGCAATGTGGAAGTGGCAATGGG + Intergenic
915001476 1:152597714-152597736 TGGCCTGGGGAAGTTTCAAGGGG + Intronic
915287972 1:154864869-154864891 GGGCATGGGGAAGTGGCTTGAGG + Intronic
915921325 1:159977912-159977934 TGCCATGGGGAAAAGGGAGGGGG + Intergenic
916058013 1:161081282-161081304 TGCCATGAGCAAGTGGTGAGGGG + Intronic
916633023 1:166637497-166637519 TGCCATTGGGCAGTGGCATCAGG + Intergenic
917211023 1:172632104-172632126 TGGGATGGGGAACTGGAAAGGGG - Intergenic
917448682 1:175128275-175128297 AGGCATGGGGAAGTGGAAATGGG + Intronic
918406047 1:184212938-184212960 TGCCATGCGGGTGGGGCAAGGGG - Intergenic
918657270 1:187043811-187043833 TGGCATGGGGAAGCTGGAAGAGG - Intergenic
918817516 1:189208598-189208620 TGTCATGGGGTAGGGGGAAGGGG - Intergenic
919403247 1:197146419-197146441 TGCCATGGCGAACCGGCGAGTGG - Exonic
919807966 1:201391977-201391999 TGGCATCTGGCAGTGGCAAGAGG - Intronic
920166422 1:204039421-204039443 TGCCGTTGGGTAGAGGCAAGAGG + Intergenic
920847264 1:209604601-209604623 TGTCATGGGACAGTGGTAAGGGG + Intronic
921051990 1:211517411-211517433 AGGCATGGGGAAGTGGCAGCAGG - Intergenic
922038293 1:221871248-221871270 TGCCACGTGGAGGTGGCCAGGGG - Intergenic
922460011 1:225808737-225808759 TCCCCTGGTGAAGTGGCCAGAGG + Intergenic
924325047 1:242887394-242887416 TGACATGGGGAAGCTGCAGGAGG - Intergenic
924795409 1:247289024-247289046 TGCCATGGGGAATGTGGAAGTGG - Intergenic
924875973 1:248105084-248105106 TGCCAGGGAGTGGTGGCAAGGGG - Intergenic
1063832616 10:9972176-9972198 CTCCATGGGCAAGTGGCAATTGG + Intergenic
1065252885 10:23834836-23834858 TGCCATGGAGGGGTGGCAGGTGG + Intronic
1065294325 10:24259977-24259999 AGCCATGGGGAAATTGCAAAGGG - Intronic
1065670597 10:28112970-28112992 TGCCTTGAGGAAGTGGGAGGAGG - Intronic
1067174479 10:43933945-43933967 TGGGATGGGGAATTGGAAAGGGG - Intergenic
1067533485 10:47091597-47091619 AGCCAAGGGTAAGTGGCAGGAGG - Intergenic
1068251489 10:54448166-54448188 TGCCATGTGAAAGTGGCATCTGG + Intronic
1069916613 10:71790585-71790607 TGGCAGGGGGACGTGGGAAGAGG + Intronic
1070550520 10:77487529-77487551 TGCAATGGGGGTGTGGTAAGGGG - Intronic
1071485495 10:86099492-86099514 TGCCCTGGTGAAGGGACAAGGGG - Intronic
1071523976 10:86347535-86347557 TTCCAGGGGCAAGTGGCCAGGGG + Intronic
1071612872 10:87047499-87047521 TGCCTTGGGGCAGTGGAAAATGG + Intergenic
1071816185 10:89234525-89234547 TGCCAGAGGGAAGGGGCAAGAGG - Intronic
1072001622 10:91200924-91200946 TGACAGAGGGAAGTGGAAAGGGG + Intronic
1072566054 10:96617628-96617650 TGACATGGGGATGTGGCTGGGGG + Intronic
1075514999 10:123101502-123101524 GGGCATGGGGAAGTGGCAAGGGG - Intergenic
1076273625 10:129177910-129177932 TGACATGGTTAAGAGGCAAGTGG + Intergenic
1077328435 11:1973572-1973594 TGCCCTCGGGAAGAGGCATGCGG + Intronic
1077329912 11:1979689-1979711 CGTCATGGGAAAGTGGCGAGGGG - Intronic
1077409243 11:2395783-2395805 ACCCATGGGGAGGTGGCCAGGGG - Intronic
1078242190 11:9539888-9539910 TGTCCTGGAGAAGTGGCCAGTGG - Intergenic
1078526211 11:12103523-12103545 TGTGATGGAGAAGTGGCAGGAGG + Intronic
1078611113 11:12820257-12820279 TGCTGTGGGGAAGTGGAGAGTGG + Intronic
1078877640 11:15414103-15414125 TGCCATGGGGAACTAGTAAAAGG + Intergenic
1078887990 11:15524853-15524875 TGCCAGGGGGAGGTGTAAAGGGG + Intergenic
1079141357 11:17812133-17812155 TGCCATGGAGAAGTGGGTTGGGG - Intronic
1079161381 11:17997861-17997883 TGCCATGGGCCAGTGGAATGGGG + Intronic
1080760255 11:35242010-35242032 TGCAATGGGGAAATGCCTAGTGG - Intergenic
1080875100 11:36267620-36267642 AGCCATGGGAAAGAGGGAAGGGG - Intergenic
1081179138 11:39966054-39966076 TGGGATGGGGAATTGGAAAGGGG - Intergenic
1083659625 11:64246124-64246146 AGCCTTGGGCAAGAGGCAAGGGG - Intronic
1083766412 11:64843592-64843614 GGCCATGGGGAAAAGGCACGGGG - Intronic
1084647114 11:70464992-70465014 TGCCCTGGGGATGTGGGAGGGGG + Intergenic
1084891108 11:72237569-72237591 TTCCTGGGGGAAGTGGCCAGTGG + Exonic
1085624452 11:78061323-78061345 TGCCAAGGGGACTTGACAAGAGG + Intronic
1086300746 11:85423994-85424016 GGCCATGGGGAAATGGCCATGGG - Intronic
1086334298 11:85784044-85784066 TGCCATGGGCACATGGCACGTGG - Intronic
1086644188 11:89198906-89198928 TGTCATGGGGTAGGGGTAAGGGG - Intronic
1087528810 11:99353039-99353061 TGGCAGGGGCAAGTGGCAGGTGG - Intronic
1088690067 11:112318734-112318756 TGGCATGGGGAGGTTGCAGGTGG - Intergenic
1089323197 11:117640198-117640220 TGCCAGGTGGGAGTGGCAAGTGG - Intronic
1089904777 11:122027315-122027337 TTCCAGTGGGAAGTGGCCAGTGG + Intergenic
1090275189 11:125413968-125413990 TCCCAGGGGTAAGTTGCAAGTGG - Intronic
1090955384 11:131509119-131509141 TGACATGGTGTAGAGGCAAGGGG - Intronic
1091182950 11:133623434-133623456 TGCAATGGGAAGATGGCAAGGGG + Intergenic
1202811413 11_KI270721v1_random:28751-28773 TGCCCTCGGGAAGAGGCATGCGG + Intergenic
1202812890 11_KI270721v1_random:34868-34890 CGTCATGGGAAAGTGGCGAGGGG - Intergenic
1091496432 12:977227-977249 TGCCAAGGGGGAGGGACAAGAGG - Intronic
1094012231 12:25821445-25821467 TGCCTTGAGAAAATGGCAAGAGG - Intergenic
1094699662 12:32856598-32856620 TGTCATGGGGAAGGGGGAAAGGG + Intronic
1095747635 12:45677229-45677251 TGCTATGGGGAAGGGGCTAGTGG + Intergenic
1095876335 12:47082893-47082915 TGTCATGTGGAAGAGGCCAGAGG - Intronic
1096243078 12:49969744-49969766 TGCACTGGGCCAGTGGCAAGTGG + Intronic
1096785235 12:54013547-54013569 TGCCAAGGTGAAGTGGGGAGTGG - Intronic
1097616113 12:61886378-61886400 TTCCATGGGGCAGTGGCAGTGGG - Intronic
1098393165 12:69990896-69990918 TGCCCTGGGGATGTGGAAACAGG + Intergenic
1099671631 12:85701444-85701466 TGCTATGGGGTAGTTGAAAGAGG - Intergenic
1100347364 12:93745512-93745534 TGCTATGGGGAAGTGACTGGTGG + Intronic
1101530841 12:105572045-105572067 TACCTTGGGCAAGAGGCAAGGGG - Intergenic
1103037126 12:117665543-117665565 GGCCATGGGGAAGTGGGGAGGGG + Intronic
1103433400 12:120906182-120906204 TCCCTTGGGGAACAGGCAAGCGG - Intergenic
1103857420 12:123982562-123982584 TGGAATTGGGAAGTGGGAAGTGG - Intronic
1104789549 12:131473099-131473121 GGCCAGGGGGAAGAGGCACGTGG + Intergenic
1105278213 13:18948434-18948456 GGCCATGGGGAAGTGGGCAGGGG - Intergenic
1107841285 13:44459875-44459897 TGCCAAGGGTCAGTGGCAAGGGG - Intronic
1108094723 13:46889876-46889898 TGCCCTGAGGAGGGGGCAAGCGG - Intronic
1109776231 13:67044398-67044420 TGCCATGTGGAATTGGCATTTGG - Intronic
1110679014 13:78285592-78285614 AGCCAAAGGGAAGTGGGAAGTGG + Intergenic
1111762796 13:92486523-92486545 TGACATAGGGAACTGGAAAGTGG + Intronic
1111850441 13:93566710-93566732 TGTCAAGGGGAGGGGGCAAGGGG - Intronic
1112247086 13:97745229-97745251 TGCAATGGGGAGGTGGAAAGGGG - Intergenic
1113055101 13:106259471-106259493 TGGGATGGGGAATTGGAAAGGGG + Intergenic
1113678293 13:112223239-112223261 TGGCACGGGGAAGTGGCATGGGG - Intergenic
1114381339 14:22207741-22207763 TGCCTAGGGGAAGTGGGGAGGGG + Intergenic
1115508961 14:34120961-34120983 TGCCATGGGGACTTGGCTAAAGG - Intronic
1115559382 14:34569337-34569359 ACACATGGGGAAATGGCAAGTGG - Intronic
1117738104 14:58788022-58788044 TGCCTTGGGAAAGATGCAAGTGG - Intergenic
1118489402 14:66244545-66244567 TGTCATGGGGAAGAAGAAAGAGG + Intergenic
1118491734 14:66267684-66267706 CTCCATGCGGGAGTGGCAAGGGG - Intergenic
1119181362 14:72607386-72607408 TCACATGGTGAAGGGGCAAGGGG + Intergenic
1119181506 14:72608412-72608434 TGCCCTGGGCAAGGAGCAAGAGG - Intergenic
1119198355 14:72733830-72733852 ATCCATGAGGAAGCGGCAAGCGG + Intronic
1122347231 14:101067948-101067970 TGTGATAGGGAAGAGGCAAGGGG - Intergenic
1126690023 15:51281734-51281756 TGCCCTGGGCAAGTGGGATGTGG + Intronic
1126897899 15:53279652-53279674 TGTCAGGGGGTAGGGGCAAGGGG - Intergenic
1128233321 15:66050484-66050506 TGCCATGTGCAAGGGGCAGGAGG + Intronic
1128314294 15:66650603-66650625 AGCCATGGGGAAGTGGGACAGGG + Intronic
1128531005 15:68447683-68447705 TGGGAAGGGGAAGTGGCAATTGG + Intergenic
1128774592 15:70309858-70309880 GGCCATGGGGGAGTGGGGAGGGG + Intergenic
1128778027 15:70338647-70338669 TGCTATGGGGTACTGGGAAGGGG + Intergenic
1128778774 15:70344071-70344093 TGGCATGGGAAAGTGGGGAGAGG - Intergenic
1129150844 15:73686959-73686981 TGCCCTGGGGATGTGGGAAAAGG - Intronic
1131123698 15:89840040-89840062 TGCCATGAGGCAGGGGGAAGAGG + Intronic
1132018421 15:98339323-98339345 GGCCATGGGGAAGGGGGAATGGG - Intergenic
1134817600 16:17218905-17218927 TACCCTGGGGCAGTGGCAGGGGG + Intronic
1136141952 16:28293559-28293581 TGCCATGGAGAGGGGGGAAGAGG + Intronic
1137290698 16:47050144-47050166 TGCGCTGGGGAAGGGGCAATGGG + Intergenic
1137460915 16:48662494-48662516 TGTCATGGGGTAGGGGGAAGGGG - Intergenic
1138215272 16:55199403-55199425 TGCCATTGGGCAATGCCAAGTGG + Intergenic
1138891916 16:61154043-61154065 TGTCATGGGGTAGGGGGAAGGGG - Intergenic
1139523238 16:67497340-67497362 TGACATGGGGAAGTGGTGGGTGG - Intergenic
1141083146 16:81071249-81071271 TGTCATGGGGAAGCTCCAAGTGG + Intronic
1142346394 16:89556808-89556830 TGTCCTGGGGAGGTGGCAAGAGG - Intronic
1143305383 17:5942264-5942286 TGGCTTCGGGAAGTGACAAGAGG - Intronic
1144342934 17:14325173-14325195 TGCCATGGGGCAATGGCTACTGG + Intronic
1145011778 17:19372406-19372428 GGCCAGAGGGAAGTGGCAGGAGG - Intronic
1145751662 17:27359552-27359574 TGCCAGGGGGAAGGAGCATGTGG - Intergenic
1146322375 17:31857075-31857097 TGCCACGGTGAAGTGTCATGAGG - Intronic
1148695222 17:49554853-49554875 TGCCATGGGGATGGGGCCACGGG - Intergenic
1148699032 17:49577053-49577075 TGGCATGGGGCGGTGGCAAGGGG - Intronic
1149007559 17:51821311-51821333 TGCCATGGACAGGTGGAAAGAGG + Intronic
1150722514 17:67625643-67625665 TGCCACGGAGCAGTGGGAAGTGG - Intronic
1150887062 17:69099353-69099375 TGCCATGGGGAAGTGGGAGTGGG + Intronic
1151430558 17:74059722-74059744 TGCCTTGGGGACGTTGAAAGAGG + Intergenic
1151819629 17:76490541-76490563 TGCCCTGGGGAACTGGCACTGGG + Intronic
1152064355 17:78102264-78102286 CACCACGGGGAAGTGGGAAGGGG + Intronic
1153815519 18:8786822-8786844 TGCCATTGGGGACTGTCAAGGGG + Intronic
1154146808 18:11873691-11873713 TGCCATGGGCAAGCGGCACCCGG - Intronic
1154491315 18:14924534-14924556 TGTCATGAGGAACTGGCATGAGG + Intergenic
1155086199 18:22460790-22460812 TCCCCTGGGGTAGTGGGAAGGGG - Intergenic
1155210898 18:23601017-23601039 GTCCATGGTGAAGGGGCAAGAGG + Exonic
1155434811 18:25801370-25801392 TTCCATGTGTAAGTGCCAAGAGG + Intergenic
1156728264 18:40157413-40157435 TGTCATGGGGTAGGGGGAAGGGG - Intergenic
1156771666 18:40735161-40735183 TGCCTTGGTGAAGAGGCCAGTGG - Intergenic
1157114890 18:44853196-44853218 TACCATGGGCAAGTTGTAAGTGG - Intronic
1157329108 18:46690291-46690313 TGCCATGAGGGAGTGTCAGGTGG - Intronic
1158655988 18:59334677-59334699 TGAGATGGAGAAGTGGGAAGAGG + Intronic
1160538654 18:79608874-79608896 TGCCATGGGTGAGGGACAAGGGG - Intergenic
1160890150 19:1373473-1373495 AGCCATGGGGCTGTGGAAAGAGG - Intronic
1161937173 19:7379159-7379181 TACCATGGGTAAGTGGGAATCGG + Exonic
1163185179 19:15633300-15633322 AGCTGTGGGGAAGTGGGAAGAGG + Intronic
1163490535 19:17614891-17614913 TGCCAGGGGGAATTGGACAGTGG + Intronic
1164748313 19:30631979-30632001 TGGTTTGGGGAGGTGGCAAGAGG - Intronic
1165110616 19:33500013-33500035 TGCAGTGTGGAAGTGGCCAGGGG - Intronic
1165347799 19:35259716-35259738 GGCCTTGGGGATGTAGCAAGAGG - Intronic
1166664951 19:44673872-44673894 TGTCCTGTGGAAATGGCAAGGGG - Intronic
1167556037 19:50196281-50196303 TGGCATGGGGAGATGGAAAGAGG + Intronic
1168099029 19:54131215-54131237 TGCCATGGGGAAGGGCCTGGGGG + Intronic
925301322 2:2815021-2815043 TGTCATGGGGTAGGGGGAAGGGG - Intergenic
926521110 2:13915104-13915126 GGCCATGGGGAAGAGGGAATGGG + Intergenic
926710331 2:15874524-15874546 TGGTATGGGGAAGTGGGAGGTGG - Intergenic
927171695 2:20375567-20375589 TGACCTGGGGCAGTGGCAATAGG + Intergenic
927196521 2:20551450-20551472 TGCCATGGGGCTGTGGCCAGCGG - Intergenic
928436716 2:31259194-31259216 TGCCACGGGGGAGTGGCAGGAGG + Intronic
928600424 2:32898989-32899011 TGGCATGGGGGAGAAGCAAGAGG - Intergenic
930779862 2:55213849-55213871 TGACATGGGCAAGTGGGAAGTGG + Intronic
930985592 2:57583712-57583734 TGCTGTGGGGTAGTGGTAAGGGG - Intergenic
931784024 2:65602957-65602979 TGCCAAGGGGAATTGGCATAGGG + Intergenic
933840924 2:86284948-86284970 TGCCCTGGGGAAGGGGAAATGGG + Intronic
935958173 2:108399246-108399268 TGGGATGGGGAGGTAGCAAGGGG - Intergenic
937100341 2:119263756-119263778 AGCCTTGGGGAAGTAGCAAAAGG - Exonic
937263164 2:120599249-120599271 TGCCAGCGGGAAGTGGGAAGGGG - Intergenic
939297812 2:140292461-140292483 TGCAAAGCGGAAGTAGCAAGGGG - Intronic
944683646 2:202098919-202098941 TGCCAAGGAGAAGAGGAAAGGGG + Intronic
944969250 2:204973054-204973076 GGGCATGGGGAAGAGGCCAGAGG - Intronic
945324693 2:208468937-208468959 TATCATGGGGAACTGGGAAGAGG + Intronic
946155528 2:217804412-217804434 TGCCATGGGGAAGGGGCTTGTGG - Exonic
946199733 2:218064709-218064731 TGCCATGCTGAAGGGGCAATTGG + Intronic
946870406 2:224079384-224079406 TGCCAGGTGGAGGTGGTAAGGGG - Intergenic
947519027 2:230829563-230829585 AGCCATGTGGCAGTGGCATGGGG - Intergenic
948007888 2:234625600-234625622 TGGCATGGGGAAGAAGCAGGCGG - Intergenic
948246569 2:236491322-236491344 GGCCATGGGGAAGTCGCAGCAGG + Intronic
948311493 2:236990265-236990287 GCCAATGGGGAAATGGCAAGAGG + Intergenic
1168798479 20:628392-628414 TGCCATGTGAAAGAGGGAAGAGG - Intergenic
1170487043 20:16828868-16828890 TTCAGTGGGGAAGTGGGAAGGGG + Intergenic
1170661720 20:18348130-18348152 TGCAGCAGGGAAGTGGCAAGAGG - Intergenic
1171970598 20:31562612-31562634 GGCCCTGGGGAAGGGGAAAGGGG - Intronic
1172152196 20:32798380-32798402 TTCCCTGTGGAAGTGGTAAGGGG + Intronic
1172449872 20:35014279-35014301 TTACAAGGGGAAGTGGCTAGAGG + Intronic
1172812348 20:37657677-37657699 TGGCATCGGGAGGTGGAAAGGGG - Intergenic
1175995613 20:62810936-62810958 GGCCATGGGAAAGTGCCAGGAGG - Intronic
1176172507 20:63702307-63702329 TCACATGAGGAAGGGGCAAGAGG + Intronic
1178367485 21:31999449-31999471 AGCCTGGGGGAAGTGGGAAGTGG - Exonic
1179115806 21:38490796-38490818 TGGCAAGGGGAAGTGGAAAGAGG - Intronic
1180119366 21:45736576-45736598 TGGCATGGGGAGTTGGCAGGGGG + Intronic
1180151570 21:45950817-45950839 TGCCACGGGGCAGTGCCAACAGG - Intergenic
1182110776 22:27721692-27721714 AGCCAAGGGGAAGTGAGAAGGGG - Intergenic
1182145928 22:27996640-27996662 GGCCATGGGGAGGTGGGGAGCGG + Intronic
1182310862 22:29405515-29405537 TGCCCTGGAGAGGTGGCAGGTGG - Intronic
1182583299 22:31328142-31328164 TGCCTTGGGGATGAGGCCAGGGG - Intronic
1182952920 22:34394534-34394556 AGCCATTGGGAAGTGGCAGTTGG - Intergenic
1183219145 22:36501091-36501113 TGTCTTGGGGAAGTGACAACAGG - Intronic
1183508176 22:38220745-38220767 GGCCAGGGGGAAGGGGCATGAGG + Exonic
1184143838 22:42596529-42596551 TCCCATAGGGAAGGGGCAGGGGG + Intronic
1184384286 22:44165516-44165538 GGCCATGAGGGAGTGGCTAGAGG + Intronic
1184749464 22:46476757-46476779 TGCCAAGCGCAAGGGGCAAGAGG + Intronic
1185310255 22:50150367-50150389 AACCATGGGCAAGAGGCAAGGGG + Intronic
1185343615 22:50302103-50302125 TGGCATGGGGAAGTGGGGTGGGG + Intronic
949689668 3:6621299-6621321 TGGGATGGGGAATTGGAAAGGGG - Intergenic
950019890 3:9779854-9779876 TGCCATGGGTTAGTGGCCATGGG + Exonic
950225924 3:11234497-11234519 TGCCTTGGGGGAATGGCCAGCGG - Intronic
950609031 3:14113131-14113153 TGCCTTGGGGGAATGGCCAGCGG - Exonic
950726152 3:14918356-14918378 TACCATGGGGAAGGGGAAGGAGG + Intronic
950827799 3:15843846-15843868 AGCAATGGGCAAGTTGCAAGAGG + Intronic
954539658 3:51385183-51385205 ACCAATGGGGAAGTGGCATGTGG + Exonic
955876220 3:63492631-63492653 TCCCATAGGGAAGTGACAAGCGG + Intronic
956808041 3:72836517-72836539 GGCCAGGGGGAAGAGGAAAGAGG - Intronic
959602240 3:108200433-108200455 TGCCAGGGGTAGGTGGTAAGTGG + Intronic
959664830 3:108909421-108909443 TCCCATGGGTCAGTGGCAACGGG + Intronic
959710650 3:109382739-109382761 TGCCATGGGGAAGCTGTAGGCGG - Intergenic
965622954 3:170658825-170658847 TGGCATGGGGAAGGGGAGAGGGG + Intronic
967979547 3:195057600-195057622 TGCCATGGGGAAAGGGGAAAAGG + Intergenic
968626560 4:1628716-1628738 TGGCATGGGGGAGTGGCATGGGG + Intronic
968626582 4:1628762-1628784 TGGCATGGGGGAGTGGCATGGGG + Intronic
968912346 4:3482733-3482755 TGTCTTGGGGAAGGGGCAGGGGG + Intronic
969938663 4:10708099-10708121 TGACAGGAGGAAGTGGCAGGAGG + Intergenic
970578497 4:17451294-17451316 TGGGATGGGGAATTGGAAAGGGG + Intergenic
971088522 4:23310552-23310574 TGCCATTGGGAAATGGCAGGAGG - Intergenic
971724993 4:30300018-30300040 TGCAATTGGAAAGTGGCAAGAGG + Intergenic
975077302 4:70227093-70227115 TTCCATGTGGAAGTCTCAAGTGG + Intronic
975308274 4:72873842-72873864 TGTCATGGGGTGGGGGCAAGGGG + Intergenic
976933185 4:90594076-90594098 TGCTATGGGGATGTGGCTATTGG + Intronic
977953790 4:103003646-103003668 TTCACTGGGGTAGTGGCAAGAGG - Intronic
978713378 4:111812236-111812258 TTCAATGGGGAAGTGGATAGGGG + Intergenic
979635159 4:122948764-122948786 TGCCATGTGGAAGTTGCTGGGGG - Intronic
979799229 4:124887163-124887185 AGCCATGGGGTAGAGGGAAGTGG + Intergenic
980705556 4:136488592-136488614 AGACATGGGGAGGTAGCAAGTGG + Intergenic
985539150 5:479752-479774 TGCCATGGGGCAGTGAGGAGAGG - Intronic
986539432 5:8828353-8828375 ACCAAAGGGGAAGTGGCAAGTGG + Intergenic
986608472 5:9545692-9545714 GGCTCTGGGGAAGTGGCAGGGGG - Exonic
987162684 5:15160569-15160591 GGGAATGGGGAAGTGGCAATGGG + Intergenic
987396741 5:17431567-17431589 TGCCAAGGGAAAATGGAAAGAGG - Intergenic
987793573 5:22599428-22599450 TGCACTGGGGCAGTGGCCAGAGG - Intronic
987964169 5:24850785-24850807 TGGCATGGGGAAGTTGGAGGTGG - Intergenic
988908744 5:35817746-35817768 TGCTGAGGGGAAGTGGCCAGAGG - Intergenic
989359456 5:40584105-40584127 TGGGATGGGGAAGAGGCAGGGGG + Intergenic
989521910 5:42412457-42412479 TGTCATGGGGTAGGGGCATGGGG - Intergenic
989823042 5:45818601-45818623 TGTCATGGGGTAGGGGGAAGGGG + Intergenic
990079842 5:51899496-51899518 TGAGATGGGGAACTGGAAAGAGG + Intergenic
990580245 5:57160822-57160844 TGCCCTGGGCAATGGGCAAGGGG - Intergenic
992226476 5:74624005-74624027 TGGCATGGGGAAGCTGCAAGTGG + Intergenic
992533159 5:77671638-77671660 AGCCATGAGGAAATGGAAAGGGG - Intergenic
992780673 5:80124298-80124320 TGGCACGGGGAAGCTGCAAGTGG - Intronic
993870842 5:93252442-93252464 TGCGTTGGGGATGTGGAAAGGGG + Intergenic
995066016 5:107863873-107863895 TGCCATGGTGCACTGGGAAGGGG - Intronic
996890331 5:128411423-128411445 TGGGATGGGGAGGTGGAAAGCGG + Intronic
997461776 5:134057765-134057787 TGCAATGTGGCAGGGGCAAGGGG - Intergenic
1000260635 5:159585197-159585219 GGCCAAGGGGAAGGGGCATGAGG - Intergenic
1003224046 6:4188962-4188984 TGCCAGGGCGCAGTGGGAAGGGG + Intergenic
1003615041 6:7647491-7647513 TGCCTTGGGTAAATGGCCAGTGG + Intergenic
1005712483 6:28515372-28515394 CACCAGGGGGAAGTGGCAAAGGG + Intronic
1007590183 6:43016347-43016369 AGGGATGGGGAAGTGGCAGGAGG + Intronic
1007766932 6:44166153-44166175 TTGCTTGGGGCAGTGGCAAGAGG + Intronic
1009607998 6:65898515-65898537 CCTCATGGGGAAGTGGTAAGAGG + Intergenic
1010582868 6:77620938-77620960 TGCCAGGGGCTAGTGGGAAGGGG - Intergenic
1011079368 6:83472640-83472662 TGCCATTCGGAAGTGGCTGGTGG - Intergenic
1012113482 6:95263496-95263518 TGGGATGGGGAGGTGGAAAGGGG + Intergenic
1012528238 6:100203058-100203080 TGCCATGTGGAAGTGGGTGGGGG - Intergenic
1012743693 6:103055042-103055064 TGGGATGGGGAGGTGGAAAGCGG + Intergenic
1013269035 6:108528602-108528624 TGACATGAGGCAGTGGCTAGGGG - Intergenic
1013650658 6:112191512-112191534 TGCCCTGGGAAAGTGACAAGGGG + Intronic
1013953916 6:115818734-115818756 TGGGTTGGGAAAGTGGCAAGAGG - Intergenic
1014332327 6:120085508-120085530 TGTCATGGGGAGGGGGCAGGGGG - Intergenic
1014487345 6:122015948-122015970 AGTCATGGTGAAGTGGTAAGGGG + Intergenic
1015141782 6:129942217-129942239 TGCCTTGGAGAAGGGGCAACAGG + Intergenic
1015746335 6:136513835-136513857 TGCCAGGTGGAAGTTGCTAGGGG + Intronic
1016370319 6:143366669-143366691 AGCCATGGGACAGTGGAAAGGGG + Intergenic
1016524789 6:144989489-144989511 TGCCAAGGGAAAGAGGAAAGAGG - Intergenic
1017034207 6:150252372-150252394 TGTTATGGGGAAAAGGCAAGAGG - Intergenic
1018456224 6:163955288-163955310 TGGGATGGGTGAGTGGCAAGTGG + Intergenic
1019282502 7:207553-207575 TGCAAAGGGGAAGAGGGAAGCGG - Intronic
1019436120 7:1023082-1023104 TGCCATGGTGCCGTGGCAATGGG + Intronic
1020025212 7:4894914-4894936 ATCCATGGGGAATTGGAAAGGGG + Intergenic
1020254686 7:6496515-6496537 TGCAAGGGGGATGTGGCTAGTGG - Intergenic
1021166994 7:17354208-17354230 AGCCATGGGGAAGTTCCAACTGG - Intergenic
1021217877 7:17940038-17940060 TGCCAGGGGCGAGTGGCAAGTGG + Intronic
1021278414 7:18685280-18685302 TCCCATGGGTAAGTGGAAAAGGG - Intronic
1021332810 7:19359394-19359416 TGCCATGGGGTTGGGGGAAGGGG + Intergenic
1021491789 7:21227005-21227027 CTCCAGGGGGAAGTGGCAATGGG - Intergenic
1022652781 7:32292810-32292832 GGCCATGGGGAAGTTGGGAGTGG - Intronic
1023794603 7:43781304-43781326 TGCCAGGGGTCAGTAGCAAGGGG - Intronic
1023888768 7:44378155-44378177 TGCGATGAGGAAGTGGGCAGTGG + Intergenic
1024343370 7:48289122-48289144 TGCCTTGGTGAAGTGTCAGGAGG + Intronic
1026483839 7:70800971-70800993 TGACATGGGGCAGTGTCATGGGG - Intergenic
1027959897 7:84931828-84931850 TGGCATGGGGAAGCTGGAAGTGG + Intergenic
1028218173 7:88160959-88160981 TGTCATGGGGCAGGGGGAAGGGG + Intronic
1028384360 7:90238062-90238084 AGGCATGAGGAAGAGGCAAGAGG - Intronic
1028584782 7:92442237-92442259 TGCCCTGGGGGAATGGCCAGTGG + Intergenic
1028781924 7:94746968-94746990 TGGCATGGGGAAGTTGGAGGTGG - Intergenic
1029518510 7:101043986-101044008 TGCCATGGGGTAGGGGGATGGGG - Intronic
1029655886 7:101924152-101924174 TGCCATGGGGAGGAGGACAGAGG + Intronic
1030157797 7:106473660-106473682 TAACATGGAGAAGTGGAAAGAGG + Intergenic
1032474257 7:132201674-132201696 TGCCATGGGGGAGGAGCATGTGG + Intronic
1032791374 7:135245574-135245596 TCCCATGGGGAAGGGGACAGAGG + Intronic
1034273831 7:149815575-149815597 TGCCATGCGGTGGAGGCAAGAGG + Intergenic
1034725156 7:153329137-153329159 CGCCATGGGGACATGGCATGTGG - Intergenic
1035409382 7:158626794-158626816 TGGAATGCGGAAGAGGCAAGGGG - Intergenic
1035470757 7:159107244-159107266 TGCCATGCAGAATTGGCAGGTGG + Intronic
1036750681 8:11441980-11442002 TGGCACAGGGAAGTGGCTAGAGG + Intronic
1036835263 8:12058865-12058887 TGTCATGGGGTAGTGGGAGGGGG + Intergenic
1036857105 8:12305429-12305451 TGTCATGGGGTAGTGGGAGGGGG + Intergenic
1036982499 8:13485982-13486004 TGCCATGAGCAATTGTCAAGAGG - Intronic
1037575066 8:20194795-20194817 TGGAATGGGGGATTGGCAAGGGG - Intergenic
1039624831 8:39038230-39038252 TGGAATGGGGAAGTTGGAAGGGG - Intronic
1039923808 8:41911248-41911270 TGCCATGGGGAAGGGAACAGAGG + Intergenic
1041255102 8:55973140-55973162 GGGCATGGGGAAGTGGGTAGTGG - Intronic
1041314708 8:56549177-56549199 TGTCATGGGGTAGTGGGGAGGGG - Intergenic
1044017020 8:87057517-87057539 TGACATGTGGAAGGGGCCAGGGG - Intronic
1044812358 8:96076396-96076418 TGTCATGGGGTAGGGGGAAGGGG + Intergenic
1045225127 8:100236524-100236546 TGCAATGAGGAAGTGGCACAGGG + Intronic
1046930563 8:119837680-119837702 TGCCAGGGAGATATGGCAAGAGG + Intronic
1048979222 8:139694170-139694192 GGTGGTGGGGAAGTGGCAAGGGG + Intronic
1051287755 9:15513574-15513596 TGGCATGGGCAAGTAGCCAGAGG - Intergenic
1052317358 9:27129468-27129490 TGCAAGGGGGAAGTGGCATGGGG - Intronic
1055331574 9:75189539-75189561 TTCCATGGGGAAGAGTAAAGGGG - Intergenic
1056048279 9:82741634-82741656 TGCATTGGGGAAGTGGTAATTGG + Intergenic
1056096002 9:83254110-83254132 TGTCATGGGGTAGGGGGAAGGGG + Intronic
1056223006 9:84468344-84468366 AACCATGGGGAGGTGGGAAGGGG + Intergenic
1056766289 9:89446650-89446672 TGCTGAGGGGAAGTGGGAAGCGG - Intronic
1057019961 9:91689358-91689380 TGCCATGTAGTAATGGCAAGGGG - Intronic
1057193475 9:93100185-93100207 AGCCAGGAGGAAGTGGCAACTGG + Intronic
1059145219 9:111893948-111893970 TGCCATGGAGCAGAGGAAAGAGG - Intergenic
1060028035 9:120189741-120189763 TGGCATGGGGAAGTGGCAAAAGG - Intergenic
1060236212 9:121864635-121864657 ACACATGGGGAAGTGGCAAATGG + Intronic
1060876973 9:127090559-127090581 TGCTATGGGGACCTGGCATGAGG + Intronic
1060934799 9:127508644-127508666 TGCCAGGGAGGAATGGCAAGCGG + Intronic
1061397769 9:130352860-130352882 TGCCCTGGGGAAGATGCCAGAGG + Intronic
1061609074 9:131734225-131734247 TGCCCTGGAGAAGTGGAATGGGG - Intronic
1061809707 9:133155167-133155189 TGCCGTGGGGAAGTGAGTAGTGG - Exonic
1061912912 9:133734309-133734331 TGCCATGGGGAAGTGGCAAGAGG - Intronic
1062402165 9:136377508-136377530 TGCCATGGGGAAGTGGGGCTGGG + Intronic
1187832578 X:23397821-23397843 TGTCTTGGGGGTGTGGCAAGAGG + Exonic
1188534226 X:31178494-31178516 TGACGTGGGAAAGTGGCAACTGG + Intronic
1188856449 X:35201891-35201913 TGGCATGGGGAAGTTGGAGGTGG + Intergenic
1189706971 X:43768686-43768708 TGCCATGGGGAAGATTCCAGAGG - Exonic
1190869308 X:54411821-54411843 TTCCATGAGGAAGTGGAAGGGGG - Intergenic
1193423150 X:81308437-81308459 TCCCATGGTGAAGTGGACAGGGG + Intergenic
1194959052 X:100214537-100214559 AGCCATGGGGAAGTTCCAACTGG - Intergenic
1194976679 X:100403286-100403308 TGCCTGGAGGAACTGGCAAGGGG - Intronic
1200711020 Y:6485161-6485183 AGCCTTGGAGAAGAGGCAAGAGG - Intergenic
1201022914 Y:9676825-9676847 AGCCTTGGAGAAGAGGCAAGAGG + Intergenic
1201065844 Y:10093104-10093126 TGCCCTGGGGCAGAGGCGAGCGG - Intergenic