ID: 1061913148

View in Genome Browser
Species Human (GRCh38)
Location 9:133735366-133735388
Sequence GAGGGTTTCCTGAAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 606
Summary {0: 1, 1: 1, 2: 18, 3: 90, 4: 496}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061913148_1061913160 26 Left 1061913148 9:133735366-133735388 CCCTCCTCCTTCAGGAAACCCTC 0: 1
1: 1
2: 18
3: 90
4: 496
Right 1061913160 9:133735415-133735437 AATAACAATGAGAATGCAAGAGG No data
1061913148_1061913161 27 Left 1061913148 9:133735366-133735388 CCCTCCTCCTTCAGGAAACCCTC 0: 1
1: 1
2: 18
3: 90
4: 496
Right 1061913161 9:133735416-133735438 ATAACAATGAGAATGCAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061913148 Original CRISPR GAGGGTTTCCTGAAGGAGGA GGG (reversed) Intronic
900152221 1:1183669-1183691 GAGGGCTGCCTGGAGGAGGAGGG - Intronic
900618113 1:3574428-3574450 AAGGGCTTCCTGGAGGAGGTGGG - Intronic
900640806 1:3687291-3687313 GCTGGTTCCCTGAATGAGGAAGG + Intronic
901055651 1:6447702-6447724 GATGGTTTCCAGATGCAGGAGGG + Intronic
901230088 1:7636983-7637005 GAAGGCTTCCTGGAAGAGGAGGG + Intronic
902081971 1:13827374-13827396 GAAAGCTTCCTGGAGGAGGAGGG + Intergenic
902155622 1:14483283-14483305 CAGGGTTGCATGGAGGAGGAGGG - Intergenic
902397484 1:16140249-16140271 GAGGGTCTGCAGAAGCAGGATGG - Intronic
902478737 1:16700935-16700957 GATGGTTTCCAGATGCAGGAGGG - Intergenic
902753794 1:18536181-18536203 GAATGTTTATTGAAGGAGGAAGG + Intergenic
902759727 1:18573295-18573317 GAGGGCTCCCTGGAAGAGGAGGG - Intergenic
903293102 1:22326986-22327008 GAAGGCTTCCTGGAGGAGGCAGG - Intergenic
903341247 1:22655860-22655882 AAAGGTTTCCTGGAGGAAGAAGG + Intronic
904284390 1:29444572-29444594 GAGGGCTGCCTGAAAGAGGTGGG + Intergenic
904366224 1:30012516-30012538 GAGGGCTTCTTGAAGGAAGGAGG - Intergenic
904368795 1:30035397-30035419 GAGGGCTTCCTGAAAGAGGTGGG + Intergenic
904379978 1:30104018-30104040 GAGGCTTCCTGGAAGGAGGAGGG + Intergenic
904499252 1:30904776-30904798 GAAGGCTTCCTGGAGGAGGAGGG - Intronic
904562351 1:31407170-31407192 GGCTGTTTCCTGGAGGAGGATGG - Intergenic
904600463 1:31669992-31670014 GAGAGTTTCCTCTAGGACGACGG + Intronic
904834646 1:33327419-33327441 GAGGGTATTCTGCATGAGGAAGG + Intronic
904887420 1:33751328-33751350 GAGGGTTTCCAGAAGGAGGAAGG + Intronic
904998384 1:34649015-34649037 GATGGCTTCCTAGAGGAGGAGGG - Intergenic
905217737 1:36421321-36421343 GAGTGTTCCCGGGAGGAGGATGG - Intronic
905489486 1:38332436-38332458 GAGGGTTTCCAAAAAAAGGACGG - Intergenic
905516936 1:38568943-38568965 GAGGGCTTCCAGAAGTAAGAGGG + Intergenic
906156211 1:43615469-43615491 GAAGGCTTCCTGGAGGAGGAGGG - Intronic
906193278 1:43912857-43912879 GGGACATTCCTGAAGGAGGAGGG + Intronic
906227380 1:44133004-44133026 GGGTGTTTCCTGAACGAGGCTGG + Intronic
906575856 1:46888799-46888821 GTGGGTTTTCTGAAGGAGAGGGG + Intergenic
906596118 1:47079095-47079117 GTGGGTTTTCTGAAGGACAAGGG - Intronic
906638230 1:47424721-47424743 GAGGGTTTTCTAGAGGAGGTGGG - Intergenic
906704652 1:47886202-47886224 GAGGGCTCCCTGGAGGAGGTGGG - Intronic
906724542 1:48034604-48034626 TAGAGCTTACTGAAGGAGGATGG - Intergenic
906796007 1:48696902-48696924 AAGGGCTTCCTCAGGGAGGAGGG - Intronic
906829949 1:49020593-49020615 GGGGGTGTCCTGGAGGAGGAGGG + Intronic
907476542 1:54709747-54709769 GAAGGCTTCCTGGAGGAGGCAGG + Intronic
907656988 1:56353629-56353651 GAGGATTTTGAGAAGGAGGAAGG - Intergenic
908403017 1:63788565-63788587 GAGGGTTTTCTGAAGGAGGTGGG + Intronic
908584706 1:65555007-65555029 GAGGGTGAGCTGAAGCAGGATGG - Intronic
908746345 1:67380342-67380364 GAAGGCTTCCTGAAGGAGGAAGG - Intronic
911048417 1:93648811-93648833 GAGGGCTTCCTGGAGGAGGTTGG - Intronic
911287577 1:96015493-96015515 GAGGGTTTGATGGTGGAGGATGG - Intergenic
912647831 1:111411716-111411738 GAGGTTTTCTTGAGGGTGGAGGG + Intergenic
912694070 1:111827801-111827823 CAGGGTATCCTGGAGCAGGAGGG - Intronic
914829763 1:151162035-151162057 GAGGGTTTTCTTCAGGAAGATGG + Exonic
915020951 1:152777902-152777924 GAGGGTATCAGGAAGAAGGAGGG - Intronic
916815014 1:168343252-168343274 GAAGGTTTCCTGAAGAAGGAGGG + Intergenic
916815158 1:168344507-168344529 GAAGGTTTCCTGAAGAAGGAGGG - Intergenic
917268500 1:173247357-173247379 GAGTATGTTCTGAAGGAGGAGGG + Intergenic
917595428 1:176524563-176524585 AAAGACTTCCTGAAGGAGGAAGG + Intronic
917598849 1:176555949-176555971 GAGGGATTACTGAAGAAGAAGGG + Exonic
918450226 1:184650455-184650477 GAGGTTTTGATGGAGGAGGAGGG - Intergenic
919730121 1:200908501-200908523 GGAGGCTTCTTGAAGGAGGAAGG + Intronic
921383551 1:214549014-214549036 GAAGTTTTCCTGAAGGTGTAGGG - Intronic
923018878 1:230147711-230147733 GAGGGACTCTTGGAGGAGGAAGG - Intronic
924646027 1:245878005-245878027 GAGTGTTCCCAGGAGGAGGAAGG + Intronic
1062768204 10:81049-81071 GAGGGCTTCCTGGAGGAGGAGGG - Intergenic
1063365431 10:5487545-5487567 GATGGTTTGCTGAAGGAGTCTGG - Intergenic
1063392512 10:5659622-5659644 GGAGGCTTCCTGAAGGAGCAGGG - Intronic
1064358316 10:14639843-14639865 CAGTGTTAGCTGAAGGAGGAAGG - Intronic
1064681168 10:17812090-17812112 GATGCTCTCCTGAAGGTGGAAGG - Intronic
1067223670 10:44361819-44361841 CAGGCTTTCCTGGAGGAGAAGGG + Intergenic
1067343739 10:45423453-45423475 CAGGGCTTCCTGGAGGAGGCAGG - Intronic
1069200465 10:65608718-65608740 TAGGGATTCCAAAAGGAGGAAGG + Intergenic
1069832804 10:71291418-71291440 GCGGGTTGCCTGCAGGAGTAGGG - Exonic
1069833854 10:71296564-71296586 GGGGATCTCCTGCAGGAGGAGGG - Exonic
1069983956 10:72271236-72271258 AAGTGTTTCCTAAAGTAGGAGGG - Intergenic
1070191516 10:74115885-74115907 GAGGGTTTCCTGAAAGACCTGGG - Intronic
1070550054 10:77483890-77483912 TGTGGTTTCCTGAAAGAGGAGGG - Intronic
1070648824 10:78220441-78220463 GAAGGCTTCCTGGAGGAAGAAGG + Intergenic
1070747230 10:78941479-78941501 GAGGGATACCTGAACTAGGAAGG + Intergenic
1071515038 10:86291557-86291579 GAGGGCTTCCTGGAGGTGGATGG - Intronic
1071647338 10:87367069-87367091 GAGGGTGGCCTGAATGGGGAGGG + Exonic
1071821328 10:89284155-89284177 GAGGGGTTGCTGGAGGAGGAGGG + Intronic
1075001877 10:118804757-118804779 GAAGGCTTCCTGGAGGAGGTGGG + Intergenic
1075021230 10:118953922-118953944 GAGGGTTTGCTCAAGGAGCTGGG - Intergenic
1075166267 10:120070920-120070942 GAGTGATTTATGAAGGAGGAAGG + Intergenic
1075600190 10:123761910-123761932 GAGGACTTCCAGAAGGAGGAGGG - Exonic
1075733128 10:124648121-124648143 GAGGGTTTTCTGGAGGAGGCAGG - Intronic
1076334878 10:129699758-129699780 GAGGTCTTCCTGGAGAAGGACGG - Intronic
1076608073 10:131702188-131702210 CAGGGTTTGCTGAAAGATGAGGG - Intergenic
1076688417 10:132208543-132208565 GAGGGCCTCCTGGAGGAGGTGGG - Intronic
1076853672 10:133105003-133105025 GGAGGTTTCCTGGTGGAGGAGGG - Intronic
1077205244 11:1338878-1338900 GAAGGTTTCCTGCTGGAGGCCGG - Intergenic
1077244530 11:1529778-1529800 CAGGGCCTCCTGAAGGAGGCAGG + Intergenic
1077297297 11:1832185-1832207 GAGGGTTCCCTGGAAGAGGTGGG + Intronic
1077358152 11:2128085-2128107 GGGAGTTGCCTGGAGGAGGAGGG - Intergenic
1077504449 11:2923643-2923665 GAGGGCTTCCTGGAGGAGGTTGG + Intronic
1077819241 11:5719774-5719796 GGGCATTTGCTGAAGGAGGATGG - Intronic
1077909644 11:6563114-6563136 GAGGCTTTCCTGGAGCAGGTGGG + Exonic
1079082036 11:17420469-17420491 CTGGGTTTCCTGGAGGAGGCAGG - Intronic
1079263606 11:18908624-18908646 GAGGGTTTCCTAAAGGTCGGAGG - Intergenic
1079632393 11:22694012-22694034 GAGGGTAGCGGGAAGGAGGAGGG + Intronic
1080225987 11:29960959-29960981 AAGGGTTTCCTGCTGTAGGATGG - Intergenic
1083190511 11:61048617-61048639 GAAGGCTTCCTGGAGGAGGCAGG - Intergenic
1083668443 11:64287640-64287662 TGGGGTTTCCTGCAGGAGGTGGG + Intronic
1083853367 11:65380251-65380273 GAGGGGTTCAGGCAGGAGGAAGG + Intronic
1084516713 11:69641667-69641689 GGGTATTTTCTGAAGGAGGAAGG + Intronic
1084604851 11:70166471-70166493 CAGGGTTTCCAGATGGAGGCTGG + Intronic
1084680788 11:70665063-70665085 GAGGGGTCCCTGTAGGAGGAAGG - Intronic
1084803757 11:71564935-71564957 GAGGTTTTCCTCATGGTGGAAGG - Intronic
1084962726 11:72725827-72725849 GAAGGCTTCTTGGAGGAGGAAGG - Intronic
1085542600 11:77286471-77286493 GAGGTTTCCCTGCAGTAGGAAGG - Intronic
1085802480 11:79603235-79603257 GAAGGCTTCCTGGAGGAGGAGGG - Intergenic
1086046277 11:82535588-82535610 AAGGGTTTCCTTATGGAGTACGG + Intergenic
1086563216 11:88192891-88192913 GAGGCTTACCTGAGGGTGGAGGG - Intergenic
1086916517 11:92535498-92535520 GAGGTTCTCCTAAAGGAGGGAGG + Intronic
1087223993 11:95577614-95577636 GATGGTCTTCTGAAGGAGGTTGG - Intergenic
1088251028 11:107860903-107860925 GAAGGGTTCCTGCAGTAGGAGGG - Intronic
1089637246 11:119822969-119822991 GAGTGTTTCCAGAAGGAAGGGGG + Intergenic
1090830183 11:130415905-130415927 GAAGGTTGTCTGAAGGAGGAGGG - Intronic
1090949868 11:131464096-131464118 GAGGGGCTGCTGAGGGAGGAGGG + Intronic
1091292486 11:134449415-134449437 TAGGGTTTCTTGAAGAAGGAGGG + Intergenic
1091583003 12:1800146-1800168 GAGGGTGTCCTGGAGGAGAGGGG - Intronic
1092077188 12:5683805-5683827 GAGGGCTTCCTGGAGGAGGCAGG + Intronic
1092708419 12:11308811-11308833 GTGGCTTTCCTGGAGGAGGTGGG + Exonic
1092712469 12:11353382-11353404 GTGGCTTTCCTGGAGGAGGTGGG + Exonic
1092712525 12:11353565-11353587 GTGGCTTTCCTGGAGGAGGTGGG + Intronic
1092712580 12:11353748-11353770 GTGGCTTTCCTGGAGGAGGTGGG + Intronic
1092712638 12:11353931-11353953 GTGGCTTTCCTGGAGGAGGTGGG + Exonic
1092716207 12:11393102-11393124 GTGGCTTTCCTGGAGGAGGTGGG + Exonic
1092716259 12:11393288-11393310 GTGGCTTTCCTGGAGGAGGTGGG + Exonic
1092716314 12:11393474-11393496 GTGGCTTTCCTGGAGGAGGTGGG + Exonic
1092716419 12:11393843-11393865 GTGGCTTTCCTGGAGGAGGTGGG + Exonic
1094423533 12:30296566-30296588 GAGGGTTTCCTAAGAGAGGAAGG + Intergenic
1095244819 12:39907688-39907710 GAGGGCTTTCTGCAGGAGGATGG - Intronic
1096148336 12:49294244-49294266 GAGTGATTCCTGAGGTAGGAAGG - Exonic
1096181976 12:49556075-49556097 GAAGGCTTCCTGGAGGAGGCAGG - Intronic
1096255328 12:50058737-50058759 GAGGGGATCCTGGGGGAGGAGGG - Exonic
1096550596 12:52369502-52369524 GAGGGATTCCTGGAGAAGGGTGG + Intergenic
1096618765 12:52849301-52849323 GAAGGCTTCCTGAAGGAGACAGG + Intergenic
1098190663 12:67945167-67945189 GAAGGCTTCCTGGAGGAGGAGGG + Intergenic
1098218019 12:68240350-68240372 GAGGGTTTCAAGCATGAGGAAGG - Intergenic
1098507637 12:71272529-71272551 GAAAGCTTCCTGGAGGAGGATGG - Intronic
1099251168 12:80256809-80256831 GAGTGTTTTCTGAAAGAGGTGGG + Intronic
1099512687 12:83556526-83556548 GAGGGTGAGCTGAAGGAGGGTGG - Intergenic
1099648746 12:85396365-85396387 GAAGATTTCATGAAGGAGGTAGG - Intergenic
1100666461 12:96758683-96758705 TAGGGTTTAATGAATGAGGAGGG + Intronic
1101849453 12:108390673-108390695 GCAGGCTTCCTGGAGGAGGAGGG + Intergenic
1102194176 12:111012663-111012685 GAGGGTTTCAGGAAGGAGGTTGG - Intergenic
1102218566 12:111179129-111179151 GAGGGGATCCTCAATGAGGAGGG - Intronic
1102240509 12:111321875-111321897 GAAGGCTTCCTGGAGGAGGGGGG + Intronic
1102952878 12:117041939-117041961 GAGGACTTCCTGAAGGTGGGTGG - Exonic
1103014622 12:117484370-117484392 GAGAGTTTCCTGACAGATGATGG - Intronic
1103904208 12:124319185-124319207 GGTGGCTTCCTGAAGGAGGCAGG - Intergenic
1104133665 12:125917737-125917759 GAAGATGTCCTGAGGGAGGAGGG + Intergenic
1104657999 12:130588166-130588188 AAGGGCTTCCTGGAGGAGGCAGG - Intronic
1104859958 12:131918653-131918675 GAGGGTCTCCTCAGGGAGGTCGG - Exonic
1105882751 13:24618094-24618116 GAGGGTTTCCTTATGGAGCCTGG - Intergenic
1109726591 13:66349186-66349208 CAGTGTTTCCTGGAGGAGGGAGG + Intronic
1110770851 13:79343391-79343413 GTAGGTTTCCTGAATTAGGATGG + Intronic
1113300073 13:109009852-109009874 GAGGGCTTTCTGGAGGAAGAGGG - Intronic
1113649580 13:112026439-112026461 GGGGGCTGCCTGAAGAAGGAGGG + Intergenic
1114499944 14:23161271-23161293 GAGGGTTTGCTGGGGGAGGGAGG - Intronic
1115180653 14:30622194-30622216 GAGGTCTTCCTGGAGGAGGTGGG + Exonic
1115336051 14:32245209-32245231 GAGGGCCTCCTGGAGTAGGATGG + Intergenic
1115818399 14:37187906-37187928 GAGGGTTAACCAAAGGAGGATGG + Intergenic
1118704437 14:68467693-68467715 GAGGGTTTGGTGAAGGACCAGGG + Intronic
1119663164 14:76465734-76465756 GAGTTCTGCCTGAAGGAGGAAGG + Intronic
1120568262 14:86085888-86085910 GAGGGGCTCCAGAAAGAGGAGGG + Intergenic
1121380675 14:93463175-93463197 GAGAGTTTCAAGAAGGAGGGAGG + Intronic
1121634826 14:95446793-95446815 GAAGGCTTCCTGGAGGAGGTAGG - Intronic
1121835545 14:97088867-97088889 GAGGATGACCTGGAGGAGGAAGG + Intergenic
1121866418 14:97366620-97366642 GAAGACTTCCTGGAGGAGGAGGG - Intergenic
1121907989 14:97765006-97765028 ATGGGTTTCCTGCAGGAGGCAGG + Intergenic
1122863913 14:104594988-104595010 GAAGGCTTCCTGCAGGAGGTGGG - Intronic
1122931020 14:104933153-104933175 GAGGGCTCCCTGGAGGAGGTGGG - Exonic
1123023535 14:105413045-105413067 GAAGGCTTCCTGAAGGAGGAGGG - Exonic
1123054290 14:105561867-105561889 GAGGCTTTCCTGGGGGAGGGCGG - Intergenic
1123078874 14:105682286-105682308 GAGGCTTTCCTGGGGGAGGGCGG - Intergenic
1123784064 15:23651097-23651119 GAGGGCTTCAGGAAGCAGGAAGG - Intergenic
1123939180 15:25208526-25208548 GAGAGTTTCCTCAGGGAGCAGGG + Intergenic
1124904910 15:33859134-33859156 CAGGGATTCCTGCAGCAGGAAGG - Intronic
1125375547 15:39024991-39025013 ACGGGCTTCCTGAAAGAGGAAGG + Intergenic
1125532785 15:40424439-40424461 GAGGTCTTCCTGAAGGAGGCAGG - Intronic
1125929409 15:43589835-43589857 GAGGGGGTCCTGTGGGAGGATGG - Intronic
1125942576 15:43689667-43689689 GAGGGGGTCCTGTGGGAGGATGG - Intergenic
1126451023 15:48809925-48809947 GAGGGCATCTTGAAGGAGGGTGG - Intronic
1127267102 15:57371254-57371276 GAGGATTTCTTAGAGGAGGAGGG + Intergenic
1127905725 15:63374351-63374373 GAAGGCCTCCTGGAGGAGGAGGG - Intronic
1128032327 15:64491894-64491916 GAGGGATTTCTGAAGCAAGATGG + Intronic
1128214650 15:65925827-65925849 GAAGGCTTCCTGGAGAAGGAGGG - Intronic
1128327024 15:66730342-66730364 GAAGGCTTCCTGGAGAAGGAAGG - Intronic
1128729913 15:70014128-70014150 GAGGCCTTCCTGGAGGAGGACGG - Intergenic
1128898574 15:71398356-71398378 GAGGGTGACCTGAAGAAGGAAGG + Intronic
1128927918 15:71675656-71675678 GAGGGTTAGATGAAGGAGGTGGG - Intronic
1129168829 15:73795643-73795665 GAGGGCTTCCTGGAGGAGGAAGG + Intergenic
1129168920 15:73796146-73796168 GAGCGCTTCCTGGAGGAGGAAGG - Intergenic
1129253157 15:74319624-74319646 GGGGTCTTCCTGGAGGAGGAGGG + Intronic
1129269958 15:74414358-74414380 GAGAGCTTCCTGGAGGAGGTAGG - Intronic
1129707012 15:77800083-77800105 GAAGGCTTCCTGATGGAGGAGGG + Intronic
1129708039 15:77805815-77805837 GAAGGTTTCTTGAAGGAGACAGG + Intronic
1130370210 15:83279462-83279484 GAGGGCTTCCTCCAGGAAGAAGG + Intronic
1131585824 15:93691699-93691721 GAGGATTAACTGAGGGAGGAGGG + Intergenic
1132436488 15:101808660-101808682 GAGAGTTTCCAAAATGAGGAAGG - Intronic
1132457104 16:30025-30047 GAGGGCTTCCTGGAGGAGGAGGG - Intergenic
1132903936 16:2272560-2272582 GGGGGTTTCCTGAGTGAGGTGGG - Intergenic
1132984846 16:2759979-2760001 GAAGGCTTCCTGAAGGAGGTGGG + Intronic
1135485762 16:22863346-22863368 GAGGGCATCCTGGAGGAAGAGGG - Intronic
1135785412 16:25344544-25344566 GGAGGTTTCAAGAAGGAGGAAGG + Intergenic
1137341745 16:47614122-47614144 GAGGTTTTCCTCATGGAGGAAGG + Intronic
1137477057 16:48818157-48818179 GAAGGCTTCTTGAAGGAGGTGGG + Intergenic
1137724984 16:50650993-50651015 GAGGGCTTCCTGGAGGAGCGGGG - Intergenic
1137925036 16:52532475-52532497 GAGGGTTTGCTTCAGGAGGTTGG - Intronic
1138029787 16:53551046-53551068 GAGGGCTGCTTGAAGGAGGCAGG - Intergenic
1138365478 16:56472877-56472899 GAAGGTTTCCTAAGTGAGGAGGG - Intronic
1139361084 16:66400694-66400716 GAGGGCTTCCTGGAGGAGCCAGG + Intronic
1139531341 16:67544139-67544161 GAGGATTTCCAGAAGGAGGAAGG - Intronic
1140525983 16:75623230-75623252 GCGCGTTTCCTGAAGGTGGGAGG - Exonic
1141633836 16:85303428-85303450 GAGGGCTTCCTGCAGGAGGAGGG - Intergenic
1141656305 16:85418481-85418503 GAGGGCTTCCTGGAGGAGGCGGG - Intergenic
1141766870 16:86064610-86064632 GAGGGAAACCTGAAGGAGGGGGG - Intergenic
1142161580 16:88560498-88560520 GAGGGTGTCATGAATGAGGCTGG + Intergenic
1142955842 17:3521211-3521233 GAAGGCTTCCTGGAGGAGGCAGG - Intronic
1143009972 17:3860878-3860900 GTGGGTGTCCTGTTGGAGGAGGG - Intronic
1143014840 17:3886213-3886235 GAGGGCTCCCTGGAGGAGGCGGG - Intronic
1143140899 17:4741181-4741203 GAGGGCTTCCGAAGGGAGGATGG - Intronic
1143383097 17:6508530-6508552 TAGTGCTTCCTGGAGGAGGAAGG + Intronic
1143604818 17:7976757-7976779 CAGGGACTCCTGCAGGAGGAAGG + Intergenic
1143940332 17:10534237-10534259 CAGGGTTTCCTGGAGGCAGAGGG - Intronic
1144194008 17:12873326-12873348 AAAGGCTTCCTGGAGGAGGAGGG - Intronic
1144282629 17:13741952-13741974 GAAGGTTTCCTGAAGAAAGAGGG + Intergenic
1144519088 17:15942539-15942561 GAAGGTTTCCTGATGGAGGTTGG + Intergenic
1144771075 17:17759970-17759992 GAGGGCTTCCTGGAGGAGATGGG + Intronic
1145251767 17:21300684-21300706 GAGGGCTCCCTGGAGGAGGCGGG + Intronic
1146185195 17:30720071-30720093 GAGGGCTTCCTGGAGGAGGTGGG + Intergenic
1146520994 17:33525450-33525472 GAGGGTTTCCTGCAGAAGATAGG - Intronic
1146839597 17:36141394-36141416 GAGGGTGGCCTGGAGGAGTAGGG + Intergenic
1147228586 17:39000760-39000782 GAGGGGGTCCTGTGGGAGGATGG - Intergenic
1147459544 17:40559469-40559491 GAGTGTCTCCTGAGGGAGGTGGG + Intronic
1147650939 17:42061737-42061759 GAAAGTCTCCTGAAGGAAGAGGG - Intronic
1148155553 17:45423490-45423512 GAGTGCTTCCTGGAGGAGGAAGG - Intronic
1148508490 17:48147601-48147623 GAGATTTTCCAGAAGGAGAAAGG + Intronic
1148543717 17:48501056-48501078 GAGTCTTTCCTGAAGGAGGGCGG + Intergenic
1148675689 17:49443536-49443558 GATTGCTTCCTGAAGGAGGTAGG - Intronic
1148891746 17:50812544-50812566 CAGGGTTTCCTGGAGGGTGATGG + Intergenic
1150387240 17:64772147-64772169 GAGTGCTTCCTGGAGGAGGAAGG - Intergenic
1151073296 17:71242242-71242264 ATGGCTTTCCTGAAGCAGGATGG - Intergenic
1151130089 17:71887911-71887933 GAGGCTTTCATGCATGAGGATGG - Intergenic
1151401366 17:73857996-73858018 GAGGGGGCCCTGAGGGAGGAGGG - Intergenic
1151448346 17:74181854-74181876 GAGGGAAGCCTGCAGGAGGAGGG - Intergenic
1151459840 17:74248083-74248105 CAGTGGCTCCTGAAGGAGGACGG + Intronic
1151577413 17:74959716-74959738 GAGGGTTTCAAGATGCAGGAAGG - Intronic
1151647872 17:75445941-75445963 GAGGATTTCTTGAACCAGGAAGG + Intronic
1151720091 17:75850084-75850106 GATGGGTTCCTGAAAGAGGGGGG + Intronic
1151996437 17:77612216-77612238 CAGTGTTTCCAGAAGGAGGGCGG + Intergenic
1152261570 17:79270054-79270076 GAGGGTGGCAAGAAGGAGGAAGG - Intronic
1152961093 18:80546-80568 GAGGGCTTCCTGGAGGAGGAGGG - Intergenic
1153912334 18:9715202-9715224 GAAGGTTTCTTGGAGTAGGAAGG + Intronic
1153930368 18:9873411-9873433 GTGGGTTTGCAGAAGGATGAGGG + Intergenic
1155285510 18:24284880-24284902 GAAGGCTTCCTGGGGGAGGATGG - Intronic
1155973980 18:32108338-32108360 AATGGTATCCTGAAGGAGGTGGG - Intronic
1156460073 18:37316658-37316680 AAGGGCTTCCTGGAGGAGGTGGG - Intronic
1157294790 18:46434810-46434832 GAGGCCTTCCTGGAGGAGGAAGG + Intronic
1158467304 18:57702216-57702238 GAGGCTGTCTTGATGGAGGAAGG - Intronic
1159002793 18:62988371-62988393 GGGGGTGTCCAGAAGGAGGACGG - Intergenic
1159027577 18:63200092-63200114 GAGGGCTTCCTGCAGAACGAAGG - Intronic
1159674083 18:71260114-71260136 GATGGTTTGCTGATGGATGAAGG + Intergenic
1160607142 18:80059672-80059694 AAGGGTGTCCTGCAGGAAGAGGG + Intronic
1160710299 19:548359-548381 GAGGGCTTCCTGGAGGAGGTGGG + Intronic
1160746885 19:715930-715952 GAGGGCGTCCTCTAGGAGGATGG + Intronic
1160787096 19:905723-905745 CAGGGCTGCCTGAAGCAGGAAGG + Intronic
1161055824 19:2190238-2190260 GAGGCTTTCCTCACAGAGGACGG + Intronic
1161348299 19:3778651-3778673 GAGGGCTTCCTGGAGGAAGCAGG - Intronic
1161606723 19:5219248-5219270 GAGGGCTTCCTGGAAAAGGAGGG - Intronic
1161614224 19:5261044-5261066 GAGGGTTTCCTGTAGAAGGCGGG + Intronic
1161630401 19:5352098-5352120 GAGGGCTTCCTGGAGGTGGCAGG - Intergenic
1161701064 19:5795605-5795627 GAAGGCTTCCTGTAGGAGGAGGG + Intergenic
1162433139 19:10641435-10641457 GGTGGTTTCCTGGAGGAGGTGGG + Intronic
1162862534 19:13517591-13517613 GAGGGTTTAGTGTGGGAGGAGGG + Intronic
1162973585 19:14195618-14195640 GAGGGCTTCCTGAAGGAGGCGGG - Intronic
1163216858 19:15885448-15885470 GAGTGTTTGCTGAATAAGGATGG + Intronic
1163221211 19:15922518-15922540 TTGGGTTTCTGGAAGGAGGATGG - Intronic
1163286478 19:16351640-16351662 GGGGTTTTCCTGCAGGAGGAAGG + Intergenic
1163488249 19:17602212-17602234 GAGGGTGTCCTGAAGAAAGAAGG - Exonic
1163538915 19:17894877-17894899 GAGGTATTACTGGAGGAGGATGG + Exonic
1164474857 19:28568004-28568026 GTGGGCTTCCTGGAAGAGGAAGG + Intergenic
1164683175 19:30149531-30149553 GAAGGCTTCCTGGAGGGGGAGGG + Intergenic
1165232008 19:34393176-34393198 CAGGGTTTCCGGCAGGAGGTGGG + Intronic
1165334468 19:35159619-35159641 GTGCGTTTGCTCAAGGAGGAAGG - Intronic
1165947014 19:39449616-39449638 GATGGCTGCCTGGAGGAGGAAGG + Intronic
1166339771 19:42130771-42130793 GAGGGCTTCCTGGAGGAAGGGGG - Intronic
1166340572 19:42134489-42134511 GAGGGGATCTTGAAGGAGGATGG + Intronic
1166547552 19:43642376-43642398 CAGGGTACCCTGAAGTAGGATGG - Intergenic
1166571584 19:43800074-43800096 GAGGGCTTCCTGGAAGAGGGTGG - Intronic
1166717034 19:44975153-44975175 GAGGGCTTCCTGGAGGAGGTTGG - Intronic
1166804801 19:45479583-45479605 GAGAGTTTCATGCAGGAGAATGG - Intergenic
1166891778 19:45998486-45998508 GAGGGCTTCCTGCAGGAGAGGGG + Intronic
1167446213 19:49539105-49539127 CAGGGTTTCCTGGAGGAGAAAGG - Exonic
1167776500 19:51561103-51561125 GAGGTCTCCCTGGAGGAGGAGGG + Intergenic
1168666394 19:58208237-58208259 GAAGGTATCCTGCAGGGGGATGG + Intronic
1202712756 1_KI270714v1_random:26766-26788 GATGGTTTCCAGATGCAGGAGGG - Intergenic
924985266 2:264485-264507 GAGGGGTACCTGGAGGAGGAAGG - Intronic
925376023 2:3386771-3386793 GAGGGCTTCATGGAAGAGGAGGG + Intronic
925570017 2:5299798-5299820 GAGAGTTTGCTGAAGTATGATGG - Intergenic
925722523 2:6842812-6842834 GAGGGTTTTGGGAAGGGGGAAGG + Intronic
926223383 2:10950929-10950951 AAGGGTTTCCTGGAAGAGGATGG - Intergenic
927146908 2:20172291-20172313 AAGTGTTTCTTGGAGGAGGAAGG + Intergenic
927154356 2:20213063-20213085 GGGCGTTTATTGAAGGAGGAGGG + Intronic
927203996 2:20595494-20595516 GAGGGCTTCCTGGAGGAGGGAGG + Intronic
927471505 2:23380983-23381005 GATGCCTTCCTGGAGGAGGAAGG - Intergenic
927508546 2:23630009-23630031 GGGAGTTTCCAGAAGGAAGAAGG + Intronic
927702236 2:25275927-25275949 GAGGGGGTGCGGAAGGAGGAGGG + Intronic
928234407 2:29527410-29527432 GAGGGTTTCCTGATGCAGCTGGG + Intronic
928281201 2:29947816-29947838 AAGGGTTGTCTGATGGAGGAAGG - Intergenic
928669978 2:33593010-33593032 GAAGGTTTCATCAAGGAGCAAGG - Intronic
929602892 2:43215682-43215704 GAGGGTTTCTTAAAGGATCAGGG + Intergenic
929683550 2:44015231-44015253 GAAGGTTTCATGGAGGAGGCAGG + Intergenic
930013706 2:46956711-46956733 GAAGGCTTTCTGGAGGAGGAGGG + Intronic
931405639 2:61974932-61974954 CAGGGGTTCAGGAAGGAGGAGGG - Intronic
932192411 2:69752063-69752085 GAAGGCTTCCTGGAGGAGGAAGG + Intronic
932335371 2:70928075-70928097 GAAGGTTTCCTGGGGCAGGAGGG + Intronic
932409272 2:71535555-71535577 GAAGGCTTCCTGGAGGAGGTGGG + Intronic
934540063 2:95166272-95166294 GAGGGCTTCATGGAGGAGGTGGG + Intronic
935727428 2:106036058-106036080 GAGGCTTTGCTGAAGAAGGAAGG - Intergenic
937058930 2:118967208-118967230 GAAGGTGTCCTGAAGCAGGACGG + Intronic
937157308 2:119730200-119730222 GAGGGTTTCCTTGAAGAGGGTGG - Intergenic
937239280 2:120449989-120450011 GAGGGCTTCCTGAAGGAGGTGGG + Intergenic
937262584 2:120595916-120595938 GAGGGCTTCCTGGAAGAGGTGGG + Intergenic
937354932 2:121192369-121192391 GAGGGCTTCCTGGAGAAGGTGGG - Intergenic
938302697 2:130228285-130228307 GGGGGCTTCCCGGAGGAGGAAGG - Intergenic
938313443 2:130310072-130310094 GGAGGCTTCCTGAAGGAGGCAGG - Intergenic
938370753 2:130767036-130767058 GAAGTTTTCCTGAAGGGGAATGG - Exonic
938663240 2:133508318-133508340 GAGGGCTTCCCCAAGGAGGAGGG - Intronic
940615683 2:156046362-156046384 GAGGGTTACGTGAGGGTGGAGGG + Intergenic
941221980 2:162793296-162793318 GAGGGTGTGGTGTAGGAGGAGGG + Intronic
941916914 2:170818910-170818932 GAGGGCTTCGCGGAGGAGGAGGG + Intronic
943512237 2:188840464-188840486 GAGGGTGAGCTGAAGTAGGATGG + Intergenic
943721416 2:191206874-191206896 GGCCGTTTCATGAAGGAGGATGG - Intergenic
944119004 2:196220390-196220412 GATAGTTTCCTAAAGGTGGACGG - Intronic
944487307 2:200220689-200220711 GAGGGTAGCTTGAAGGAGGGTGG - Intergenic
944680666 2:202073844-202073866 TTGAGTTTCATGAAGGAGGAAGG - Intronic
945142156 2:206698472-206698494 GAGGGTTCCCGGAAGGAGAAGGG - Intronic
945268349 2:207913458-207913480 GAGAATTTCATGAAGGAAGAAGG + Intronic
946220848 2:218225353-218225375 GAGGGTTTCTTGAAGGTGAGTGG + Intronic
948282704 2:236760230-236760252 GAAAGTTTCAGGAAGGAGGAAGG + Intergenic
948902981 2:240965501-240965523 GAGGGTGCCCGGAAGGAGGTGGG + Intronic
1169260497 20:4134829-4134851 GAGGGAGAACTGAAGGAGGAGGG + Intronic
1169527573 20:6446810-6446832 TAGGGTTACCTGATTGAGGAGGG - Intergenic
1170144821 20:13161609-13161631 GAAAGTTTCAAGAAGGAGGAGGG + Intronic
1170599810 20:17832700-17832722 GAGGTGTTCCAGAAGAAGGAAGG + Intergenic
1171139643 20:22729713-22729735 GAGGGTTTAATGAAGGGGTATGG + Intergenic
1171983754 20:31645114-31645136 GAGGGCTTCCTGGAGGAGTGGGG + Intergenic
1172031985 20:31988773-31988795 GAGGGCTTCCTGTAGGAAGAAGG + Intronic
1172588950 20:36104328-36104350 GAGAGTTTCAGGAAGGAGGCGGG + Intronic
1172618361 20:36305066-36305088 GAGGGCTTCCTGGAAGAGGCAGG - Intergenic
1172825436 20:37779286-37779308 GAGCGCTTCCTGAAGGGCGAGGG + Exonic
1172987126 20:39000688-39000710 CTGGGTTTCCTGGAGCAGGATGG + Intronic
1173221232 20:41134647-41134669 TAGAGTTTCCTGACTGAGGAGGG - Intergenic
1173464964 20:43273553-43273575 CATGGTTACCTGAAGGAGGGTGG - Intergenic
1173534640 20:43800196-43800218 GAGTGTTTGCTGAATGAGAATGG - Intergenic
1173795746 20:45858037-45858059 GAGGGCTGCCTGGAGGAGGAGGG + Intronic
1173857466 20:46259650-46259672 GAGGGCTGCCTGGAGGAGGGGGG + Intronic
1174286271 20:49475936-49475958 CAGGGTTGTCTGAAGGATGAAGG - Intronic
1174725722 20:52859678-52859700 GAGGTCTTCCTGGAAGAGGAGGG - Intergenic
1175137464 20:56835228-56835250 GAAGCCTTCCTGAAGGAGGCAGG + Intergenic
1175249593 20:57601205-57601227 GAAGGCTTCCTGGAGGAGGAGGG - Intergenic
1176036806 20:63043603-63043625 CAAGGCTTCCTGAAGGAAGAAGG + Intergenic
1176197632 20:63844682-63844704 CAGGTTTTCCTGAGGAAGGAAGG + Intergenic
1176792924 21:13341614-13341636 GAAGGGATCATGAAGGAGGATGG + Intergenic
1179597391 21:42452075-42452097 GAGGGCTTCCTGGAGGGGGTGGG - Intergenic
1179896433 21:44366115-44366137 GAGGGTCTCCTGGAGGACGGGGG + Intronic
1180540968 22:16447367-16447389 GAGGGTGAGCTGAAGCAGGATGG + Intergenic
1180600495 22:17012293-17012315 GAGGGCTTCTTGGAGGAGGAGGG + Intergenic
1180760412 22:18198157-18198179 GAGGGTTGCCACAAGGACGACGG + Intergenic
1180770725 22:18382454-18382476 GAGGGTTGCCACAAGGACGACGG + Intergenic
1180775257 22:18426539-18426561 GAGGGTTGCCACAAGGACGACGG - Intergenic
1180808331 22:18737594-18737616 GAGGGTTGCCACAAGGACGACGG - Intergenic
1180828669 22:18885413-18885435 GAGGGTTGCCACAAGGACGACGG + Intergenic
1181027624 22:20134899-20134921 GAAGGCTTCCTGAAGGAAGAGGG - Intronic
1181071253 22:20342559-20342581 GAGGGTTGCCACAAGGACGACGG - Intergenic
1181194328 22:21171508-21171530 GAGGGTTGCCACAAGGACGACGG - Intergenic
1181215115 22:21321270-21321292 GAGGGTTGCCACAAGGACGACGG + Intergenic
1181382871 22:22520863-22520885 GAGGGGGTAGTGAAGGAGGAGGG - Intergenic
1181414022 22:22746469-22746491 GAGTGTCTCCTGAAGGAGGCTGG - Intronic
1181527342 22:23497569-23497591 GAGGGCATCCAGAGGGAGGAGGG - Intergenic
1182679024 22:32063851-32063873 GAGGGAGTCCAGAATGAGGAAGG + Intronic
1183265214 22:36820697-36820719 TGGGGTTTGCTGAAGAAGGAAGG + Intergenic
1183279887 22:36926288-36926310 GAGGGTTTCTTGAGGGATGAGGG + Intronic
1183390933 22:37545540-37545562 GAGGGCTTCCTGGAGGAAGGAGG - Intergenic
1183518875 22:38284727-38284749 CAGGGTTTCCTAAGGGAGAATGG - Intergenic
1183733621 22:39631542-39631564 GAGGACTGCCTGGAGGAGGAGGG + Intronic
1183857331 22:40644024-40644046 GAGGGCTTCCTGGAGGAAGTGGG - Intergenic
1184450490 22:44579677-44579699 CAGGGCTTCCTGGAGGAGGTGGG - Intergenic
1184684800 22:46091415-46091437 GAGGGCTTCCTGGAGGAAGAGGG - Intronic
1184684811 22:46091451-46091473 GAGGGCCTCCTGGAGGAAGAGGG - Intronic
1184684820 22:46091487-46091509 GAGGGCTTCCTGGAAGAAGAGGG - Intronic
1184684827 22:46091523-46091545 GAGGGCTTCTTGGAGGAAGAGGG - Intronic
1184684836 22:46091559-46091581 GAGGGCTTCCTGGAGGAAGAGGG - Intronic
1184684845 22:46091595-46091617 GAGGGCTTCCTGGAGGAAGAGGG - Intronic
1184787220 22:46677775-46677797 GAGGGTCTCATGTAAGAGGAAGG - Exonic
1184886138 22:47345408-47345430 GAGGGTGTCCTGCATGAGGAGGG + Intergenic
1203232561 22_KI270731v1_random:123626-123648 GAGGGTTGCCACAAGGACGACGG + Intergenic
1203278760 22_KI270734v1_random:111401-111423 GAGGGTTGCCACAAGGACGACGG + Intergenic
949423601 3:3891902-3891924 GAGGATGTGCTGAAGCAGGATGG - Intronic
949495713 3:4629806-4629828 GAGGGCTTCCTGGAGGAAGAAGG + Intronic
951622075 3:24613386-24613408 AAATGTTTCCTGAAGGAAGATGG + Intergenic
952171401 3:30811046-30811068 GAGGGTTTCTGGAAGGGGAAGGG - Intronic
952322300 3:32289447-32289469 GAAGGCTTCCTGGAGGAGGTGGG + Intronic
952440175 3:33318950-33318972 GTGTGTTTCCTGAAGGAGAAGGG + Intronic
952754016 3:36850154-36850176 GAGGCTCTCCTAAAAGAGGAAGG - Intronic
953293119 3:41686340-41686362 CAGGGTTTCTTGGAAGAGGAAGG + Intronic
953908137 3:46878615-46878637 AGGGGTTTTCTGAGGGAGGAAGG + Intronic
953925167 3:46979108-46979130 GAAGGCTTCCTGGAGGAGGGAGG + Intronic
954156419 3:48687336-48687358 GAGGGCTTCTGGGAGGAGGAAGG - Intergenic
954224434 3:49173061-49173083 GAGGCCTTCCTGATGGATGAGGG + Exonic
954413638 3:50382240-50382262 TGGGGGTCCCTGAAGGAGGAAGG - Intronic
955473229 3:59308830-59308852 GAGAGTTTTCAGAAGGATGATGG + Intergenic
956748783 3:72330092-72330114 TGGGGTTTCCTGCAGCAGGATGG - Intergenic
959720531 3:109482148-109482170 TAGGGTTTATTGAAGGAGGAAGG + Intergenic
959736433 3:109664888-109664910 GAGGGTGTGCTGAAGCAGGGCGG + Intergenic
960454939 3:117859576-117859598 GAGAGGTGACTGAAGGAGGAAGG - Intergenic
960956494 3:123035174-123035196 GAAGGCTTCTTGAAGGAGGTGGG + Intergenic
961102455 3:124211903-124211925 GAAGGCTTCCTGGAGGAAGAGGG + Intronic
961174245 3:124820982-124821004 GAGGGTGTCTTAAAGGAGGGTGG - Intronic
961214268 3:125147552-125147574 GAGGGGATCCGGAGGGAGGAGGG - Intronic
961820213 3:129572032-129572054 GAAGGCTTCCTGGAGGAGGTGGG - Intronic
962321779 3:134396569-134396591 GAGGTTCCCCTGAAGGAGGCCGG - Intergenic
964026865 3:152084733-152084755 GAGTTTTTCCTAAAGCAGGAAGG - Intergenic
964640607 3:158906377-158906399 GAGGGAATGCTGAAGGAGGTGGG - Intergenic
965278675 3:166720604-166720626 TAGGGATTCCTCAAGGATGAGGG + Intergenic
967773278 3:193358053-193358075 GAAGGAGTCCTCAAGGAGGAAGG + Intronic
968222063 3:196947038-196947060 GTGGGAGTCATGAAGGAGGACGG + Exonic
968684042 4:1944254-1944276 CCTGGTTTCCTGAAGGAGGTGGG + Intronic
968730424 4:2266991-2267013 GAAGGCTTCCTGGAGGAGGTGGG + Intergenic
968982072 4:3855675-3855697 TAAGGACTCCTGAAGGAGGAAGG - Intergenic
969370943 4:6731310-6731332 TAGGGTTGCCTAGAGGAGGAAGG + Intergenic
969607157 4:8208084-8208106 GAGGGTTGCCAGGTGGAGGATGG - Intronic
969620505 4:8276536-8276558 GAGGGCTTCCTGTAAGAGGAGGG + Intronic
969652583 4:8476659-8476681 GAGGGTCTCATGGAGGAGGGAGG - Intronic
970929946 4:21498019-21498041 CAGGGCTTTCTGAAGGAGTATGG - Intronic
972050583 4:34727767-34727789 GATGTTTTCCTGGAGGAGGAGGG + Intergenic
975137926 4:70892598-70892620 GGAGGTTGCCAGAAGGAGGAAGG + Intergenic
975927599 4:79477239-79477261 GTGGTCTTCCTGAAGGTGGAGGG - Intergenic
976561155 4:86503027-86503049 GAGGGACTGCTGAAAGAGGATGG + Intronic
977356950 4:95957925-95957947 GAGGCTTTCCTGCAGCAGGTTGG + Intergenic
978464498 4:108994126-108994148 GAGGGCTACCTGAAGCAGGGAGG + Intronic
984924527 4:184794925-184794947 GAGGATTTGCTGAAGAGGGACGG + Intronic
985965821 5:3338273-3338295 GAGGGTGTCCTGTGGGTGGAGGG + Intergenic
986428037 5:7654233-7654255 CAGGGTTTCAGGAAGGAAGAAGG + Intronic
987016429 5:13824811-13824833 CAGGATTACCTGAAGGAGGAAGG + Intronic
987123316 5:14788263-14788285 GGAGGTTTCCTGAGGGAGGAAGG - Intronic
987691063 5:21267733-21267755 GAGGTTTTTAAGAAGGAGGAGGG + Intergenic
988204370 5:28115316-28115338 GAAAGTTTGCTGAAGGAGTAGGG - Intergenic
988859969 5:35267513-35267535 GAAGGTTTCTAGAAGGAGGTGGG + Intergenic
989217935 5:38924417-38924439 GAGGGTTGTCTGAAGGAGCTAGG - Exonic
989241061 5:39203150-39203172 GAGAGTTTCTTGAAAGAGGAAGG + Intronic
989451878 5:41596466-41596488 GAGGGTGAGCTGAAGCAGGATGG + Intergenic
990249697 5:53900756-53900778 CATGGTTTCATGAAGGAGGTGGG + Intronic
990285290 5:54295731-54295753 GAATGTTTCCTGAATGAGGCTGG - Intronic
991419152 5:66423422-66423444 TAGGGTTTCCAGAAGAAGAAGGG + Intergenic
992102056 5:73417589-73417611 GAGGAATTCCTGGAGGAGGGAGG + Intergenic
992515288 5:77485533-77485555 GTCTGTTTCCTGAAGGAGCAAGG + Intronic
992791633 5:80219374-80219396 GAAGGTTTCCTGAAGTTTGAGGG - Intronic
994066228 5:95545682-95545704 GTGGGGTTGCTGAAGGAGGAAGG - Intronic
995522117 5:113018635-113018657 GAAGGTTTCCTGCAGGTGGTTGG + Exonic
996013356 5:118504843-118504865 TAGGGTTTCCTGGAGGAAGGAGG - Intergenic
996526178 5:124482234-124482256 TAGGGGTTGCTGAAGGTGGATGG + Intergenic
997436629 5:133880387-133880409 GAGGGCTTCCTGGAGGAGGCAGG - Intergenic
997469492 5:134108929-134108951 GAGGGCTTCCTGGAGGAAGGAGG - Intergenic
997880958 5:137589251-137589273 GAGTGTTTCCAGGAAGAGGAAGG + Intronic
998401865 5:141852547-141852569 GGGGGTTTCTGGAAGGAAGAGGG + Intergenic
998756020 5:145380054-145380076 GAGGGTTTGGTGCAGGAGCATGG - Intergenic
999481135 5:151949175-151949197 CAAGACTTCCTGAAGGAGGAAGG + Intergenic
999538159 5:152541483-152541505 GAGGGTTTTATGAAGGAGAAGGG + Intergenic
999954506 5:156685905-156685927 GGGGCTTTCCTGAGGGTGGAGGG + Intronic
1000574791 5:162964661-162964683 GAGGGTGAGCTGAAGCAGGATGG - Intergenic
1000961157 5:167602890-167602912 GAGGGCTTCCTGGAAGAGAATGG + Intronic
1001155789 5:169271538-169271560 GAGGGTTTCAGGAAGGAGGCAGG + Intronic
1001647722 5:173294780-173294802 GAGGGCTTCCTGGAGTAGGTGGG + Intergenic
1001791852 5:174464502-174464524 GAGTGGTTCTGGAAGGAGGAAGG - Intergenic
1001827886 5:174760679-174760701 GGTGGCTTCCTGAAGGAGAATGG + Intergenic
1002342456 5:178526094-178526116 GAGGGCTTCCTGAAGGAGAGAGG + Intronic
1002479045 5:179487265-179487287 GAGGGTTTCACAAAGGAGGAAGG - Intergenic
1002591887 5:180296123-180296145 GGGGGATTCCCGGAGGAGGAGGG - Intergenic
1003535003 6:6969100-6969122 GAGGGTGCCCTGAGGGAGGGAGG - Intergenic
1003601608 6:7522632-7522654 GAGTTTTTCCTGAATGAGGATGG + Intergenic
1003815701 6:9837751-9837773 GGGGCTTTCCTGAGGGTGGAGGG + Intronic
1005339653 6:24831348-24831370 GAGAGTTTCCTGAAGGGGATGGG + Intronic
1006146012 6:31960151-31960173 GATGGGTTCCTGAAGGAAGCTGG + Intronic
1006431950 6:34002539-34002561 GAAGGCTTCCTGAAGGAGGTAGG + Intergenic
1006457361 6:34139496-34139518 GCAGGCTTCCTGGAGGAGGAAGG - Intronic
1006911132 6:37564379-37564401 GAGGGGCTCTTGAAGGAGGGAGG - Intergenic
1007170608 6:39860642-39860664 CAGGGTGACCTGAAGCAGGAGGG + Intronic
1007249904 6:40488462-40488484 GAAGGCTTCCTGCAGGAGGGAGG - Intronic
1007271710 6:40642382-40642404 GAAGGCTTCCTGCAAGAGGAGGG + Intergenic
1007413061 6:41675907-41675929 GAGGGCCTCCTGTAGGAAGAGGG - Intergenic
1007500846 6:42295600-42295622 GAGGGCTTCCTGGATGAGGCTGG - Intronic
1007509071 6:42361771-42361793 CAGAGCTGCCTGAAGGAGGATGG - Intronic
1007836883 6:44680903-44680925 GAAGGCTTCCTGAAGGAGGTGGG - Intergenic
1008460601 6:51765358-51765380 AAGGGTTTTATGCAGGAGGATGG - Intronic
1008632991 6:53381750-53381772 GAGGGATACCTGAAGGTGCAGGG - Intergenic
1008679392 6:53856395-53856417 GAGGTATTCCTGAAGGAGCTGGG + Intronic
1008974723 6:57411188-57411210 GAGCTTTTACTGATGGAGGAAGG - Intronic
1009571427 6:65390412-65390434 TAGGGTTTTCAGAAGGAGAAGGG + Intronic
1009988155 6:70806476-70806498 GAGGGTGAGCTGAAGGAGGGCGG - Intronic
1010329875 6:74610612-74610634 GAGGGTTTCCTGGATGAAGGTGG - Intergenic
1012469355 6:99553594-99553616 GAAGATTTACTGAAGGAGGAAGG - Intronic
1013598374 6:111681623-111681645 GATGGCTTCATGAAGGAGGTGGG - Intronic
1014158883 6:118143937-118143959 GATGGTTTTCTGATGGAAGATGG + Intronic
1015539527 6:134300097-134300119 AAGGTTTTCCTGAGGGAAGAAGG - Intronic
1015631625 6:135237328-135237350 GAGGGTTTCTTGATGGTTGAAGG + Intergenic
1015691031 6:135923029-135923051 GAGGTTTTCCAGAAGGTGGTTGG - Intronic
1016475884 6:144427451-144427473 GTAGGTTTCTTGGAGGAGGAGGG + Intronic
1017357039 6:153521464-153521486 GAGGGTGAGCTGAAGCAGGAGGG - Intergenic
1018114722 6:160572170-160572192 GAGGGTGACCTGAAGCAGGGTGG - Intronic
1018410573 6:163542241-163542263 GAGGATTAACGGAAGGAGGAAGG - Intronic
1018899168 6:168042693-168042715 GAGGCAGTCCTGAAGGAGGTGGG - Exonic
1018937859 6:168285318-168285340 GTGGGTTCTCTGAAGGAGCAGGG - Intergenic
1019071976 6:169354150-169354172 GAGGGTGAGCTGAAGGAGGGTGG - Intergenic
1019210662 6:170401992-170402014 CAGGGAGTCCTGAGGGAGGATGG - Intronic
1019777251 7:2919192-2919214 AAGGGCTTCCTGGAGGAGGAGGG + Intronic
1021997050 7:26189297-26189319 GAGGGTTTACTGAAGCATGGGGG - Intergenic
1022734164 7:33060713-33060735 GAGATTTTTCTGAGGGAGGAGGG + Intronic
1023732539 7:43205967-43205989 GAGGGTGTCCTGGATGGGGAGGG - Intronic
1024632246 7:51259485-51259507 GTGGGTTTCCTCAAGGAGATGGG - Intronic
1024793361 7:52992732-52992754 GAGAGTGTCCTGAGGGAGGTAGG + Intergenic
1025111037 7:56216411-56216433 GAAGGGTTGCAGAAGGAGGAGGG + Intergenic
1025209764 7:57013834-57013856 GAGGGGTCCCTGATGGAGGCTGG + Intergenic
1025662189 7:63563017-63563039 GAGGGGTCCCTGATGGAGGCTGG - Intergenic
1027249469 7:76389989-76390011 GAGGGCTTCCTGGAGGAGGAAGG + Exonic
1027508196 7:79045224-79045246 GAGGTTTTCCTGTAGCAGAAGGG + Intronic
1029222388 7:99000726-99000748 TGGGGTGTCCTGAAGGAGCAGGG + Intronic
1029365156 7:100111991-100112013 CAGGGCTTCCTGTGGGAGGAGGG + Exonic
1029514890 7:101018255-101018277 GAGGGAGTCCTGGGGGAGGAGGG - Intronic
1029514932 7:101018371-101018393 GAGGGAGTCCTGGGGGAGGAGGG - Intronic
1029623825 7:101707268-101707290 GAAGGCTTCCTGAAGGAGGTGGG - Intergenic
1032390634 7:131553273-131553295 GAAAGCTTCCTGAAGGAGGTGGG - Intronic
1033272337 7:139943931-139943953 GAGGGTTTTCTGAATAAGTAAGG - Intronic
1034105918 7:148489810-148489832 GAGGGCTTCGTGAAAAAGGAAGG - Intergenic
1034224316 7:149471065-149471087 GAGTGATTCCTGTAGGAGGAAGG + Intergenic
1034414845 7:150959014-150959036 GAGGGCATCCTGACAGAGGAAGG + Intronic
1034892698 7:154854917-154854939 AAGGGGTTCCTGAATGTGGAAGG - Intronic
1034971833 7:155424105-155424127 GAGGGTGTCCTGGAGGGGAACGG - Intergenic
1036217987 8:6896798-6896820 GAGGGTTTACAGAGGTAGGAGGG - Intergenic
1036744064 8:11391512-11391534 AAGGAGTTCCAGAAGGAGGACGG - Intronic
1037884755 8:22590040-22590062 GAGGGCTTCTTGGAGGAAGAGGG + Intronic
1038083434 8:24166041-24166063 CAGTTTTTCCTGAAGGTGGAGGG + Intergenic
1038722962 8:30054509-30054531 GATGGTTTCCTGAGGGATGATGG + Intergenic
1039361244 8:36879605-36879627 GAAGGCTTCCTGCAGGAGGCAGG + Intronic
1039893399 8:41699369-41699391 CAGGGATTCCAGAGGGAGGAAGG - Intronic
1040309591 8:46229849-46229871 GAGGGATTCCGGAATGAGGGAGG - Intergenic
1040550286 8:48432187-48432209 ATGGGCTTCCTGGAGGAGGAGGG + Intergenic
1040968890 8:53112787-53112809 GAGGGTGAGCTGAAGCAGGATGG - Intergenic
1042001251 8:64125406-64125428 GAGGTCTTCTTGAAGAAGGATGG + Intergenic
1042106409 8:65332163-65332185 AGTGGTTTCCTGAAGGATGAGGG - Intergenic
1043214168 8:77564571-77564593 GAGGCCTTCCAGAAGGTGGAAGG + Intergenic
1043529633 8:81135203-81135225 GAGGGTTTTCTGCAGGAGAGTGG - Intergenic
1044633926 8:94303685-94303707 GAGTGTTTGGTGAAGGAGAAGGG - Intergenic
1048286156 8:133143242-133143264 GAAGGACACCTGAAGGAGGAAGG - Intergenic
1049199707 8:141334087-141334109 AAGGACTTCCTGGAGGAGGAGGG + Intergenic
1049268973 8:141684144-141684166 GAGGGCTTCCCCAAGGAGGGTGG - Intergenic
1049299098 8:141860454-141860476 GAGGGCATCCTGATGCAGGAGGG - Intergenic
1049352197 8:142170343-142170365 GAGGGCTTCCTGGAGGAGGAGGG + Intergenic
1049794148 8:144488871-144488893 GAGGGTTTCAGGATGGAGGGTGG + Intronic
1049849219 8:144821795-144821817 GAGGGTGTCCTAGAGGAGGGAGG - Intergenic
1050751650 9:8945851-8945873 GAAGGTTTCCTGAAGGAATTGGG - Intronic
1051355968 9:16239996-16240018 GAGGGTTGCGGGGAGGAGGAGGG - Intronic
1052856051 9:33407250-33407272 GAAGGCTTCCTGAAGGAAGAGGG + Intergenic
1053298854 9:36934660-36934682 GAGGGCTTCCTGGAAGAGGAAGG - Intronic
1054712852 9:68528987-68529009 GTGGGTTTTCTGGAGGAGGTGGG - Intronic
1055658142 9:78472921-78472943 GAGGATTTCCAGAAGGAAGGTGG + Intergenic
1055681349 9:78718826-78718848 GAGAGTTTGGTGAAGGAGAATGG + Intergenic
1056078416 9:83063901-83063923 GAGGGTCTCCTGGAAAAGGATGG - Intergenic
1056847719 9:90055261-90055283 GATGCTTTCCAGAAGGAGGGTGG + Intergenic
1057732090 9:97618840-97618862 GAAGGTTTCATGGAGGAGCATGG - Intronic
1059365192 9:113781388-113781410 GAAGGCTTCCTGAAGGAGGAGGG - Intergenic
1059519577 9:114927914-114927936 AAGGGTTTCCTATAGGAAGATGG - Intronic
1060736130 9:126067526-126067548 GAGGCCTTCCTGGAGGAGGAGGG - Intergenic
1061580822 9:131534793-131534815 TAGGGTGGCTTGAAGGAGGAGGG - Intergenic
1061621712 9:131814884-131814906 GAAGGCTTCCTGGAGGAAGAGGG - Intergenic
1061817808 9:133206956-133206978 GAGGGTCACCTTAAGGGGGAGGG - Intronic
1061913148 9:133735366-133735388 GAGGGTTTCCTGAAGGAGGAGGG - Intronic
1062277616 9:135738164-135738186 GAGGGCTTCCTGGAGGAGGTGGG - Intronic
1062407331 9:136403183-136403205 GAGGGTTTCCAGAGCGGGGAGGG + Intronic
1062421883 9:136486597-136486619 GAGCTCTTCCTGGAGGAGGAGGG + Intergenic
1062495180 9:136828172-136828194 GAGGGTTTGCTGCTGAAGGAAGG - Intronic
1062737068 9:138143440-138143462 GAGGGCTTCCTGGAGGAGGAGGG + Intergenic
1186174473 X:6910624-6910646 GAAGGCTCCCTGGAGGAGGAAGG + Intergenic
1186721972 X:12314340-12314362 GCGGGCTTCCTGAAGGAAGTGGG + Intronic
1186996641 X:15130926-15130948 GAGCCTTTCCTGAAGGAGCTTGG - Intergenic
1187003589 X:15208022-15208044 GAGGGGTTCGTGAAGGGGTATGG - Intergenic
1187571521 X:20508485-20508507 GACAGTTTCCTGAATGAGGTAGG + Intergenic
1187798934 X:23038033-23038055 ATGGCTTTCCTGAATGAGGAGGG + Intergenic
1188115759 X:26240310-26240332 GATGGTTTCCCAAAGGAGAATGG - Intergenic
1190898076 X:54640627-54640649 GAGCTTTTCCTGTAGGAGTAGGG + Intergenic
1191123485 X:56929897-56929919 GAGGTTTACTTGAATGAGGAAGG - Intergenic
1191719829 X:64220242-64220264 CAGGGTTTCCTCAAGGCTGAGGG + Intergenic
1191971307 X:66819751-66819773 GGGGGGTTCCAGAGGGAGGAGGG + Intergenic
1192703246 X:73498409-73498431 GAGGGTGAGCTGAAGTAGGATGG - Intergenic
1193176617 X:78401805-78401827 TTGGGTTTCCTGAAGGAGATGGG + Intergenic
1194112123 X:89847537-89847559 GAGGCCTACCTGAAGGTGGAGGG + Intergenic
1194596245 X:95862151-95862173 GAGGGTATCAAGCAGGAGGAAGG + Intergenic
1194675002 X:96783740-96783762 GAGTGATTCCCAAAGGAGGAAGG - Intronic
1195614687 X:106903070-106903092 GAGAGCTTCCTGAGAGAGGAAGG - Intronic
1196709386 X:118746647-118746669 AAGGGTTTGTTGTAGGAGGAGGG + Intronic
1197425311 X:126289755-126289777 AAGTAGTTCCTGAAGGAGGAAGG + Intergenic
1198162576 X:134022194-134022216 GAGTGTTTCAAGAATGAGGAAGG - Intergenic
1198222370 X:134614095-134614117 GAAGGCTTCCTGGAGGAGGTGGG - Intronic
1198640525 X:138751012-138751034 GAGAGTTTCAGGAAGGAAGAAGG + Intronic
1199606133 X:149581122-149581144 AAGGGTTTCCTGCAAGATGAGGG - Intergenic
1199632988 X:149788246-149788268 AAGGGTTTCCTGCAAGATGAGGG + Intergenic
1200399255 X:156009701-156009723 GAGGGCTTCCTGGAGGAGGAGGG + Intronic
1200464778 Y:3502317-3502339 GAGGCCTACCTGAAGGTGGAGGG + Intergenic
1201453283 Y:14140168-14140190 AAGGCTTTCCTGAAGAAGGATGG + Intergenic