ID: 1061913647

View in Genome Browser
Species Human (GRCh38)
Location 9:133738062-133738084
Sequence ACTTGTGGGGAGGAGCGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061913639_1061913647 1 Left 1061913639 9:133738038-133738060 CCTTCGCCTGGTGAGGGTAGGCA 0: 1
1: 0
2: 1
3: 8
4: 95
Right 1061913647 9:133738062-133738084 ACTTGTGGGGAGGAGCGGCAGGG No data
1061913635_1061913647 8 Left 1061913635 9:133738031-133738053 CCTGGCACCTTCGCCTGGTGAGG 0: 1
1: 1
2: 1
3: 19
4: 144
Right 1061913647 9:133738062-133738084 ACTTGTGGGGAGGAGCGGCAGGG No data
1061913640_1061913647 -5 Left 1061913640 9:133738044-133738066 CCTGGTGAGGGTAGGCAGACTTG 0: 1
1: 0
2: 0
3: 11
4: 144
Right 1061913647 9:133738062-133738084 ACTTGTGGGGAGGAGCGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061913647 Original CRISPR ACTTGTGGGGAGGAGCGGCA GGG Intronic
No off target data available for this crispr