ID: 1061918020

View in Genome Browser
Species Human (GRCh38)
Location 9:133767008-133767030
Sequence CTACTTCCCCTGCCCTACAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 154}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061918020_1061918022 14 Left 1061918020 9:133767008-133767030 CCAATGTAGGGCAGGGGAAGTAG 0: 1
1: 0
2: 0
3: 20
4: 154
Right 1061918022 9:133767045-133767067 TGATTAATTCAAAAGTAGGCAGG No data
1061918020_1061918023 29 Left 1061918020 9:133767008-133767030 CCAATGTAGGGCAGGGGAAGTAG 0: 1
1: 0
2: 0
3: 20
4: 154
Right 1061918023 9:133767060-133767082 TAGGCAGGAAAGAAGAAAAAAGG No data
1061918020_1061918021 10 Left 1061918020 9:133767008-133767030 CCAATGTAGGGCAGGGGAAGTAG 0: 1
1: 0
2: 0
3: 20
4: 154
Right 1061918021 9:133767041-133767063 ATATTGATTAATTCAAAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061918020 Original CRISPR CTACTTCCCCTGCCCTACAT TGG (reversed) Intronic
900374752 1:2348416-2348438 CTCCTCCCTCTGCCCTCCATGGG + Intronic
901655840 1:10768658-10768680 CTGCTTCCCCTCCCCCACAGTGG - Intronic
908197690 1:61761375-61761397 CTATTTTCCCTCCCCTACACTGG - Intronic
909409419 1:75331930-75331952 ACACTTCCCCTCCCCTACAAAGG + Intronic
914203559 1:145506888-145506910 GTATTTCCCTTTCCCTACATTGG + Intergenic
914482681 1:148080042-148080064 GTATTTCCCTTTCCCTACATTGG + Intergenic
915520929 1:156443213-156443235 CTACTTCTCCTCCCCTACCACGG + Intergenic
918849501 1:189667823-189667845 CTATTACCACTGCCCTACACTGG + Intergenic
919682607 1:200451225-200451247 CTAGAGCCCCTGCCCTACATTGG + Intergenic
922563091 1:226583136-226583158 CCACTTCCCCTGCATTATATTGG + Intronic
924083442 1:240423246-240423268 CTCCTTCCCCCACCCTCCATAGG - Intronic
1063607675 10:7537149-7537171 CTACTTACCCTGCGTCACATTGG + Intergenic
1066544806 10:36488378-36488400 CTATTTCCCCTTCCCTCCAGAGG + Intergenic
1067085745 10:43237339-43237361 CTGCTTCACCTGCCCTCCAATGG + Intronic
1067792637 10:49299535-49299557 CTACTTCCCCAGCACAGCATCGG - Intronic
1067967570 10:50929869-50929891 CTGCTTCCCCTCCCCTATTTCGG - Intergenic
1072488611 10:95880715-95880737 ATATTTCCCCTGCCACACATGGG - Intronic
1075335610 10:121607009-121607031 CTGCTCCCCATGCCCTAAATGGG + Intergenic
1075726426 10:124613088-124613110 CTCCTCCCCCTGCCCTACTCAGG - Intronic
1081721887 11:45295338-45295360 CTACTTCCCAAGCCATTCATGGG + Intergenic
1084756368 11:71241396-71241418 CCGCTTCCCCTGCCCCACACAGG + Intronic
1084954348 11:72683543-72683565 CCATTTCCCCTGCCCTACTTTGG - Intergenic
1085326900 11:75613246-75613268 CTTCCTTCCCTGCCCTACATGGG + Intronic
1088742635 11:112779489-112779511 CTGCTTGCCCTGACCTCCATTGG + Intergenic
1089777353 11:120847730-120847752 CCTCTTCCCCTGCCTTACATAGG - Intronic
1090910399 11:131113651-131113673 CAACCTCCACTGCCCTGCATTGG + Intergenic
1091948020 12:4566323-4566345 CTACCTCCCTGGCCCTCCATCGG + Intronic
1092218021 12:6695824-6695846 CCACTTCCCCTGCCCTCTAGGGG + Intronic
1092225865 12:6748135-6748157 CTCCTTCCACAGCCCTAGATAGG + Exonic
1092228512 12:6764355-6764377 CTGCTTGCCCTGCCTTATATGGG - Intronic
1095250389 12:39972260-39972282 CTATGTTCCCTGCCCTACTTTGG - Intronic
1097584718 12:61501659-61501681 CAACTTCCACTTCCCTTCATGGG - Intergenic
1098654805 12:73014159-73014181 ATACTTCCCCTGACCAACTTAGG - Intergenic
1101900301 12:108787038-108787060 CTCCTTTCCCTTCCCTAGATGGG + Exonic
1103401652 12:120647187-120647209 CGTCTTCCCCTGCCCAGCATTGG - Intronic
1104973425 12:132541526-132541548 CCACTTCCCTTCCCCTGCATGGG - Intronic
1105412433 13:20182365-20182387 CTGCTGCCCCTGCCCTGCAATGG + Intergenic
1105414318 13:20195146-20195168 CTCCTTCTCCTCCCCTACACTGG - Intergenic
1107414843 13:40190857-40190879 CTAAGTCTCCTGCCTTACATTGG + Intergenic
1112509574 13:99997667-99997689 CCCCTTCCCCTTCCCCACATCGG + Intergenic
1114389744 14:22294236-22294258 GTCCCTCCCTTGCCCTACATGGG + Intergenic
1118399190 14:65363952-65363974 CTATTTTCCCTCCCCTACAGTGG + Intergenic
1118712805 14:68536452-68536474 GTACTTTCCGAGCCCTACATTGG + Intronic
1119186548 14:72646882-72646904 CTAATTCCCCTGCCCTGGAGTGG + Intronic
1119876778 14:78066549-78066571 CTCTTTCCCCTCCCCTCCATGGG + Intergenic
1120966883 14:90175423-90175445 CTCCTACCCCTGCCCTCAATTGG + Intronic
1127051649 15:55089993-55090015 CTGCTTCCTCTTCCCTTCATAGG + Intergenic
1128796090 15:70467791-70467813 CCACCTCCCTTGCCCTCCATAGG + Intergenic
1129140706 15:73595455-73595477 CTCCTACCACTGCCCTACAAAGG + Intronic
1129675327 15:77630198-77630220 CCACTTCCCCTACCCTCCACTGG + Intronic
1135824116 16:25711311-25711333 CTACCTCAGCTGCCCCACATTGG - Intronic
1135940905 16:26820901-26820923 TTACATCCCCTGCCCTGCAATGG + Intergenic
1139167738 16:64589240-64589262 TTATTTCTGCTGCCCTACATGGG + Intergenic
1139697874 16:68687992-68688014 CCACTTCACATGCTCTACATAGG - Intronic
1139903715 16:70348136-70348158 TCACTTCCACTGCCCAACATAGG - Intronic
1141663794 16:85455443-85455465 CTTCATCCCCAGCCCTACACTGG - Intergenic
1142360788 16:89625658-89625680 TTTCTTCTCCTGCCCTACACTGG - Intronic
1144632074 17:16879123-16879145 ATACTTCCCCTGCCCTCAGTGGG + Intergenic
1144949476 17:18986180-18986202 CTACTTCCCCTGCCCATAGTGGG + Intronic
1148457381 17:47818336-47818358 CTACTGCCTCAGCCCTACCTGGG - Exonic
1148613270 17:48979399-48979421 CCACTGCGCCTGGCCTACATAGG - Intergenic
1149069678 17:52524985-52525007 CTAGATACCCTGCCATACATAGG - Intergenic
1151574337 17:74944200-74944222 CTGCATCCCATACCCTACATGGG + Intronic
1155116920 18:22778050-22778072 CTTCTTCCCCTCCCCAGCATGGG + Intergenic
1157110905 18:44819603-44819625 TTCCTTCCTCTGCCCTGCATGGG - Intronic
1161212418 19:3074308-3074330 CTACTTGGCCTGCCCTCCAGAGG + Intergenic
1162530352 19:11232320-11232342 CTGCTTTCCCTGCCCTCCACTGG - Intronic
1162583975 19:11547775-11547797 CTGCTTTCCCTGCCCCACCTAGG + Exonic
1165370133 19:35400090-35400112 CTACTACACCTGGCCAACATAGG + Intergenic
1166948963 19:46413696-46413718 CTCCTTCCCCTCCCCCACAGGGG + Intergenic
1168246423 19:55114945-55114967 CTCCTGCCCCTTCCCTACAGGGG - Intronic
928237644 2:29558564-29558586 CTTCTTCCCCTGCTCTACCTTGG + Intronic
929471767 2:42200919-42200941 CCACTTCCCCTGTTCTCCATGGG + Intronic
931337495 2:61361998-61362020 CTATTTTCTTTGCCCTACATAGG - Intronic
932778238 2:74542003-74542025 CCGCTGCCCCTGGCCTACATAGG - Intronic
932860662 2:75287967-75287989 CTGCTTCTCCTTCCCTCCATAGG + Intergenic
933018299 2:77159972-77159994 CTTCTTCCCCTGTCTTACACTGG + Intronic
934864832 2:97798408-97798430 CTACTCCCCCTGGCATAGATCGG + Intronic
938127676 2:128686266-128686288 CTCCTTCCCCTGCCCATGATGGG + Intergenic
945278292 2:208010714-208010736 CTACTTCCCCAGCCCTTTCTGGG - Intronic
946708815 2:222485818-222485840 CTCCTTCCCCTTCCCAGCATGGG - Intronic
946765337 2:223035496-223035518 CTACTTTCCATGCCCTAGAGAGG + Intergenic
948148258 2:235724527-235724549 TGACTTCCCCTGCCCTACGCTGG - Intronic
1169795036 20:9452968-9452990 CTACTGCCCCTTCCACACATTGG - Intronic
1169875487 20:10292722-10292744 CTGCTACCGCTGCCCTACACAGG - Intronic
1170687364 20:18581580-18581602 CCACTGCACCTGGCCTACATTGG + Intronic
1175321762 20:58093125-58093147 TTACCTCCCCTGCTCTCCATGGG - Intergenic
1175907107 20:62386438-62386460 CTGCTTCCCCTGCCCTGCCCTGG + Intergenic
1178715222 21:34958241-34958263 CCCCTTCCCCTCCCCTACAGAGG + Intronic
1178749165 21:35284193-35284215 TCACTTCCCCTGCCCTGCCTGGG + Intronic
1179411319 21:41165815-41165837 CTCCTTTCTCTGCCCTGCATCGG + Intergenic
1180841364 22:18960348-18960370 CCACCTCCCCTGCCCTGCAGCGG + Intergenic
1183227155 22:36558417-36558439 CTGCCTCCCCTGCCCATCATGGG - Intergenic
1184104108 22:42357565-42357587 CTCCTTCCCCTGGCCTGCCTGGG + Intergenic
1184659366 22:45958834-45958856 CTCCTGCCCCTGACTTACATGGG - Intronic
1184994774 22:48197437-48197459 CTAGCTCCCCTGCCCAACGTGGG + Intergenic
949146024 3:701064-701086 GTACTTACCCTGGCCAACATAGG - Intergenic
949266203 3:2159387-2159409 CTACTTACTCTGACCTATATCGG + Intronic
949954709 3:9258279-9258301 ATACTTTCCCTCCCCTACTTGGG - Intronic
950422031 3:12904892-12904914 CTCCTTACCCTGCCCAACTTGGG + Intronic
958819092 3:98952234-98952256 CTACTTACCCTGGCCAACTTAGG - Intergenic
962254923 3:133864056-133864078 GAGCTTGCCCTGCCCTACATGGG - Intronic
965939442 3:174160351-174160373 CTTCCTCCCCTGCCCAAAATAGG + Intronic
969313224 4:6366459-6366481 CTGCATCCCCTGCTCCACATAGG - Intronic
969440271 4:7212851-7212873 CTCCTCACCCTGCCCTCCATGGG - Intronic
973615714 4:52676007-52676029 CTCCCTTCCCTGCCCTCCATAGG + Intergenic
978182311 4:105814093-105814115 TGCCTTCCCCTGCCCTACCTAGG + Intronic
978973996 4:114846188-114846210 CTCCTTCCCATGCCCAAAATGGG - Intronic
982135523 4:152271042-152271064 CTACTTCGCATGCCCAACACAGG - Intergenic
982943677 4:161590698-161590720 CTACTTCATATGCTCTACATTGG + Intronic
987247533 5:16063673-16063695 CTAATTCTCCTCCCATACATAGG + Intergenic
987695510 5:21324603-21324625 CTACTTCCCCTGCTCCACCCAGG - Intergenic
988130243 5:27094988-27095010 TTACTTCCCCTGGCTTACAGTGG - Intronic
988181222 5:27796792-27796814 CTACAGCCTCTGCCCCACATTGG + Intergenic
990734111 5:58841216-58841238 CTACATGCCCTCCCCTAAATGGG - Intronic
991744895 5:69727496-69727518 CTACTTCCCCTGCCCCACCCAGG + Intergenic
991752810 5:69827730-69827752 CTACTTCCCCTGCCCCACCCAGG - Intergenic
991796465 5:70307224-70307246 CTACTTCCCCTGCCCCACCCAGG + Intergenic
991802428 5:70384464-70384486 CTACTTCCCCTGCCCCACCCAGG - Intergenic
991824275 5:70602810-70602832 CTACTTCCCCTGCCCCACCCAGG + Intergenic
991832129 5:70702858-70702880 CTACTTCCCCTGCCCCACCCAGG - Intergenic
991888843 5:71306780-71306802 CTACTTCCCCTGCCCCACCCAGG + Intergenic
992261499 5:74975143-74975165 CTCCCTCCCCTTCCCTACCTTGG - Intergenic
992323073 5:75633237-75633259 CTACATCCCCAGCCCTTCAAAGG - Intronic
992937171 5:81719789-81719811 CTGTTTACCCTGCCCTGCATTGG - Intronic
994235348 5:97356219-97356241 CTACTTCCACAGCACTACACAGG - Intergenic
997464035 5:134074757-134074779 ATGCTTACCCTGCCCTATATGGG + Intergenic
999930946 5:156432462-156432484 ATACTTCCCCTGGCCAACTTTGG - Intronic
1000796791 5:165674063-165674085 CTACCCCCCCTGCCTTACATGGG - Intergenic
1001095201 5:168770734-168770756 CAGCTTCCCCTCCCCCACATAGG + Intronic
1001746841 5:174098864-174098886 CTAGTTCTCCAGCGCTACATTGG - Intronic
1003485870 6:6579341-6579363 CCAGTTCCCCTGCCCCACAGAGG + Intergenic
1005555273 6:26973499-26973521 CTACTTCCCCTGCCCCACCCAGG + Intergenic
1006068012 6:31476400-31476422 CTCCTTCCCTTTCCCCACATGGG - Intergenic
1007841230 6:44717473-44717495 CCACTGCCCCTGCCTGACATGGG - Intergenic
1009829214 6:68909438-68909460 CTACTTCCTCATCTCTACATTGG + Intronic
1013022868 6:106236531-106236553 CTACTTCACGTTCCCTAGATTGG - Intronic
1014988829 6:128048441-128048463 CTAATGCTCCTGCCCTACATGGG + Intronic
1016017931 6:139205087-139205109 ATACTTCCCCTGGCCAACTTAGG + Intergenic
1016347222 6:143126978-143127000 CTACTTCTTCTCCCCTACTTGGG - Intronic
1017074173 6:150601848-150601870 CTGCTTCCCCTACTCTAAATGGG + Intronic
1018769661 6:166959508-166959530 CTACTCCCCCACCCCCACATCGG + Intergenic
1019593079 7:1845352-1845374 CTCCCTCCGCTGCCCTGCATGGG + Intronic
1020758646 7:12239751-12239773 TTACTTTCACTGCCTTACATGGG + Exonic
1022573864 7:31479190-31479212 CTCCTTCCCCTGCCCTGCTTCGG + Intergenic
1022630649 7:32081373-32081395 ATACTTTCCCTCCCCTACCTAGG + Intronic
1024143975 7:46492297-46492319 CTACTTCTTCTACCCTACAAAGG - Intergenic
1027966463 7:85016384-85016406 CTACTCCTCCTGCCCTACCTTGG + Intronic
1028632262 7:92947833-92947855 CTACTTCCCCTCCCCTTCCGAGG + Intergenic
1028840252 7:95421682-95421704 CTACCTCCCCTCCCCTAGACTGG - Intronic
1029123720 7:98283956-98283978 CCACTTCCCCTTCCCTAGGTGGG + Intronic
1030265003 7:107611277-107611299 CCACTGCCCCTGGCCTACAATGG - Intronic
1034082534 7:148292835-148292857 CAACTTCCTCTGCCCTACACTGG + Intronic
1035627976 8:1088162-1088184 CGACTTCCCATCCCCTAAATGGG + Intergenic
1035814724 8:2527091-2527113 TTCCTTCCCCTGCCCTACAGTGG - Intergenic
1036989957 8:13581004-13581026 TCTCTTCTCCTGCCCTACATGGG - Intergenic
1038420248 8:27429987-27430009 CCCCTTCCCCTGCCATACGTGGG - Intronic
1041748436 8:61234038-61234060 CTTCTTTCCCTGCCCTACTTGGG + Intronic
1046177992 8:110604680-110604702 CTGCTTCCTCTGTCCTTCATGGG + Intergenic
1047665551 8:127087181-127087203 CTCCTTCTCCTCCCCTACGTCGG - Intergenic
1055457557 9:76487227-76487249 CTCCTTCCCTTGACCTACCTTGG + Intronic
1056461703 9:86815165-86815187 CTACTTCCCCAGCCCCAGCTTGG - Intergenic
1056583678 9:87914388-87914410 CTACTGCCCCTCCCCAACAAAGG + Intergenic
1056584170 9:87917857-87917879 CTACTGCCCCTCCCCAACAAAGG + Intergenic
1056612699 9:88135068-88135090 CTACTGCCCCTCCCCAACAAAGG - Intergenic
1056613196 9:88138558-88138580 CTACTGCCCCTCCCCAACAAAGG - Intergenic
1057109612 9:92455416-92455438 CTGCGTCCCCTGCCCTCCACAGG - Intronic
1057159945 9:92882467-92882489 CTACTGCCCCTCCCCAACAAAGG + Intergenic
1057567447 9:96178235-96178257 CTTCTTCCCCAGCCCTGAATGGG + Intergenic
1058453654 9:105119501-105119523 CTACCTCTCCTGCCCTTCCTGGG - Intergenic
1061684924 9:132267793-132267815 CTACTTCCCATGTCCTCCTTGGG + Intronic
1061918020 9:133767008-133767030 CTACTTCCCCTGCCCTACATTGG - Intronic
1193006607 X:76626049-76626071 ATACTTCCCCTGACCAACAAAGG + Intergenic
1194181453 X:90715780-90715802 ATACTTCCCCTGGCCAACTTAGG + Intergenic
1200528077 Y:4297695-4297717 ATACTTCCCCTGGCCAACTTAGG + Intergenic