ID: 1061919131

View in Genome Browser
Species Human (GRCh38)
Location 9:133772518-133772540
Sequence GACAGAAGGAGGTTAGTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 569
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 539}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061919131_1061919141 30 Left 1061919131 9:133772518-133772540 CCAGACACTAACCTCCTTCTGTC 0: 1
1: 0
2: 1
3: 28
4: 539
Right 1061919141 9:133772571-133772593 ATTCAAATGTGACCTTACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061919131 Original CRISPR GACAGAAGGAGGTTAGTGTC TGG (reversed) Intronic
900115524 1:1026309-1026331 GGGAGAAGGAGGTTAGGGTGAGG + Intronic
900567644 1:3341467-3341489 GGCAGATGGAGATCAGTGTCCGG + Intronic
901719783 1:11187522-11187544 TACAGCAGGAGGTGAGTGGCAGG - Intronic
902183287 1:14705928-14705950 CACAGCAGGAGGTGAGTGGCAGG + Intronic
902884029 1:19392234-19392256 GACAGAAGGGGGTTGCTGTGGGG + Intronic
902942350 1:19809539-19809561 CACAGCAGGAGGTGAGTGGCAGG + Intergenic
903602574 1:24553551-24553573 GACAGAATGAGGTCAGAGGCAGG - Intergenic
904126633 1:28244930-28244952 GACAGAAAGAGTTTTGTGCCCGG + Intronic
904721898 1:32516479-32516501 CACAGCAGGAGGTAAGTGGCTGG + Intronic
907608008 1:55839028-55839050 GACAGTAGGAGGTAAATATCTGG - Intergenic
908015907 1:59835883-59835905 CACAGAAGCAGGTGAGTGGCAGG - Intronic
909423924 1:75499432-75499454 CACAGCAGGAGGTGAGTGGCAGG - Intronic
909677311 1:78252676-78252698 GACAGAGGGAGGTGGATGTCTGG + Intergenic
911214153 1:95174282-95174304 GACAGGAGGAAGTTAGTGTCAGG - Intronic
911604316 1:99885520-99885542 CACAGCAGGAGGTGAGTGGCAGG + Intronic
911625971 1:100124959-100124981 CACAGCAGGAGGTGAGTGGCAGG - Intronic
915651026 1:157310987-157311009 CAGAGAAGCAGGTGAGTGTCAGG - Intergenic
915962048 1:160275078-160275100 CACAGCAGGAGGTGAGTGGCAGG + Intergenic
916260605 1:162838586-162838608 GCAAGGAGGAGGTTAGTTTCAGG - Intronic
916409259 1:164529083-164529105 CAAACAAGGAGGTTAGTTTCAGG + Intergenic
917347926 1:174048057-174048079 CACAGCAGGAGGTGAGTGGCTGG + Intergenic
918524785 1:185453511-185453533 CACAGCAGGAGGTTAGTGGTGGG + Intergenic
918573346 1:186025228-186025250 CACAGCAGGAGGTGAGTGGCAGG - Intronic
918623616 1:186633500-186633522 GAAAGAAGGAGGTTTGTTTTAGG - Intergenic
918762755 1:188434903-188434925 GACAGCAGGATGTGAGTGGCTGG - Intergenic
919618071 1:199832115-199832137 GACTGAAGGAGGAGAGGGTCAGG + Intergenic
920181579 1:204135095-204135117 GAGTGGAGGAGGTTAGTGTAGGG - Intronic
920868958 1:209777306-209777328 TATAGAAGGAGGTCAGTGTTGGG - Intronic
922222915 1:223622130-223622152 GGCAGAGGCAGGTTAGTGTGGGG - Intronic
922781397 1:228255853-228255875 CACAGCAGGAGGTGAGTGGCAGG + Intronic
923068793 1:230544093-230544115 GTGAGAAGGGGGTTAGTTTCTGG + Intergenic
923311183 1:232737109-232737131 CACGGAAGCAGGTGAGTGTCAGG - Intergenic
923387179 1:233476783-233476805 GAAAGAAGGAGATTTGTTTCAGG - Intergenic
924233208 1:241979282-241979304 GACCGCAGGAGGTGAGTGGCAGG - Intergenic
924464071 1:244284610-244284632 GACAGAAGGAGGCTAGCGCTTGG - Intergenic
1063576284 10:7264876-7264898 TACAGTAGCAGGTTAGTGCCTGG + Intronic
1064303847 10:14147733-14147755 CACAGCAGGAGGTGAGTGGCGGG - Intronic
1064449818 10:15431664-15431686 CACAGCAGGAGGTGAGTGGCGGG + Intergenic
1064541116 10:16406046-16406068 CACAGCAGGAGGTGAGTGGCAGG + Intergenic
1064646346 10:17463962-17463984 CACAGCAGGAGGTGAGTGGCAGG + Intergenic
1064871920 10:19946921-19946943 CACAGCAGGAGGTGAGTGGCAGG - Intronic
1064922904 10:20537752-20537774 CACAGAAGCAGGTGAGTGGCAGG - Intergenic
1065073188 10:22048974-22048996 CACAGCAGGAGGTGAGTGGCAGG + Intergenic
1065361838 10:24896166-24896188 CACAGCAGGAGGTGAGTGGCAGG + Intronic
1065960261 10:30728207-30728229 CACAGCAGGAGGTGAGTGGCTGG - Intergenic
1066789727 10:39049108-39049130 AACAGAAGGATGTTATTTTCAGG - Intergenic
1067040151 10:42947082-42947104 GACAGAATTAGTTTTGTGTCAGG - Intergenic
1067993784 10:51245858-51245880 TACAGAAGGAGGTTGGTTTAAGG - Intronic
1069357292 10:67601472-67601494 TACAGCAGGAGGTGAGTGGCAGG - Intronic
1069589883 10:69635128-69635150 GACAGAGGCAGCTTAGTGTGGGG + Intergenic
1069808507 10:71141355-71141377 GGCCGAAGTAGGTTTGTGTCTGG + Intergenic
1069905838 10:71731557-71731579 GACAGAAGGGCTTCAGTGTCAGG - Intronic
1070105989 10:73431909-73431931 GACAGAATGAGGTTAGTTGTTGG - Intronic
1071348436 10:84715560-84715582 GAGAGAGGGAGGTTAGTGGCTGG + Intergenic
1071348637 10:84717019-84717041 AAGAGAGGGAGGTTAGTGGCTGG + Intergenic
1071982032 10:91013171-91013193 CACAGCAGGAGGTGAGTGGCAGG - Intergenic
1072052976 10:91724776-91724798 CACAGCAGGAGGTGAGTGGCAGG + Intergenic
1073232324 10:101982563-101982585 CACAGCAGGAGGTGAGTGGCAGG + Intronic
1073233840 10:101996333-101996355 GAAAGAAGCAGGTCAATGTCAGG - Intronic
1073659948 10:105463714-105463736 CACAGCAGGAGGTGAGTGGCAGG + Intergenic
1073746872 10:106479184-106479206 CACAGCAGGAGGTGAGTGGCAGG + Intergenic
1074507519 10:114084766-114084788 CACAGCAGGAGGTGAGTGGCTGG - Intergenic
1074610253 10:115014955-115014977 CACAGCAGGAGGTGAGTGGCAGG - Intergenic
1075467578 10:122663143-122663165 GAGAGAAGGAGGTTGGAGTTGGG + Intergenic
1075880636 10:125847933-125847955 GACAGCAGGAGGTGAGTGGGGGG - Intronic
1075893363 10:125973485-125973507 CACAGTAAGAGGTCAGTGTCTGG + Intronic
1076135564 10:128043468-128043490 CACAGCAGGAGGTGAGTGGCAGG - Intronic
1076555024 10:131315904-131315926 GACAGATGGAGGTTCAGGTCGGG + Intergenic
1077426476 11:2481556-2481578 CACAGCAGGAGGTGAGTGGCAGG + Intronic
1078059824 11:8036012-8036034 GACAGGAGGAGGGTATTCTCTGG - Intronic
1078099607 11:8322108-8322130 CACAGCAGGAGGTGAGTGACAGG + Intergenic
1078849510 11:15151133-15151155 CACAGCAGGAGGTGAGTGGCCGG + Intronic
1080014397 11:27489545-27489567 CACACCAGGAGGTGAGTGTCGGG - Intergenic
1080202127 11:29684413-29684435 CACAGCAGGAGGTGAGTGGCTGG - Intergenic
1080830670 11:35890705-35890727 TACAGCAGGAGGTGAGTGGCAGG - Intergenic
1080832004 11:35903585-35903607 CACAGCAGGAGGTGAGTGGCAGG - Intergenic
1081254759 11:40878624-40878646 CACAGTAGGAGGTGAGTGGCAGG - Intronic
1081650135 11:44818335-44818357 GACAGAGGAAGGTGAGGGTCAGG - Intronic
1083064658 11:59912493-59912515 AACAGAAGGAGGTTAAGGTTTGG - Intergenic
1083390450 11:62345915-62345937 CACAGCAGGAGGTGAGTGGCAGG - Intronic
1084932392 11:72567507-72567529 TACAGCAGGAGGTGAGTGGCAGG - Intergenic
1085566388 11:77517988-77518010 CACAGCAGGAGGTGAGTGGCAGG - Intronic
1087812496 11:102623320-102623342 CACAGCAGGAGGTGAGTGGCGGG + Intronic
1088519114 11:110675664-110675686 CACAGCAGGAGGTGAGTGGCAGG - Intronic
1089772795 11:120815465-120815487 GAGAGAAGGAGGTGAGTGTGAGG + Exonic
1090659049 11:128868999-128869021 CACAGAAGGAGGTGAGTGGTAGG - Intergenic
1090670995 11:128945233-128945255 GCCAGAAGACGGTGAGTGTCCGG + Intergenic
1091479730 12:815114-815136 CACAGCAGGAGGTGAGTGGCAGG - Intronic
1092292077 12:7166211-7166233 CACAGAAGGAGGTGAGTGGTAGG + Intergenic
1092307831 12:7319640-7319662 CACAGCAGGAGGTGAGTGGCGGG - Intronic
1092752114 12:11728359-11728381 CACAGCAGGAGGTGAGTGGCGGG + Intronic
1092776190 12:11946828-11946850 CACAGCAGGAGGTGAGTGGCAGG + Intergenic
1093251365 12:16808189-16808211 CACAGCAGGAGGTGAGTGACAGG + Intergenic
1093411922 12:18877808-18877830 CACAGCAGGAGGTGAGTGACAGG - Intergenic
1093832268 12:23776822-23776844 CACAGCAGGAGGTGAGTGGCGGG - Intronic
1094009724 12:25794590-25794612 GACAGAACTAGGTTTGAGTCAGG + Intergenic
1094075147 12:26464480-26464502 CACAGCAGGAGGTGAGTGGCAGG - Intronic
1094645765 12:32322546-32322568 CACAGCAGGAGGTGAGTGGCAGG - Intronic
1095764295 12:45877209-45877231 CACAGCAGGAGGTGAGTGCCAGG + Intronic
1096425046 12:51494127-51494149 GACAGATCTAGGTTAGTGCCAGG + Intronic
1096483404 12:51958815-51958837 CACAGCAGGAGGTAAGTGGCAGG - Intronic
1096592423 12:52669761-52669783 GAGAGAAGGCAGTTAGTGTGTGG + Intergenic
1096657849 12:53102877-53102899 GACAGAGGGAGGTTTGCATCCGG + Intergenic
1097322949 12:58245954-58245976 GACAGAAGGAGGATGTTTTCAGG + Intergenic
1097925044 12:65117918-65117940 CACAGCAGGAGGTGAGTGGCAGG - Intronic
1099154569 12:79158449-79158471 CACAGCAGGAGGTGAGTGGCAGG - Intronic
1099198687 12:79650073-79650095 TACAGCAGGAGGTGAGTGGCTGG - Intronic
1099868723 12:88319226-88319248 CACAGCAGGAGGTGAGTGACAGG + Intergenic
1100162138 12:91872740-91872762 CACAGCAGGAGGTGAGTGACTGG + Intergenic
1100262216 12:92943102-92943124 GCAAGAAGGAGGTTTGTTTCAGG - Intergenic
1100567301 12:95809566-95809588 CACAGCAGGAGGTGAGTGGCCGG - Intronic
1100820488 12:98424947-98424969 GCCAGACGGGGTTTAGTGTCAGG + Intergenic
1101370253 12:104122473-104122495 CACAGCAGGAGGTGAGGGTCTGG + Intronic
1101512818 12:105407865-105407887 CACAGTAGGAGGTTAGTGGCAGG + Intergenic
1101968644 12:109297196-109297218 CACAGAAGGAGGTGAGTAGCAGG + Intronic
1102362507 12:112300558-112300580 GACTGAAGGACGTTGGTATCTGG - Intronic
1104013471 12:124947896-124947918 GAGGGAAGGAGGACAGTGTCAGG + Intronic
1104246823 12:127051022-127051044 CACAGCAGGAGGTTAGTGACAGG + Intergenic
1104297890 12:127534743-127534765 CACAGCAGGAGGTGAGTGGCAGG + Intergenic
1104418510 12:128615693-128615715 CACAGCAGGAGGTGAGTGGCGGG - Intronic
1104518729 12:129452980-129453002 CACAGCAGGAGGTGAGTGGCAGG + Intronic
1105668633 13:22588215-22588237 TACTGAGGGAGGTTTGTGTCTGG - Intergenic
1105989734 13:25606980-25607002 CACAGCAGGAGGTGAGTGGCAGG + Intronic
1107600544 13:42008097-42008119 CTCAGAAGGAGATTAGTGCCAGG + Intergenic
1107715377 13:43194401-43194423 GAGAGAAGGAGGGTAATGACGGG - Intergenic
1107751673 13:43574041-43574063 GACCTAATGAGGTTAGTGACAGG + Intronic
1108072965 13:46648336-46648358 CACAGCAGGAGGTGAGTGTCAGG - Intronic
1108333347 13:49412900-49412922 CACAGTAGGAGGTGAGTGGCTGG - Exonic
1108457850 13:50634570-50634592 CACAGCAGGAGGTGAGTGACAGG - Intronic
1108461358 13:50670587-50670609 TACAGCAGGAGGTGAGTGGCAGG + Intronic
1108481923 13:50881321-50881343 CACAGCAGGAGGTGAGTGGCAGG + Intergenic
1108588894 13:51895121-51895143 CACAGCAGGAGGTGAGTGGCAGG - Intergenic
1108608202 13:52061304-52061326 CACAGCAGGAGGTGAGTGGCAGG - Intronic
1108826151 13:54415159-54415181 CACAGCAGGAGGTTAGCGCCAGG + Intergenic
1110778825 13:79441144-79441166 CACAGCAGGAGGTGAGTGGCAGG - Intergenic
1111011855 13:82324656-82324678 GACAGAAGGAGCATAGAGCCTGG - Intergenic
1111419030 13:87985575-87985597 CACAGCAGGAGGTAAGTGGCAGG - Intergenic
1111454642 13:88465000-88465022 CACAGCAGGAGGTGAGTGACGGG + Intergenic
1111921038 13:94411444-94411466 CACAGCAGGAGGTGAGTGGCAGG - Intergenic
1112025223 13:95405523-95405545 GACAGAAGGAGCACACTGTCTGG - Intergenic
1112032992 13:95474396-95474418 TACAGCAGGAGGTGAGTGGCAGG - Intronic
1112095459 13:96127492-96127514 CACAGCAGGAGGTGAGTGGCAGG - Intronic
1112265273 13:97918113-97918135 CACAGCAGGAGGTGAGTGGCAGG - Intergenic
1113073186 13:106441778-106441800 GGCAGAAGGAGGTTATTGAGAGG - Intergenic
1113247224 13:108411123-108411145 CACAGCAGGAGGTGAGTGGCAGG - Intergenic
1113346985 13:109488926-109488948 CACAGCAGGAGGTGAGCGTCGGG + Intergenic
1113978320 13:114249389-114249411 CACAGCAGGAGGTGAGTGGCAGG - Intronic
1114183462 14:20383459-20383481 GTGAGAAGGAGGTGGGTGTCGGG - Intronic
1114583567 14:23788435-23788457 GAAAGAAGGAGGTTTGTTTCAGG - Intergenic
1115021005 14:28681905-28681927 CACAGCAGGAGGTGAGTGGCAGG - Intergenic
1115251925 14:31357936-31357958 CACAGCAGGAGGTGAGTGGCGGG + Intronic
1116419208 14:44713621-44713643 CACAGCAGGAGGTGAGTGGCGGG - Intergenic
1117157832 14:52958255-52958277 CACAGCAGGAGGTGAGTGGCGGG + Intergenic
1117458122 14:55918151-55918173 TACAGCAGGAGGTGAGTGGCAGG + Intergenic
1117581118 14:57152660-57152682 CACAGCAGGAGGTGAGTGGCGGG + Intergenic
1118188001 14:63554991-63555013 GACAGCAGGAGGTGAGTGGCAGG - Intergenic
1118385410 14:65251868-65251890 CACAGCAGGAGGTGAGTGGCGGG + Intergenic
1120387947 14:83869108-83869130 CACAGCAGGAGGTTAGTGGCAGG - Intergenic
1121944969 14:98111278-98111300 CACAGCAGGAGGTGAGTGGCAGG - Intergenic
1124393095 15:29277627-29277649 CACAGCAGGAGGTGAGTGGCAGG - Intronic
1124450123 15:29780498-29780520 CACAGCAGGAGGTGAGTGGCGGG - Intronic
1124793233 15:32749926-32749948 GACAGAAGGAGGGAAGAGGCGGG - Intergenic
1125415621 15:39449338-39449360 GGCAGAAGGAGGGTATTGGCTGG - Intergenic
1126316706 15:47377674-47377696 GTCAGAAGCAGGAAAGTGTCTGG + Intronic
1126328813 15:47510138-47510160 CACAGCAGGAGGTGAGTGGCAGG + Intronic
1126329879 15:47520824-47520846 GCCAGAAGGAGGCTAGAGTCTGG + Intronic
1127142236 15:55989844-55989866 CACAGCAGGAGGTGAGTGGCAGG + Intronic
1127448536 15:59091968-59091990 CACAGCAGGAGGTGAGTGGCAGG - Intronic
1127876968 15:63120002-63120024 CACAGCAGGAGGTGAGTGGCAGG - Intergenic
1128662738 15:69514015-69514037 CACAGCAGGAGGTGAGTGGCAGG + Intergenic
1130629636 15:85553744-85553766 CACAGCAAGAGGTGAGTGTCAGG + Intronic
1132076495 15:98825449-98825471 CACAGCAGGAGGTGAGTGGCAGG + Intronic
1132130728 15:99275903-99275925 CACAGCAGGAGGTGAGTGGCAGG + Intronic
1132306390 15:100817211-100817233 CACAGCAGGAGGTGAGTGGCAGG + Intergenic
1133441345 16:5823550-5823572 CACAGAAGGAGGTGAGTTGCAGG + Intergenic
1134601786 16:15539376-15539398 CACAGCAGGAGGTGAGTGGCGGG - Intronic
1134662111 16:15991961-15991983 CACAGCAGGAGGTGAGTGGCAGG + Intronic
1135191451 16:20357986-20358008 CACAGCAGGAGGTGAGTGGCGGG - Intergenic
1136004545 16:27319689-27319711 CACAGCAGGAGGTGAGTGGCGGG + Intronic
1137042401 16:35625276-35625298 GAAAGAAGGAAGTTTGTGTTAGG - Intergenic
1138257628 16:55580742-55580764 CACAGCAGGAGGTGAGTGGCAGG + Intronic
1139245027 16:65433256-65433278 GACAGCAGGAGGGAAGTGGCAGG - Intergenic
1139307363 16:65998613-65998635 CACAGCAGGAGGTAAGTGGCTGG - Intergenic
1139375073 16:66491841-66491863 CACAGCAGGAGGTGAGTGGCGGG - Intronic
1139934468 16:70559047-70559069 GTCAGGAGGAGTGTAGTGTCTGG + Intronic
1140241427 16:73204588-73204610 CACAGCAGGAGGTGAGTGGCAGG - Intergenic
1144080269 17:11757988-11758010 CACAGAAGGATCTGAGTGTCTGG - Intronic
1144557878 17:16297903-16297925 CACAGCAGGAGGTGAGTGACGGG + Intronic
1144665670 17:17100524-17100546 CACAGCAGGAGGTGAGTGGCAGG + Intronic
1145251660 17:21300046-21300068 GACAGCAGATGGTGAGTGTCAGG - Intronic
1145714250 17:27004939-27004961 CACAGCAGGAGGTGAGTGGCTGG - Intergenic
1146224266 17:31052126-31052148 GGAAGAAAGTGGTTAGTGTCAGG - Intergenic
1146496952 17:33331018-33331040 CACAGGAGGAGGTGAGTGGCGGG + Intronic
1146606711 17:34265789-34265811 GAAAGTACGAGGTTAGTATCAGG - Intergenic
1146708524 17:35020318-35020340 CACAGCAGGAGGTGAGTGGCTGG + Intronic
1147173539 17:38636194-38636216 CACAGCAGGAGGTGAGTGGCTGG + Intergenic
1147446546 17:40478436-40478458 GACAGAATGAGGGTAGGGTGGGG - Intronic
1148399223 17:47339551-47339573 CACAGTAGGAGGTAAGTGGCTGG - Intronic
1148488487 17:48007037-48007059 GACAGAAGGAGGTGAATTACAGG - Intergenic
1149136513 17:53371948-53371970 CACAGCAGGAGGTGAGTGTAAGG + Intergenic
1150031974 17:61748106-61748128 CACAGCAGGAGGTGAGTGGCAGG + Intronic
1150168965 17:62971699-62971721 CACAGCAGGAGGTGAGTGGCTGG + Intergenic
1150517102 17:65825396-65825418 CACAGCAGGAGGTGAGTGGCAGG - Intronic
1151032087 17:70753124-70753146 CACAGCAGGAGGTGAGTGGCAGG + Intergenic
1151043657 17:70894329-70894351 GACAGCAGGAGGTGAGTGGTGGG - Intergenic
1151279550 17:73062967-73062989 CACAGCAGGAGGTGAGTGGCGGG - Intronic
1151945463 17:77317337-77317359 CACAGCAGGAGGTGAGTGACTGG + Intronic
1152752797 17:82072874-82072896 GATAGAAAGAGGGAAGTGTCCGG - Intergenic
1153139390 18:1954561-1954583 GGCAGAAGGGGGTTAGTCCCTGG - Intergenic
1153507285 18:5814238-5814260 CACAGCAGGAGGTGAGTGGCAGG - Intergenic
1154368839 18:13738962-13738984 CACAGCAGGAGGTGAGTGGCAGG - Intronic
1156009643 18:32481661-32481683 CACAGCAGGAGGTGAGTGGCAGG - Intergenic
1156721978 18:40081413-40081435 GACAGAAGGATATTACAGTCTGG + Intergenic
1157808559 18:50676977-50676999 CACAGCAGGAGGTGAGTGGCTGG + Intronic
1158403326 18:57140295-57140317 CACAGCAGGAGGTGAGTGGCAGG + Intergenic
1159285363 18:66342790-66342812 CACAGCAGGAGGTGAGTGGCAGG - Intergenic
1159670890 18:71219380-71219402 CACAGCAGGAGGTGAGTGGCAGG - Intergenic
1159703110 18:71654612-71654634 CACAGCAGGAGGTGAGTGGCAGG + Intergenic
1161457989 19:4379513-4379535 GACAGCAGCAGGTGTGTGTCAGG - Intronic
1163372779 19:16911170-16911192 CACAGCAGGAGGTGAGTGACAGG + Intronic
1164812588 19:31169648-31169670 AAAAAAAGGAGGTTTGTGTCTGG + Intergenic
1165268432 19:34681709-34681731 CACAGCAGGAGGTGAGTGGCAGG - Intronic
1165285990 19:34841982-34842004 CACAGCAGGAGGTGAGTGGCAGG + Intergenic
1165479170 19:36051830-36051852 CACAGCAGGAGGTGAGTGGCAGG + Intronic
1166037160 19:40177082-40177104 GCAAGAAGGGGGTTAGTTTCAGG - Intergenic
1166227976 19:41408901-41408923 GACAGAAGGAGCTCAGGGCCTGG - Intronic
1166251251 19:41572531-41572553 GAGAGCAGAAGGTAAGTGTCAGG - Intronic
1168180859 19:54662333-54662355 GAGAGAAGGAGGTGAGTGCATGG + Intronic
1168243525 19:55098772-55098794 AACAGGAGGACGTGAGTGTCAGG - Exonic
1168384648 19:55953030-55953052 CACAGCAGGAGGTGAGTGGCAGG + Intronic
1168582707 19:57568897-57568919 CACAGTAGGAGGTGAGTGGCAGG - Intergenic
925221887 2:2148443-2148465 CACAGCAGGAGGTGAGTGGCAGG - Intronic
926236121 2:11045421-11045443 CACAGCAGGAGGTGAGTGACGGG - Intergenic
927099178 2:19774910-19774932 GACAGCAGGGGGTTAGTATCTGG - Intergenic
928208594 2:29306026-29306048 CACAGCAGGAGGTGAGTGGCAGG - Intronic
928294245 2:30069183-30069205 GAGGGAAGGAGGATAGTGTGAGG - Intergenic
929008277 2:37416326-37416348 CACAGCAGGAGGTGAGTGGCAGG + Intergenic
930066464 2:47331702-47331724 CACAGCAGGAGGTGAGTGGCAGG - Intergenic
931747219 2:65300752-65300774 CTCAGAAGGAGGGTTGTGTCTGG - Intergenic
933239245 2:79901317-79901339 GACAGCAGGTGGTAAGTGCCTGG + Intronic
934625797 2:95849888-95849910 CACAGCAGGAGGTGAGTGGCAGG - Intronic
934807775 2:97251430-97251452 CACAGCAGGAGGTGAGTGGCAGG + Intronic
934829735 2:97505757-97505779 CACAGCAGGAGGTGAGTGGCAGG - Exonic
935227426 2:101065302-101065324 GACAGTAGATGGTTAGTGTTTGG - Intronic
935509094 2:103949014-103949036 GACAGTAGCAGGAGAGTGTCTGG - Intergenic
936042367 2:109159642-109159664 CACAGCAGGAGGTGAGTGGCGGG + Intronic
937014232 2:118589058-118589080 CACAGCAGGAGGTGAGTGGCAGG - Intergenic
937568564 2:123328703-123328725 CACAACAGGAGGTGAGTGTCTGG + Intergenic
937670313 2:124531326-124531348 AACAGCAGGAGGTGAGTGTCAGG - Intronic
938476800 2:131623375-131623397 CACAGCAGGAGGTTAGAGGCAGG + Intergenic
938904834 2:135827755-135827777 CACAGCAGGAGGTGAGTGGCAGG - Intronic
938943645 2:136191179-136191201 CACAGCAGGAGGTGAGTGGCAGG + Intergenic
939547459 2:143570963-143570985 CACAGTAGGAGGTGAGTGGCAGG + Intronic
940478113 2:154192197-154192219 GACAGAAGAAGATAAGTGGCTGG - Intronic
941000853 2:160202455-160202477 GAAAGAAAGAGGTTTCTGTCTGG + Intronic
941150217 2:161905425-161905447 CACAGCAGGAGGTGAGTGGCAGG - Intronic
941325736 2:164111613-164111635 CACAGCAGGAGGTGAGTGGCGGG - Intergenic
942538161 2:176987504-176987526 GACAGAAGGAGGCTAGCGTAGGG - Intergenic
942749406 2:179270649-179270671 CACAGCAGGAGGTGAGTGGCTGG - Intergenic
942936598 2:181564195-181564217 CACAGTAGGAGGTGAGTGGCAGG - Intronic
943294350 2:186117804-186117826 CACAGCAGGAGGTGAGTGACAGG - Intergenic
944069439 2:195652814-195652836 CACAGCAGGAGGTGAGTGTCAGG + Intronic
944901300 2:204219322-204219344 CACAGAAGGAGGTGAGTGGGGGG + Intergenic
945149826 2:206778736-206778758 CACAGCAGGAGGTGAGTGGCAGG + Intronic
945365382 2:208946479-208946501 GAGAGAAGGAGTTAACTGTCAGG - Intergenic
945568612 2:211435543-211435565 CACAGCAGGAGGTGAGTGGCAGG + Intronic
945671646 2:212809411-212809433 CACAGCAGGAGGTGAGTGGCAGG + Intergenic
945748068 2:213743398-213743420 GACAGAAGGAAGTTGATCTCAGG - Intronic
946016069 2:216605017-216605039 CACAGAAGGTAGCTAGTGTCCGG - Intergenic
946288363 2:218722960-218722982 GGCAGAAGGAGCTTAGTCCCTGG - Intronic
946405914 2:219492034-219492056 CCCAGAAGGACATTAGTGTCAGG - Intronic
946927062 2:224636503-224636525 CACAGCAGGAGGTGAGTGGCGGG + Intergenic
947000858 2:225454575-225454597 CACAGCAGGAGGTGAGTGGCAGG + Intronic
947211188 2:227710130-227710152 TACAGCAGGAGGTGAGTGGCGGG - Intronic
947230289 2:227877807-227877829 CACAGCAGGAGGTGAGTGGCGGG - Intronic
948004494 2:234596056-234596078 GCAAGAAGGAGGTTTGTTTCAGG + Intergenic
948118250 2:235509830-235509852 CACAGCAGGAGGTGAGTGACGGG + Intronic
1169166717 20:3430487-3430509 CACAGCAGGAGGTGAGTGTCAGG - Intergenic
1170936295 20:20812741-20812763 GAAAGAAGGAGGTTTGTGTGGGG + Intergenic
1171365700 20:24622463-24622485 CACAGCAGGAGGTGAGTGGCTGG + Intronic
1171444252 20:25192618-25192640 GCAAGAAGGAGGTTTGTTTCAGG - Intergenic
1172306710 20:33885704-33885726 CACAGCAGGAGGTGAGTGGCTGG + Intergenic
1172678523 20:36693551-36693573 CACAGGAGGAGGTGAGTGGCAGG + Intronic
1172850576 20:37960031-37960053 GACAGCAGGAAGTGAGTGGCAGG + Intergenic
1172855327 20:37997398-37997420 GGCATCAGGAGGTTAGTGACTGG + Intronic
1174116142 20:48227681-48227703 GACACAAGGGGGTGAGTGACTGG + Intergenic
1174144404 20:48441001-48441023 CACAGCAGGAGGTGAGTGGCGGG + Intergenic
1174551261 20:51363395-51363417 CACAGCAGGAGGTGAGTGGCAGG - Intergenic
1174552443 20:51371759-51371781 GCAAGAAGGAGGTTTGTTTCGGG + Intergenic
1174588026 20:51623886-51623908 GACAGGAGGAGGGGAGTGCCTGG - Intronic
1175370127 20:58482776-58482798 GACAGAAGCAAGATACTGTCAGG - Intronic
1175604029 20:60297878-60297900 CACAGCAGGAGGTGAGTGGCAGG - Intergenic
1175651632 20:60729696-60729718 CACAGCAGGAGGTGAGTGGCAGG + Intergenic
1177524696 21:22276284-22276306 GACAGCAGGAGGTGAGTGGCAGG + Intergenic
1177582488 21:23044093-23044115 CACAGCAGGAGGTGAGTGGCAGG + Intergenic
1177650500 21:23954637-23954659 GAGAGAAGGAGGAGAATGTCAGG + Intergenic
1177831632 21:26145511-26145533 CACAGCAGGAGGTGAGTGGCAGG - Intronic
1178065065 21:28895534-28895556 CACAGCAGGAGGTGAGTGGCAGG + Intergenic
1179256434 21:39720343-39720365 CACAGCAGGAGGTGAGTGGCTGG - Intergenic
1179385243 21:40935278-40935300 GACAAAATAAGGTTAGTTTCAGG - Intergenic
1180052977 21:45341366-45341388 CACAGAAGGAGGCTCGTGCCTGG + Intergenic
1182363514 22:29762397-29762419 CACAGCAGGAGGTGAGTGGCAGG + Intronic
1183082821 22:35467780-35467802 GGCAGAAGGAGGGCAGGGTCGGG + Intergenic
949475480 3:4441079-4441101 AACAGCAGGAGGTGAGTGGCAGG + Intronic
950212378 3:11133355-11133377 GAGAGAAGGTGGTCAGAGTCTGG + Intergenic
951043576 3:18014098-18014120 CACAGCAGGAGGTAAGTGGCCGG + Intronic
951632387 3:24736202-24736224 GAGAGAAGGAGGTTATTTCCTGG + Intergenic
951960308 3:28310988-28311010 GACAGCAGGAGGTGAGCGTCTGG - Intronic
952162980 3:30714294-30714316 CACAGCAGGAGGTGAGTGACAGG + Intergenic
952235776 3:31478461-31478483 AACAGTAAGAGGATAGTGTCAGG - Intergenic
952667958 3:35930493-35930515 GACAGAAAGAGCTTGGTCTCTGG - Intergenic
952710001 3:36420456-36420478 CACAGCAGGAGGTGAGTGGCGGG + Intronic
953249009 3:41226180-41226202 CACAGCAGGAGGTAAGTGGCAGG - Intronic
953706975 3:45238499-45238521 CACAGCAGGAGGTGAGTGGCAGG + Intergenic
953785619 3:45908894-45908916 CACAGGAGGAGGTGAGTGGCAGG + Intronic
953834756 3:46332851-46332873 TTCTGCAGGAGGTTAGTGTCAGG - Intergenic
954766195 3:52919080-52919102 CACAGCAGGAGGTGAGTGGCGGG - Intronic
954910619 3:54104227-54104249 CACAGCAGGAGGTGAGTGGCAGG + Intergenic
955551852 3:60093600-60093622 CACAGCAGGAGGTGAGTGGCGGG + Intronic
955599798 3:60632942-60632964 CTCTGAAGGAGTTTAGTGTCAGG - Intronic
955851418 3:63224151-63224173 CACAGCAGGAGGTGAGTGGCAGG + Intergenic
956315715 3:67934270-67934292 CACAGTAGGAGGTGAGTGACAGG - Intergenic
956647848 3:71474483-71474505 CACAGCAGGAGGTCAGCGTCAGG + Intronic
957426998 3:80051684-80051706 GGCAGAAGGAGGCTGGTCTCTGG + Intergenic
957613800 3:82503467-82503489 CACAGCAGGAGGTGAGTGGCAGG - Intergenic
958421879 3:93939495-93939517 GATAGAAGGATTATAGTGTCGGG - Intronic
960218718 3:115077029-115077051 CCCAGCAGGAGGTGAGTGTCCGG - Intronic
960537037 3:118826045-118826067 GAGAGAAGGAGGTAAATTTCAGG + Intergenic
960537563 3:118830188-118830210 CACAGCAGGAGGTGAGTGGCTGG + Intergenic
960775419 3:121246100-121246122 CACAGCAGGAGGTAAGTGGCAGG + Intronic
960791652 3:121438446-121438468 GACAGAAGGCTTTTAGTGGCAGG - Intronic
961727485 3:128942271-128942293 GACAGTAGAAGCTTTGTGTCTGG - Intronic
962285451 3:134082238-134082260 CACAGCAGGAGGTGAGTGGCTGG + Intronic
963147334 3:142007918-142007940 CACAGCAGGAGGTGAGTGGCAGG - Intronic
963308059 3:143676192-143676214 CACAGCAGGAGGTGAGTGGCAGG - Intronic
964552036 3:157895708-157895730 GACAGAAGTAGGTAGGTTTCAGG - Intergenic
964687645 3:159414928-159414950 AACAGCAGGAGGTGAGTGGCAGG - Intronic
964975972 3:162621150-162621172 CACAGTAGGAGGTGAGTGGCAGG + Intergenic
965769589 3:172167687-172167709 CACAGCAGGAGGTGAGTGGCAGG + Intronic
966334929 3:178857392-178857414 CACAGCAGGAGGTGAGTGGCGGG - Intergenic
967251953 3:187549002-187549024 GACAGAAGAGGGTAAGGGTCTGG + Intergenic
967814466 3:193787446-193787468 GACAGAGGGAGGTTAGCATCCGG + Intergenic
967901816 3:194462371-194462393 CACAGTAGGAGGTGAGTGACAGG + Intronic
967941716 3:194771525-194771547 GGCAGAAGAAGGTGAGTGGCTGG + Intergenic
967963499 3:194943106-194943128 AACAGCAGGAGGTCAGTGGCAGG + Intergenic
968352970 3:198077471-198077493 GACAGAATGAGCTTGGTGTTTGG + Intergenic
968438133 4:606027-606049 CACAGCAGGAGGTGAGTGGCAGG + Intergenic
968789514 4:2649828-2649850 CACAGCAGGAGGTGAGTGGCCGG + Intronic
969139507 4:5056221-5056243 GACAGAGGGAGGATAGTTTCAGG - Intronic
969695717 4:8733094-8733116 CACAGCAGGAGGTGAGTGGCAGG + Intergenic
969697438 4:8742723-8742745 CACAGCAGGAGGTGAGTGGCAGG - Intergenic
970371529 4:15411928-15411950 CACAGCAGGAGGTGAGTGGCAGG + Intronic
970924428 4:21434547-21434569 CACAGCAGGAGGTGAGTGGCAGG + Intronic
971475595 4:27068872-27068894 CAGAGAAGGAGCTGAGTGTCAGG - Intergenic
971483733 4:27138697-27138719 CACAGCAGGAGGTGAGTGGCAGG + Intergenic
971879506 4:32351949-32351971 CACAGCAGGAGGTGAATGTCAGG - Intergenic
972660482 4:41111214-41111236 CACAGCAGGAGGTGAGTGGCAGG - Intronic
973079611 4:45973151-45973173 CACAGCAGGAGGTAAGTGGCAGG - Intergenic
973131366 4:46652843-46652865 CACAGCAGGAGGTGAGTGGCGGG - Intergenic
973134944 4:46695690-46695712 CACAGCAGGAGGTGAGTGGCAGG - Intergenic
973747030 4:53973829-53973851 GACAGAAGGACTTTAGTGAAGGG - Intronic
973781952 4:54296465-54296487 GAAAGAAGGAGGCTGATGTCTGG - Exonic
974003818 4:56536097-56536119 CACAGCAGGAGGTGAGTGGCAGG - Intronic
974364021 4:60922071-60922093 CACAGCGGGAGGTGAGTGTCAGG - Intergenic
975325963 4:73059056-73059078 GACAGCAGGAGGTGAGTGGTGGG - Intronic
975349783 4:73332153-73332175 CACAGCAGGAGGTGAGTGGCAGG + Intergenic
975381680 4:73707593-73707615 CACAGCAGGAGGTGAGTGGCGGG + Intergenic
976342366 4:83959456-83959478 CACAGCAGGAGGTGAGTGGCGGG - Intergenic
976668148 4:87622454-87622476 CACAGCAGGAGGTGAGTGGCAGG - Intergenic
976865985 4:89727757-89727779 GACATAAGGAGTTTACAGTCTGG - Intronic
977235151 4:94499708-94499730 CACAGCAGGAGGTGAGTGGCAGG + Intronic
977398706 4:96503950-96503972 GACAGAATGAGGTTAGAATCAGG - Intergenic
977429786 4:96916962-96916984 CACAGCAGGAGGTCAGTGGCTGG - Intergenic
979055978 4:115995138-115995160 CTCAGAAGGAGGTGAGTGGCAGG - Intergenic
979402480 4:120265688-120265710 CATAGCAGGAGGTTAGTGGCAGG + Intergenic
979444328 4:120793089-120793111 CACAGCAGGAGGTGAGTGGCGGG + Intronic
979952152 4:126906636-126906658 CACAGAAGGAGGTGAGTGGCTGG + Intergenic
980021136 4:127711577-127711599 CACAGCAGGAGGTGAGTGGCGGG + Intronic
980230374 4:130039428-130039450 CACAGCAGGAGGTGAGTGGCGGG + Intergenic
980497068 4:133599946-133599968 GAAAGAAGGAGGTTTGTTTTGGG - Intergenic
981000119 4:139821279-139821301 CACAGTAGGAGGTGAGTGGCGGG + Intronic
981088647 4:140709910-140709932 CACAGCAGGAGGTGAGTGGCAGG - Intronic
981135324 4:141204607-141204629 GACAAACTGAGGTTATTGTCAGG + Intronic
981691063 4:147509542-147509564 CACAGCAGGAGGTGAGTGGCAGG + Intronic
981745318 4:148046993-148047015 GCCAGAAGGTGGTTTTTGTCTGG - Exonic
982104259 4:151997879-151997901 CACAGCAGGAGGTGAGTGGCGGG + Intergenic
982678557 4:158403289-158403311 CACAGCAGGAGGTGAGTGGCAGG + Intronic
983274734 4:165603418-165603440 TACAGCAGGAGGTGAGTGGCGGG - Intergenic
983439773 4:167766536-167766558 CACAGCAGGAGGTGAGTGGCTGG - Intergenic
984081057 4:175250548-175250570 CACAGCAGGAGGTGAGTGGCTGG - Intergenic
984630981 4:182060530-182060552 CACAGCAGGAGGTGAGTGTTGGG - Intergenic
984814329 4:183822706-183822728 CACAGAAGGAGGAGAGTGGCAGG - Intergenic
984858780 4:184218695-184218717 AATAGGAGGAGGTTAGTGACAGG + Intronic
984861760 4:184246663-184246685 CACAGAAGGAGGTGAGTGGTGGG - Intergenic
985080550 4:186260247-186260269 CACAGCAGGAGGTGAGTGGCAGG - Intergenic
985143828 4:186872249-186872271 CACAGCAGGAGGTGAGTGGCGGG + Intergenic
985423085 4:189803614-189803636 GACAGGAGGAACTCAGTGTCTGG - Intergenic
985472946 5:57317-57339 GTCACAAGGAGCTTAGTTTCAGG + Intergenic
986197978 5:5555308-5555330 CACAGCAGGAGGTGAGTGGCAGG + Intergenic
986952074 5:13100940-13100962 CACAGCAGGAGGTGAGTGGCAGG + Intergenic
987452568 5:18104653-18104675 GGCAGAAGTAGGTGAGTGTGTGG + Intergenic
987981660 5:25093838-25093860 GACATAATGAGGTTAGTAGCAGG + Intergenic
988440667 5:31228792-31228814 CACAGCAGGAGGTGAGTGGCAGG - Intronic
988850931 5:35180241-35180263 CACAGCAGGAGGTGAGTGGCGGG - Intronic
990325558 5:54672002-54672024 GCAAGAAGGAGGTTAGTTTTAGG - Intergenic
990961489 5:61398192-61398214 CACAGCAGGAGGTGAGTGGCAGG + Intronic
991097989 5:62759563-62759585 GACAGCAGGAGGTGAGTGGCAGG + Intergenic
991142012 5:63255479-63255501 GATAGAAGGAGGTTTGTTTTGGG - Intergenic
991670112 5:69038786-69038808 GACAGCAGGTTGTGAGTGTCTGG - Intergenic
991672303 5:69060582-69060604 CACAGCAGGAGGTGAGTGGCGGG - Intergenic
992273147 5:75086650-75086672 GAGAGATGGAGCTTAGTGTAAGG + Intronic
992307874 5:75462493-75462515 CACACCAGGAGGTGAGTGTCAGG - Intronic
993037302 5:82771806-82771828 CACAGCAGGAGGTGAGTGGCGGG - Intergenic
993968539 5:94388270-94388292 TACAGCAGGAGGTGAGTGGCGGG - Intronic
994690959 5:103019017-103019039 CACAGCAGGAGGTGAGTGGCAGG - Intronic
994819823 5:104634912-104634934 CACAGTAGGAGGTAAGTGGCAGG - Intergenic
994972699 5:106761895-106761917 CACAGTAGGAGGTGAGTGGCGGG - Intergenic
994982244 5:106890744-106890766 GAAAGTAGGAAGTTTGTGTCAGG - Intergenic
995179726 5:109219514-109219536 CACAGCAGGAGGTGAGTGGCAGG + Intergenic
995881058 5:116845253-116845275 CACAGCAGGAGGTGAGTGGCAGG - Intergenic
996080240 5:119251074-119251096 CACAGCAGGAGGTGAGTGTTGGG + Intergenic
996599654 5:125247184-125247206 GACAGAAGGAGGTTAGTTAATGG - Intergenic
997534691 5:134610140-134610162 GACAGAAGGAAATTAATATCAGG + Intronic
998765556 5:145482988-145483010 CACAGCAGGAGGTGAGTGGCAGG - Intronic
999941258 5:156545679-156545701 CACAGCAGGAGGTGAGTGGCAGG - Intronic
1001521815 5:172399699-172399721 AACAGAGGGATGTTATTGTCAGG - Intronic
1001631362 5:173177861-173177883 GAGAGGAGGAGGGGAGTGTCTGG + Intergenic
1002323691 5:178391024-178391046 CACAGCAGGAGGTGAGTGGCAGG + Intronic
1002911465 6:1494298-1494320 CACAGCAGGAGGTGAGTGACGGG - Intergenic
1004034898 6:11914420-11914442 CACAGCAGGAGGTGAGTGGCGGG - Intergenic
1004157939 6:13187148-13187170 CACAGCAGGAGGTGAGTGGCGGG - Intronic
1004779779 6:18895558-18895580 CACAGCAGGAGGTTAGCGGCAGG + Intergenic
1004834394 6:19514983-19515005 CACAGCAGGAGGTGAGTGGCAGG + Intergenic
1004924519 6:20403822-20403844 TACAGCAGCAGGTTAGTGACCGG + Intronic
1005058786 6:21757077-21757099 GACAGAATGAGTTTGGTGTGAGG + Intergenic
1005283309 6:24298253-24298275 CACAGCAGGAGGTGAGTGGCAGG - Intronic
1005660534 6:27994289-27994311 CACAGCAGGAGGTGAGTGGCAGG + Intergenic
1005739698 6:28778950-28778972 GAGAGAGGGCGCTTAGTGTCGGG - Intergenic
1005932754 6:30496161-30496183 CACAGTAGGAGGTGAGTGGCAGG - Intergenic
1006512849 6:34530983-34531005 CACAGCAGGAGGTGAGTGACAGG - Intronic
1006871342 6:37255057-37255079 CACAGCAGGAGGTGAGTGGCGGG - Intronic
1007112819 6:39322781-39322803 GACAGCAGCAAGTCAGTGTCAGG + Intronic
1008192917 6:48482061-48482083 CACAGCAGGAGGTGAGTGGCTGG - Intergenic
1008518630 6:52342263-52342285 CACAGCAGGAGGTGAGTGGCAGG + Intergenic
1009052230 6:58290026-58290048 TACAGCAGGAGGTGAGTGGCAGG - Intergenic
1009922739 6:70082992-70083014 CACAGCAGGAGGTGAGTGGCGGG - Intronic
1010680689 6:78795348-78795370 CACAGCAGGAGGTGAGTGGCAGG + Intergenic
1010864657 6:80959990-80960012 GAAAGAAGGATGACAGTGTCTGG - Intergenic
1012425389 6:99108542-99108564 CACAGCAGGAGGTGAGTGGCAGG - Intergenic
1012865504 6:104613595-104613617 GACAGAACCAGGTTATTGACTGG + Intergenic
1012884216 6:104825971-104825993 CACAGCAGGAGGTGAGTGGCAGG + Intronic
1013305222 6:108841390-108841412 CACAGGAGGAGGTTGTTGTCAGG - Intergenic
1013420893 6:109965748-109965770 CACAGCAGGAGGTGAGTGGCAGG + Intergenic
1013633191 6:112005064-112005086 GACTGGAGGAGGGTGGTGTCAGG - Intergenic
1014745035 6:125190872-125190894 CACAGCAGGAGGTGAGTGGCAGG - Intronic
1015158634 6:130126328-130126350 GACAAAAGGAGGTGAGAATCTGG - Intronic
1015957599 6:138614715-138614737 CACAGCAGGAGGTGAGTGGCAGG + Intronic
1016664926 6:146627799-146627821 TACAGAAGGAGATGAGTGTTTGG - Intronic
1016841399 6:148529141-148529163 TACAGCAGGAGGTGAGTGGCGGG - Intronic
1017055794 6:150434527-150434549 CACAGCAGGAGGTAAGTGGCGGG + Intergenic
1017324075 6:153127204-153127226 CACAGCAGGAGGTGAGTGGCTGG - Intronic
1017464571 6:154682467-154682489 CACAGGAGGAGGTGAGTGGCAGG + Intergenic
1018741903 6:166735792-166735814 CACAGCAGGAGGTGAGTGGCAGG - Intronic
1019432301 7:1004759-1004781 GAGAGAAAGAGGATTGTGTCAGG - Intronic
1020385150 7:7592826-7592848 CACAGCAGGAGGTGAGTGACAGG - Intronic
1021284218 7:18759278-18759300 CACAGCAGGAGGTGAGTGGCAGG + Intronic
1021749987 7:23787478-23787500 CACAGCAGGAGGTGAGTGGCAGG + Intronic
1022573174 7:31473010-31473032 CACAGAAGGAGGTGAGCGGCAGG - Intergenic
1022580178 7:31545104-31545126 GTCAGAAGTAGGTTAGAGTCAGG + Intronic
1022839892 7:34153774-34153796 GACAGCAGGAGATTGGTGACCGG + Exonic
1023112090 7:36824252-36824274 CACAGCAGGAGGTGAGTGACGGG - Intergenic
1023888055 7:44374895-44374917 GGGAGAAGGGGGTTAGGGTCAGG + Intergenic
1024255838 7:47539487-47539509 GGCAGGAGGAGGTCAGAGTCGGG - Intronic
1024493714 7:50017421-50017443 TACAGCAGGAGGTGAGTGGCAGG - Intronic
1026550723 7:71366185-71366207 CACAGCAGGAGGTGAGCGTCAGG - Intronic
1026553772 7:71388956-71388978 CACAGCAGGAGGTGAGTGGCAGG + Intronic
1026558399 7:71427715-71427737 CACAGCAGGAGGTGAGTGGCAGG + Intronic
1026620453 7:71945510-71945532 CACAGCAGGAGGTGAGTGGCAGG + Intronic
1027154659 7:75758157-75758179 CACAGCAGGAGGTGAGTGGCAGG - Intergenic
1028067566 7:86406341-86406363 CACAGCAGGAGGTGAGTGGCAGG + Intergenic
1028348705 7:89816822-89816844 CACAGCAGGAGGTGAGTGGCGGG - Intergenic
1029436469 7:100566711-100566733 GACAGAAGGAGGGCAGAGGCTGG - Exonic
1029536363 7:101160101-101160123 GGCAGAGGGAGGTGAGTGCCAGG - Intronic
1029920215 7:104254595-104254617 GGCAGAAAGAAGTTAGAGTCTGG - Intergenic
1029954150 7:104620054-104620076 CACAGCAGGAGGTGAGTGGCAGG - Intronic
1030282641 7:107792623-107792645 CACAGCAGGAGGTGAGTGGCAGG - Intronic
1030723812 7:112901194-112901216 CACAGCAGGAGGTAAGTGGCAGG + Intronic
1031532676 7:122895337-122895359 CACAGAAGGAGGTGAGTGGCAGG - Intergenic
1031644468 7:124206931-124206953 GACAAAAGGTGGTGAGTGTTGGG + Intergenic
1032058603 7:128704776-128704798 CACAGCAGGAGGTGAGTGGCCGG - Intergenic
1033250941 7:139758541-139758563 CACAGCAGGAGGTGAGTGGCAGG + Intronic
1034635111 7:152561010-152561032 CACAGCAGGAGGTGAGTGGCAGG + Intergenic
1036586292 8:10126949-10126971 CACAGCAGGAGGTGAGTGGCAGG - Intronic
1036621966 8:10430202-10430224 CACAGCAGGAGGTGAGTGGCAGG - Intergenic
1036692550 8:10952847-10952869 CACAGCAGGAGGTGAGTGGCAGG + Intronic
1037292703 8:17368248-17368270 CACAGCAGGAGGTGAGTGGCGGG - Intronic
1037603606 8:20419508-20419530 CACAGCAGGAGGTGAGTGGCAGG - Intergenic
1037736380 8:21570217-21570239 CACAGCAGGAGGTGAGTGGCAGG - Intergenic
1038614164 8:29077252-29077274 GACAGAAGGAGCTGAGTGCTGGG - Intronic
1039041999 8:33417011-33417033 GACAATAGGAGGTGAGTGGCGGG + Intronic
1039737745 8:40350601-40350623 GGCAGAAGCAAGTAAGTGTCCGG + Intergenic
1039958323 8:42224107-42224129 CACAGTAGGAGGTGAGTGGCAGG + Intergenic
1040010686 8:42658860-42658882 CACAGCAGGAGGTGAGTGGCAGG - Intergenic
1040087466 8:43360437-43360459 CACAGCAGGAGGTTAGTGGCAGG + Intergenic
1041332931 8:56747987-56748009 CACAGCAGGAGGTGAGTGGCAGG + Intergenic
1042321779 8:67483192-67483214 GAAAGAAGGAGGGAAGTGTCAGG - Intronic
1042347415 8:67741493-67741515 CACAGCAGGAGGTGAGTGGCAGG + Intronic
1042425453 8:68643002-68643024 CACAGCAGGAGGTTAGCGGCAGG - Intronic
1042981417 8:74533167-74533189 CACAGCAGGAGGTGAGTGGCAGG - Intergenic
1043187309 8:77170386-77170408 CACAGGAGGAGGTGAGTGGCAGG - Intergenic
1043198726 8:77335370-77335392 GATAGAAGCAGGTAAGAGTCTGG - Intergenic
1043706737 8:83359278-83359300 GAAAGAAGGAGGTTTGTTTTGGG + Intergenic
1043794584 8:84520605-84520627 CACAGCAGGAGGTGAGTGGCCGG + Intronic
1044336319 8:90987948-90987970 CACAGCAGGAGGTGAGTGGCAGG - Intergenic
1045249167 8:100468786-100468808 CACAGCAGGAGGTGAGTGGCAGG - Intergenic
1045891572 8:107164200-107164222 CACAGCAGGAGGTGAGTGTTGGG + Intergenic
1045946735 8:107805083-107805105 CACAGCAGGAGGTGAGTGGCAGG - Intergenic
1048140078 8:131785798-131785820 CACAGCAGGAGGTGAGTGACAGG - Intergenic
1048829978 8:138466341-138466363 GAGAGAAGTAGGTCAGTGGCAGG + Intronic
1049190045 8:141282277-141282299 GGCAGGAGGAGCATAGTGTCAGG - Intronic
1050057028 9:1666397-1666419 CACAGCAGGAGGTGAGTGGCAGG + Intergenic
1051147252 9:14040709-14040731 GGAAGAAGGAGCTTAATGTCAGG - Intergenic
1051678089 9:19578986-19579008 GAGAAAAGGAGGTTGGTGTGTGG + Intronic
1052390409 9:27872534-27872556 CACAGCAGGAGGTGAGTGGCAGG - Intergenic
1052652797 9:31325522-31325544 CACAGCAGGAGGTGAGTGGCTGG - Intergenic
1052668841 9:31529192-31529214 CACAGCAGGAGGTGAGTGGCGGG - Intergenic
1054075682 9:60526723-60526745 GACAACAGGAGGATAGTTTCTGG + Intergenic
1054981325 9:71210043-71210065 CACAGCAGGAGGTGAGCGTCAGG + Intronic
1055116865 9:72614216-72614238 GACACATGGAGGTCAGTGTTTGG + Intronic
1055657292 9:78463986-78464008 CACAGCAGGAGGTGAGTGGCAGG - Intergenic
1055729978 9:79270547-79270569 GAGAGAGGGGGTTTAGTGTCAGG + Intergenic
1056275074 9:84986503-84986525 CACAGCAGGAGGTGAGTGACAGG - Intronic
1057165179 9:92920080-92920102 GAGAGCAGGAGGTCTGTGTCTGG + Intergenic
1058155573 9:101511252-101511274 CACAGCAGGAGGTGAGTGGCAGG - Intronic
1058599574 9:106654506-106654528 GACAGAAGGAGGTTATGCTGAGG - Intergenic
1058864735 9:109151322-109151344 CACAGCAGGAGGTGAGTGGCAGG + Intronic
1061139573 9:128756707-128756729 GACAGAAGTAGGTTTGTGGTTGG + Intronic
1061919131 9:133772518-133772540 GACAGAAGGAGGTTAGTGTCTGG - Intronic
1185986264 X:4837883-4837905 CACAGCAGGAGGTAAGTGTCAGG + Intergenic
1186237792 X:7532215-7532237 CACAGCAGGAGGTGAGTGGCAGG - Intergenic
1186588055 X:10897941-10897963 CACAGCAGGAGGTGAGTGGCAGG - Intergenic
1186996686 X:15131196-15131218 CACAGAAGGAGGTGGGTGGCAGG + Intergenic
1188174988 X:26977995-26978017 CACAGCAGGAGGTGAGTGGCAGG - Intergenic
1188330441 X:28864697-28864719 AAAAGAAGGAGGCTAGTGTTGGG + Intronic
1188469208 X:30518321-30518343 CACAGCAGGAGGTGAGTGGCAGG - Intergenic
1188904271 X:35773531-35773553 CACAGCAGGAGGTGAGTGGCAGG + Intergenic
1189641927 X:43081941-43081963 CACAGCAGGAGGTGAGTGGCAGG + Intergenic
1189880202 X:45483151-45483173 CACAGCAGGAGGTGAGTGGCGGG - Intergenic
1190379033 X:49820094-49820116 GACAGCAGGAGGTGAGTGGTGGG + Intergenic
1190437041 X:50435825-50435847 GAGAGCAGGAGGAAAGTGTCAGG + Intronic
1191125238 X:56947249-56947271 AACAGAAGGATGTTATTTTCAGG - Intergenic
1191129133 X:56989568-56989590 CACAGCAGGAGGTGAGTGGCAGG + Intronic
1192557254 X:72100554-72100576 CACAGCAGGAGGTGAGTGGCAGG + Intergenic
1194278870 X:91922491-91922513 CACAGCAGGAGGTCAGTGGCGGG + Intronic
1194346278 X:92771080-92771102 GACAAGAGGAGGTTGGTGGCTGG + Intergenic
1195219187 X:102730358-102730380 CACAGCAGGAGGTGAGTGGCGGG - Intronic
1195423322 X:104699549-104699571 CACAGTAGGAGGTGAGTGGCGGG - Intronic
1196551841 X:117037613-117037635 GACTGAGGGAGATTAGGGTCAGG - Intergenic
1196614770 X:117755413-117755435 GAGAGAAGGAGGAGAGTGGCTGG + Intergenic
1196754453 X:119145579-119145601 CACAGCAGGAGGTGAGTGGCAGG + Intronic
1197549627 X:127873960-127873982 CACAGAAGGAGGTGAGTGGTGGG - Intergenic
1198427723 X:136536447-136536469 GACAGAAGGAAGCCAGTTTCTGG - Intronic
1198733338 X:139758454-139758476 CACAGCAGGAGGTGAGTGGCAGG + Intronic
1199079060 X:143556140-143556162 CACAGCAGGAGGTGAGTGTTTGG + Intergenic
1199282463 X:146018164-146018186 GCTAGAAGAAGGTTAGTCTCTGG - Intergenic
1200326442 X:155245214-155245236 GACAGGTGGAGGTTAGGGGCTGG - Intergenic
1200596349 Y:5145992-5146014 CACAGCAGGAGGTCAGTGGCGGG + Intronic
1201322138 Y:12711158-12711180 CACAGCAGAAGGTGAGTGTCAGG - Intronic
1201525877 Y:14933739-14933761 GGCAGAAGGAGGTGAATGGCAGG + Intergenic