ID: 1061919658

View in Genome Browser
Species Human (GRCh38)
Location 9:133775944-133775966
Sequence CAGGCACCACCCAGACCCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 222}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061919651_1061919658 0 Left 1061919651 9:133775921-133775943 CCTCCACCCTGCTGGGCCGCTCA 0: 1
1: 0
2: 0
3: 18
4: 257
Right 1061919658 9:133775944-133775966 CAGGCACCACCCAGACCCGGCGG 0: 1
1: 0
2: 2
3: 14
4: 222
1061919644_1061919658 28 Left 1061919644 9:133775893-133775915 CCTGGAGATGGCAACAGGCAGCC 0: 1
1: 0
2: 2
3: 31
4: 292
Right 1061919658 9:133775944-133775966 CAGGCACCACCCAGACCCGGCGG 0: 1
1: 0
2: 2
3: 14
4: 222
1061919643_1061919658 29 Left 1061919643 9:133775892-133775914 CCCTGGAGATGGCAACAGGCAGC 0: 1
1: 0
2: 1
3: 24
4: 253
Right 1061919658 9:133775944-133775966 CAGGCACCACCCAGACCCGGCGG 0: 1
1: 0
2: 2
3: 14
4: 222
1061919649_1061919658 7 Left 1061919649 9:133775914-133775936 CCTGGGGCCTCCACCCTGCTGGG 0: 1
1: 1
2: 4
3: 58
4: 586
Right 1061919658 9:133775944-133775966 CAGGCACCACCCAGACCCGGCGG 0: 1
1: 0
2: 2
3: 14
4: 222
1061919655_1061919658 -7 Left 1061919655 9:133775928-133775950 CCTGCTGGGCCGCTCACAGGCAC 0: 1
1: 0
2: 2
3: 9
4: 202
Right 1061919658 9:133775944-133775966 CAGGCACCACCCAGACCCGGCGG 0: 1
1: 0
2: 2
3: 14
4: 222
1061919654_1061919658 -6 Left 1061919654 9:133775927-133775949 CCCTGCTGGGCCGCTCACAGGCA 0: 1
1: 0
2: 1
3: 18
4: 185
Right 1061919658 9:133775944-133775966 CAGGCACCACCCAGACCCGGCGG 0: 1
1: 0
2: 2
3: 14
4: 222
1061919652_1061919658 -3 Left 1061919652 9:133775924-133775946 CCACCCTGCTGGGCCGCTCACAG 0: 1
1: 0
2: 3
3: 32
4: 994
Right 1061919658 9:133775944-133775966 CAGGCACCACCCAGACCCGGCGG 0: 1
1: 0
2: 2
3: 14
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061919658 Original CRISPR CAGGCACCACCCAGACCCGG CGG Intronic
900850765 1:5141139-5141161 CAAGCACCACCCAGACTCACTGG - Intergenic
901054764 1:6443991-6444013 CAGGCCCCACCCTTACCCCGAGG + Intronic
901777588 1:11570925-11570947 AAGGCTCCACCCTGAGCCGGAGG + Intergenic
902531869 1:17095869-17095891 CAGGCACCACCCTGAACCCAGGG - Intronic
902748714 1:18491303-18491325 CAGGCACCACCCACACCCTGGGG + Intergenic
903180788 1:21603796-21603818 CAGGCAGCCTCCAGAGCCGGCGG + Intronic
903416121 1:23184388-23184410 CAGGCATCACACAGACCGGGTGG - Intergenic
903571929 1:24311973-24311995 CAGGAACCAGCCAGAACAGGAGG - Intergenic
904423887 1:30410938-30410960 CAGGCATCACCCTGAGCTGGGGG + Intergenic
907490763 1:54807433-54807455 AAGCCACCACCCTGACCCGGAGG - Intronic
908394621 1:63714086-63714108 CAGGTACCAGCCACACCCTGAGG - Intergenic
908939138 1:69410591-69410613 CATGCACCATCCAGAGCCTGAGG + Intergenic
912686069 1:111766263-111766285 CAGGCACTACACAGGCCCTGGGG + Exonic
913671961 1:121105404-121105426 CAGTCACCAGCCAGACATGGTGG + Intergenic
914023736 1:143892849-143892871 CAGTCACCAGCCAGACATGGTGG + Intergenic
914662212 1:149800796-149800818 CAGTCACCAGCCAGACATGGTGG + Intronic
915600923 1:156922940-156922962 CAGGAGCCAGCCAGACCAGGGGG + Intronic
916132850 1:161626471-161626493 CACGTACCACCCAGATCCTGAGG + Intronic
916166223 1:161969501-161969523 CAGCCACCATCCAGGCTCGGGGG + Intergenic
916192393 1:162192131-162192153 CAGGCCCCACCCAGCACCTGTGG + Intronic
917749085 1:178038069-178038091 CAGCCACGACCCAACCCCGGCGG + Intergenic
919803771 1:201368783-201368805 CAGGCACAGCCCAGGCCAGGCGG - Intronic
920017741 1:202927183-202927205 GAAGCGCCGCCCAGACCCGGAGG + Exonic
920050626 1:203162560-203162582 AAGGCACCACCCAGAGTCAGTGG - Intronic
922791277 1:228312399-228312421 CAGACATCACCCAGACCAGGAGG - Intronic
922917772 1:229272037-229272059 CCTGCAGCACCCAGACCTGGAGG + Intronic
1062977329 10:1694490-1694512 CATGCACGACCCACAACCGGTGG + Intronic
1063035687 10:2284504-2284526 CAGCCACCACCCAGAATGGGGGG - Intergenic
1064234765 10:13563794-13563816 CAGGCACCAGCCAGGCGCAGTGG - Intergenic
1065881952 10:30044516-30044538 CAGGTACCCCCTAGACCGGGAGG + Intronic
1066630629 10:37456168-37456190 CAGGTATCAGCCAGGCCCGGTGG + Intergenic
1068773612 10:60848994-60849016 CAGGCCCCACTCAGACCTGCTGG - Intergenic
1069962629 10:72087686-72087708 CCGGCCCCACCCAGACCTGCCGG + Intronic
1071564311 10:86663755-86663777 AAGGCACCCCCCAGACCCCAGGG + Exonic
1075950965 10:126477426-126477448 CAGGTACCACGTAGACCCAGAGG - Intronic
1076344726 10:129772609-129772631 CGGGCACCACCCAGCCGGGGCGG + Intergenic
1076884273 10:133254472-133254494 TAGGCAGCCCCCAGCCCCGGAGG + Intergenic
1077395872 11:2320942-2320964 CAGTCTCCACCCAGGCCCAGGGG + Intergenic
1080458592 11:32435495-32435517 AAGGCAGCGCCCACACCCGGGGG - Exonic
1082806372 11:57454266-57454288 CAGCCAGCAGCCAGGCCCGGTGG + Intergenic
1084008033 11:66333486-66333508 CAGGGCCCACCCAGACAGGGAGG + Intronic
1084567550 11:69940003-69940025 CTGGCACCACCCACACCCCCTGG + Intergenic
1085254355 11:75164104-75164126 CAGGCCCCACCCAGCCACAGGGG + Intronic
1089273262 11:117315858-117315880 CCAGCACCACCCAGACTTGGGGG - Exonic
1090247219 11:125224964-125224986 CACCCAGCACCCAGACCCTGGGG - Intronic
1090356807 11:126146143-126146165 GAGGCAGCACCCAGAACAGGGGG - Intergenic
1096229700 12:49890044-49890066 CAGGCACCAGCCACACCCGAGGG - Intronic
1096967041 12:55636966-55636988 GAAGCACCACCCAGAACAGGGGG - Exonic
1100512968 12:95295445-95295467 CAGGCACCAGCCGGGCGCGGTGG - Intronic
1101748305 12:107561199-107561221 CAGCCACACCCCAGACCCTGGGG + Intronic
1103992395 12:124807950-124807972 GAGGGGACACCCAGACCCGGCGG + Intronic
1104053179 12:125209992-125210014 CAGGCAGCATCCAGACTCTGGGG + Intronic
1105000705 12:132688017-132688039 GAGGGCCCGCCCAGACCCGGGGG + Intronic
1105538958 13:21298113-21298135 GAGGCCGCGCCCAGACCCGGAGG + Intergenic
1106404991 13:29465590-29465612 GAGGCATCACCCAGACCCCAGGG - Intronic
1106574935 13:30965962-30965984 CAGGGACCAGACAGACCCAGTGG + Intronic
1113310027 13:109122106-109122128 CAGGCCCCACCCAGGACCTGTGG + Intronic
1113319654 13:109221280-109221302 CAGGCACCACCCAAAAGTGGAGG - Intergenic
1113767986 13:112892819-112892841 CGGGCCCCACTCAGACCCGCAGG - Intergenic
1118204928 14:63714094-63714116 CAGCAACCACCCAGATCCTGAGG + Intronic
1118745913 14:68773115-68773137 CACCCACCACCCAGAGTCGGTGG + Intergenic
1121016720 14:90553406-90553428 CAGGCATCCCCCAAACCCTGAGG - Intronic
1121274052 14:92656041-92656063 CAGGCACCGTGCAGACCAGGAGG + Intronic
1121455169 14:94034195-94034217 CAGGCAATATCCAGACACGGTGG - Intronic
1122309267 14:100784234-100784256 CAGGCCCCATCCAGGCCCAGGGG + Intergenic
1123035991 14:105472156-105472178 CAGGCCCCACCCAGCACCGGTGG - Intergenic
1123765819 15:23477606-23477628 CAGGTTCCACCCAGAGGCGGAGG - Intergenic
1128450257 15:67802015-67802037 CAGGCAGCACCCACACACTGCGG + Intronic
1128992434 15:72272323-72272345 CAGGCTTCACTCAGGCCCGGCGG - Intronic
1131574474 15:93572671-93572693 CAAGGACCACCCAGAGCCAGAGG - Intergenic
1132465117 16:73786-73808 CTGGTGCCACCCAGACCCAGAGG - Intronic
1132543838 16:524094-524116 CTGGCACCACACAGACCCCTGGG - Intergenic
1132657284 16:1046640-1046662 CAGGCACAGCCCAGAGCCAGGGG - Intergenic
1132758554 16:1497630-1497652 AGGGCACCACCCACACCCTGTGG - Intronic
1136004922 16:27322934-27322956 CAGGCTCCAACCTGACTCGGTGG - Intronic
1136275511 16:29177274-29177296 GAGGCACCGCCCAGAGCGGGTGG + Intergenic
1136448308 16:30337386-30337408 GACTCACCATCCAGACCCGGCGG + Intergenic
1140401130 16:74672642-74672664 CAGGCACCAGCCAGACCAGGGGG - Intronic
1142047564 16:87935445-87935467 GACTCACCATCCAGACCCGGCGG - Intronic
1142743196 17:1942317-1942339 CTGGCACCCCCCACACCCCGGGG - Intronic
1143018732 17:3905240-3905262 CAGCCACATCCCAGACCTGGGGG + Exonic
1143026273 17:3943674-3943696 CAGACACCACCCCGACCCCAGGG - Intronic
1145236822 17:21214256-21214278 CAGGCGGAAGCCAGACCCGGCGG + Exonic
1145312524 17:21708325-21708347 CAGCCACCAGCCACACCCAGGGG + Intergenic
1146588943 17:34110934-34110956 TAGGCACAAGCCAGACACGGTGG + Intronic
1147723963 17:42554977-42554999 CAGGGACCACACAGACCCAGGGG - Exonic
1148747151 17:49924768-49924790 CAGGAACCACCAAAGCCCGGCGG + Intergenic
1148888517 17:50790831-50790853 CAAGCACCATCCAGGCCCTGAGG - Intergenic
1149030229 17:52074036-52074058 CAGGCAATACCAAGACCCAGAGG - Intronic
1149412504 17:56423243-56423265 CACGCACCACACAGACACGTTGG + Intronic
1151724198 17:75875234-75875256 CCGGCACAACCCAGCCCCGCCGG + Intronic
1151945940 17:77319936-77319958 CAGCCACCGACCAGACCGGGCGG + Intronic
1152353235 17:79794845-79794867 CAGGCCCCCCCCAGAGCTGGGGG + Exonic
1152426958 17:80223197-80223219 CCGGCTCCACCCAGTCCCAGAGG - Intronic
1152565549 17:81098818-81098840 CGGTCCCCACCCTGACCCGGCGG - Intronic
1152575746 17:81140172-81140194 CAGTCACCAGCCAGGCCCGGTGG - Intronic
1152691400 17:81719740-81719762 CAGGCACCAGCCAGGCACGGTGG - Intronic
1152781176 17:82228072-82228094 CTGGCCCCTCCCGGACCCGGGGG - Intergenic
1153641872 18:7164506-7164528 CAGGCACCACCCTGTCCTCGTGG - Intergenic
1155188290 18:23406723-23406745 CAGGCAGCACTCAGAACCAGAGG - Intronic
1156016153 18:32549428-32549450 CAGGCACCACCACCACCTGGTGG + Intergenic
1156260609 18:35442306-35442328 CAGGCACCCACCAGTCCCAGGGG + Intergenic
1160506426 18:79429320-79429342 CGGTCACCATCCAGACCAGGTGG + Intronic
1160528939 18:79552514-79552536 CAGGCCCCACCCTCACCCAGAGG + Intergenic
1160985279 19:1835797-1835819 GAGGTACCACCCAGCCCCAGTGG + Intronic
1161102592 19:2428615-2428637 CAGACGCCACCCAGCCCTGGGGG - Exonic
1161169384 19:2805361-2805383 TGGGCTCCACCCAGACCCTGGGG + Intronic
1161217716 19:3102777-3102799 CAGGCACCAACCTGACGCAGGGG - Intronic
1161420117 19:4171891-4171913 CAGGCGCCACCCAGTCCAGCAGG - Exonic
1162100206 19:8334609-8334631 AGGCCACCACCCAGACCCCGTGG - Exonic
1163495702 19:17645490-17645512 CAGGAAGCACCCAGGCCAGGAGG - Intronic
1164637175 19:29800081-29800103 CATGCACCAGCCAGCCCCAGTGG - Intergenic
1165324879 19:35108791-35108813 CAGGCCCCATCCAGCCCCTGCGG - Intergenic
1165831013 19:38730329-38730351 CACGCCCGACGCAGACCCGGAGG - Exonic
1166305695 19:41935862-41935884 CAGGCTCCCCCCCCACCCGGCGG + Intergenic
1167787003 19:51645359-51645381 CAGGAAGGACCCAGACCCAGGGG + Intronic
925972220 2:9113620-9113642 CACCCAACACCCAGACCCCGAGG + Intergenic
926892719 2:17651642-17651664 CCGGCAGCACCAAGGCCCGGTGG + Intronic
929947378 2:46381363-46381385 CAGCCATCCCCCAGACCAGGAGG + Intronic
935184708 2:100721698-100721720 CAGGCAGCACTCAGAACCAGAGG - Intergenic
937144285 2:119629223-119629245 CAGGCACCATCCAGATCCTCTGG + Intronic
937912787 2:127083939-127083961 CAAACACGACTCAGACCCGGCGG - Intronic
938536274 2:132252368-132252390 CAGGCACAGCCCAGAGCTGGCGG + Intronic
947625870 2:231618282-231618304 CAGGCCCCACCCACACCCAATGG - Intergenic
947742825 2:232492643-232492665 CAGGTCCCACCCACACCCGCTGG + Intergenic
947912075 2:233808171-233808193 CAGGCCCCACACAGACCCACAGG + Intronic
948174747 2:235934352-235934374 CAGGCTCCACCCAGGCCTGCTGG + Intronic
948228609 2:236333481-236333503 GAGTCGCCACTCAGACCCGGTGG - Intronic
948263557 2:236621777-236621799 CAGGCATCAGCCAGATCCTGGGG - Intergenic
948929731 2:241124301-241124323 CAGGCAGCACCAAGGCCTGGAGG + Intronic
949040856 2:241849481-241849503 CAGGTACCACCCCTGCCCGGAGG + Intergenic
1171425167 20:25044338-25044360 CAGGCACCGGCCAGGCGCGGTGG + Intronic
1171847003 20:30283439-30283461 CAGGCAGCACCCCGACCCACGGG + Intergenic
1172109363 20:32536354-32536376 CGGGCCCCACCCAGGGCCGGGGG + Intronic
1172402260 20:34659526-34659548 CAGCCACCACCCAGTCTTGGAGG + Intronic
1174121742 20:48271049-48271071 AAGGCACCACCCTGGCCAGGAGG - Intergenic
1175103747 20:56599005-56599027 CAGGGACCACCCAGAACCCTGGG - Intergenic
1175367503 20:58466336-58466358 CGGGCTCCACCCAGACCTGAAGG + Intronic
1175652084 20:60734178-60734200 CAGGCTCCACCCAGGCCGGTTGG + Intergenic
1175915501 20:62424010-62424032 CAGCCCCCACCCAGGCCTGGAGG - Intronic
1176046270 20:63094428-63094450 CAGCCACAAACCAGACCCCGGGG + Intergenic
1176118012 20:63441611-63441633 CGGGCCCCACCCTGACCCTGTGG + Intronic
1176430975 21:6575448-6575470 CAGGCACAGCCCAGCCCAGGAGG - Intergenic
1178409465 21:32351593-32351615 CAGGCTCCACCCAGACCTGCCGG + Intronic
1179706369 21:43182910-43182932 CAGGCACAGCCCAGCCCAGGAGG - Intergenic
1179707306 21:43189012-43189034 CAAGATCCTCCCAGACCCGGTGG - Intergenic
1179884386 21:44307186-44307208 GCCTCACCACCCAGACCCGGGGG + Intronic
1180170423 21:46055441-46055463 CAGGCTCCTGCCGGACCCGGAGG + Intergenic
1180590380 22:16932168-16932190 CAGGAAACACCCAGACCAGAGGG - Intergenic
1180920996 22:19521622-19521644 CTGGTACTACCCAGTCCCGGTGG + Intergenic
1181977154 22:26738165-26738187 CAGGCTCCACCCAGACCTATAGG + Intergenic
1182759420 22:32710216-32710238 CAGGCCCCACCTAGACACTGGGG - Intronic
1183656120 22:39185662-39185684 CAGGCCCCACCCAGGCCTGCTGG - Intergenic
1184381089 22:44145374-44145396 CAGGGACCACCCTGACCTAGGGG - Intronic
1184411499 22:44328874-44328896 CAGCCACCTCCCAGACCCGCAGG + Intergenic
1184821006 22:46909356-46909378 CAGGCACCGCCCAGAGCAGGGGG - Intronic
1185021717 22:48380373-48380395 CAGGCCAGACCCAGAGCCGGGGG - Intergenic
950331383 3:12158752-12158774 CATGCCTCACCCAGCCCCGGGGG + Exonic
953518186 3:43617404-43617426 CAGGTTCCACACAGACCCTGGGG + Intronic
954393160 3:50278099-50278121 CAGCCACCACCAAGCCCCTGAGG + Intergenic
955081748 3:55664211-55664233 CAGGCTCCACCCAGACCTAATGG + Intronic
956647327 3:71469012-71469034 AAGGCAACACCCAGCGCCGGTGG - Intronic
961811258 3:129523201-129523223 CAGCCAACACCCAGACCCCTAGG + Intergenic
962454519 3:135552885-135552907 CAGGCACCACCCATTCCCAATGG - Intergenic
967141758 3:186567392-186567414 CCCGCACCACCGAGACCTGGCGG + Exonic
968144624 3:196287896-196287918 CAGCCTCCACCCGGAACCGGAGG + Intronic
968269793 3:197394609-197394631 GAGGCTCCACCCAGGCCCGGTGG - Intergenic
968549905 4:1216818-1216840 CCGGCCCCAGCCAGACACGGTGG - Intronic
968881442 4:3302322-3302344 CAGGCGCCAACCTGACCCTGCGG - Intronic
980357600 4:131739093-131739115 CAGGCAAAACCCAGTCCCGTTGG - Intergenic
985096386 4:186416831-186416853 CAGTCACGTCTCAGACCCGGAGG + Intergenic
985122777 4:186660616-186660638 CAGCCACACCCCAGCCCCGGCGG - Intronic
985493768 5:193389-193411 CAGGCACCCCCCAGCACCTGAGG - Intronic
985533479 5:447750-447772 CAGGTACCAGCCAGACGCCGAGG + Exonic
985619639 5:947465-947487 CAGGTACCTCCCAGCCCCGCAGG + Intergenic
985823795 5:2178515-2178537 CAGGCACCACCCATGCTGGGAGG - Intergenic
986711407 5:10490678-10490700 CAGGCCCCACCCAGAACCTAAGG - Intergenic
986721444 5:10563883-10563905 CCGGCCCCACCCAGGTCCGGGGG + Intergenic
988521126 5:31946437-31946459 TAGACCCCACCCAGACCCGCCGG - Intronic
990481757 5:56218425-56218447 CAGCCACCACCCAGATCAGTCGG + Intronic
992698200 5:79312102-79312124 CAGCAACCAGCCAGACACGGTGG - Intronic
997260940 5:132465139-132465161 CAGGCACTACCCAGGCACTGTGG - Intronic
997367266 5:133333982-133334004 CAGGCCCCACCCAGGTCCCGAGG + Intronic
997473339 5:134128821-134128843 GGAGCACCAGCCAGACCCGGTGG + Intronic
997702091 5:135909669-135909691 CAGGCACCACGCACACCCCAGGG + Intergenic
998184168 5:139966073-139966095 CAGGCACCACACTGACACTGGGG - Intronic
998347329 5:141476305-141476327 CAGACACCACCCGGAACCTGCGG - Exonic
999116716 5:149170499-149170521 CAGGCCCCACCCAAACCCCATGG + Intronic
1003595142 6:7468034-7468056 CAGGCCCCACCCAGACCTATTGG + Intergenic
1007729959 6:43939704-43939726 CTGGCAGCTCCCAGACCAGGAGG + Intergenic
1011635610 6:89369996-89370018 CAGGCACCAGGCACACCAGGAGG + Intronic
1013657706 6:112262711-112262733 CAGGCCCCATCCACACCAGGAGG - Intergenic
1014139128 6:117920229-117920251 CAGCCACCACCCAAGCCCCGAGG - Intronic
1015643558 6:135363783-135363805 CGGCCACCACCCCGTCCCGGAGG - Intronic
1015811739 6:137167698-137167720 CAGCCACCACCCAGGACCAGTGG + Intronic
1017941567 6:159057823-159057845 CAGGCTCTACCCAGATGCGGAGG + Intergenic
1019032560 6:169025152-169025174 CCGGCAGCACCGAGAACCGGCGG - Intergenic
1019032587 6:169025287-169025309 CCGGCAGCACCGAGAACCGGCGG - Intergenic
1019326723 7:442103-442125 CAGCCACCACCCAGCCCTTGGGG + Intergenic
1019378312 7:708014-708036 CCAGCACCACCCAGAGCCAGGGG + Intronic
1019378339 7:708126-708148 CCAGAACCACCCAGAGCCGGGGG + Intronic
1022494409 7:30844091-30844113 CAAGCAGCACCCAGTCCAGGGGG - Intronic
1025058822 7:55786797-55786819 CAGGGACCACCAAGAGCTGGCGG + Intergenic
1029435513 7:100562090-100562112 CAGGGACCACCCAGTTCAGGAGG - Intronic
1030741613 7:113116392-113116414 CAGGCCCCACCCAGACCAATTGG - Intergenic
1033667114 7:143452016-143452038 CAGGCACCAGCCATACCAGCTGG + Intergenic
1035091761 7:156318925-156318947 CAGGCACAACCATGACACGGAGG + Intergenic
1035159281 7:156939304-156939326 CAGGCCCTCCCCAGACCCTGAGG - Intergenic
1036205857 8:6805374-6805396 ACAGCACCGCCCAGACCCGGGGG + Intergenic
1036744003 8:11391181-11391203 CAGACCCCACCCAGACCTGCTGG + Intronic
1036912199 8:12766669-12766691 CAGGCAACACCCAGAACAAGTGG + Intergenic
1037039674 8:14215959-14215981 CAGGCCCCTCACAGACCCTGAGG + Intronic
1037827130 8:22166057-22166079 CAGCCACCACCCAGCCCAAGTGG + Intronic
1038059605 8:23898063-23898085 CAGGCATCACTCAGCCCTGGAGG - Intergenic
1040284034 8:46091033-46091055 ATGGCACTACCTAGACCCGGTGG - Intergenic
1042611593 8:70607582-70607604 CCGGCACTCCTCAGACCCGGGGG + Intronic
1044840535 8:96333221-96333243 CAGGAACCACCCAGACTTTGGGG + Intronic
1048827304 8:138440850-138440872 CAGTTACCACCCAGACCAAGGGG - Intronic
1048899100 8:139021079-139021101 CAGGCACCACGCAGAGATGGAGG - Intergenic
1048949845 8:139487245-139487267 CAGGCTCCAGCCAGACTCAGTGG + Intergenic
1049164491 8:141117738-141117760 CAGGCACCTCCCTGACCCCTGGG - Intronic
1049209057 8:141376995-141377017 CAGACCCCAGCCAGACCTGGGGG + Intergenic
1049423407 8:142526675-142526697 CAGAGCCCACCCAGCCCCGGGGG + Intronic
1049457501 8:142700972-142700994 CAGGCCCAACCCAGACCCAAGGG + Intronic
1049741902 8:144244932-144244954 CAGACACAACCCAGCCCAGGTGG - Intronic
1053510021 9:38679795-38679817 CAGGCAACACTCAGGCCTGGAGG - Intergenic
1059246519 9:112854307-112854329 CAGGAATCACCCAGACCCGCAGG - Intronic
1059444156 9:114327842-114327864 CCGGCCTCACCCAGACCTGGGGG + Intergenic
1060555776 9:124506589-124506611 CAGCCCCCACCCAACCCCGGCGG - Intronic
1061919658 9:133775944-133775966 CAGGCACCACCCAGACCCGGCGG + Intronic
1203783427 EBV:114086-114108 CAGGCACCACCCCGTCCCAGTGG + Intergenic
1185447697 X:268167-268189 CAGGCCCCACCCACACTGGGTGG - Intergenic
1186878109 X:13837460-13837482 CAGGCAGCCCGCAGACCCAGGGG + Intronic
1187607244 X:20898950-20898972 CAGGAACCAGCCAGACATGGTGG - Intergenic
1190968205 X:55323163-55323185 CAGGACCAACCCAGACCCAGTGG - Intergenic
1192235612 X:69293804-69293826 TAGGGACCACCCAGACCTGCAGG - Intergenic
1192758490 X:74070504-74070526 CAGGACCAACCCAGACTCGGGGG + Intergenic
1196962044 X:121014178-121014200 CTGGATCCACCCAGACCTGGGGG - Intergenic
1200111432 X:153742934-153742956 CCACCAGCACCCAGACCCGGGGG - Intronic