ID: 1061920447

View in Genome Browser
Species Human (GRCh38)
Location 9:133779696-133779718
Sequence ATAAGGCAGCACCAGGCTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 200}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061920447_1061920451 4 Left 1061920447 9:133779696-133779718 CCTACAGCCTGGTGCTGCCTTAT 0: 1
1: 0
2: 1
3: 15
4: 200
Right 1061920451 9:133779723-133779745 AACAGAGCCACCTCCCAAGGAGG 0: 1
1: 0
2: 1
3: 13
4: 156
1061920447_1061920450 1 Left 1061920447 9:133779696-133779718 CCTACAGCCTGGTGCTGCCTTAT 0: 1
1: 0
2: 1
3: 15
4: 200
Right 1061920450 9:133779720-133779742 AGAAACAGAGCCACCTCCCAAGG 0: 1
1: 0
2: 4
3: 32
4: 298
1061920447_1061920457 24 Left 1061920447 9:133779696-133779718 CCTACAGCCTGGTGCTGCCTTAT 0: 1
1: 0
2: 1
3: 15
4: 200
Right 1061920457 9:133779743-133779765 AGGTGCCATAGAGGCCAGAGAGG 0: 1
1: 0
2: 1
3: 34
4: 249
1061920447_1061920454 15 Left 1061920447 9:133779696-133779718 CCTACAGCCTGGTGCTGCCTTAT 0: 1
1: 0
2: 1
3: 15
4: 200
Right 1061920454 9:133779734-133779756 CTCCCAAGGAGGTGCCATAGAGG 0: 1
1: 0
2: 1
3: 18
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061920447 Original CRISPR ATAAGGCAGCACCAGGCTGT AGG (reversed) Intronic