ID: 1061921020

View in Genome Browser
Species Human (GRCh38)
Location 9:133782553-133782575
Sequence GAGCTGTGATTTTAGATCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 173}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061921020_1061921021 -9 Left 1061921020 9:133782553-133782575 CCATTGATCTAAAATCACAGCTC 0: 1
1: 0
2: 0
3: 17
4: 173
Right 1061921021 9:133782567-133782589 TCACAGCTCAAAATGTATTCTGG No data
1061921020_1061921025 8 Left 1061921020 9:133782553-133782575 CCATTGATCTAAAATCACAGCTC 0: 1
1: 0
2: 0
3: 17
4: 173
Right 1061921025 9:133782584-133782606 TTCTGGGCAATGGCGTCTCTGGG No data
1061921020_1061921026 21 Left 1061921020 9:133782553-133782575 CCATTGATCTAAAATCACAGCTC 0: 1
1: 0
2: 0
3: 17
4: 173
Right 1061921026 9:133782597-133782619 CGTCTCTGGGTGACAATCTCTGG No data
1061921020_1061921022 -8 Left 1061921020 9:133782553-133782575 CCATTGATCTAAAATCACAGCTC 0: 1
1: 0
2: 0
3: 17
4: 173
Right 1061921022 9:133782568-133782590 CACAGCTCAAAATGTATTCTGGG No data
1061921020_1061921023 -2 Left 1061921020 9:133782553-133782575 CCATTGATCTAAAATCACAGCTC 0: 1
1: 0
2: 0
3: 17
4: 173
Right 1061921023 9:133782574-133782596 TCAAAATGTATTCTGGGCAATGG No data
1061921020_1061921024 7 Left 1061921020 9:133782553-133782575 CCATTGATCTAAAATCACAGCTC 0: 1
1: 0
2: 0
3: 17
4: 173
Right 1061921024 9:133782583-133782605 ATTCTGGGCAATGGCGTCTCTGG No data
1061921020_1061921027 22 Left 1061921020 9:133782553-133782575 CCATTGATCTAAAATCACAGCTC 0: 1
1: 0
2: 0
3: 17
4: 173
Right 1061921027 9:133782598-133782620 GTCTCTGGGTGACAATCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061921020 Original CRISPR GAGCTGTGATTTTAGATCAA TGG (reversed) Intronic
901899070 1:12342493-12342515 GAAATGTGATTTCAAATCAATGG - Intronic
901971920 1:12914913-12914935 GAGCTGAGATCTTGGATGAATGG + Intronic
902013248 1:13286827-13286849 GAGCTGAGATCTTGGATGAATGG - Intergenic
904972755 1:34431940-34431962 GAGCTCTGGTTTTCCATCAAAGG + Intergenic
907288955 1:53400450-53400472 CAGCTGTGGTATTATATCAATGG + Intergenic
907560829 1:55385952-55385974 GAGGTGTGATTTTACATATATGG + Intergenic
908681950 1:66672064-66672086 GAGCTGAGAGTTTAGCTCAAAGG - Intronic
908887863 1:68810685-68810707 CAGCTGTGTTTTTAGATGATAGG + Intergenic
908897628 1:68918261-68918283 GGCCTGGCATTTTAGATCAAAGG + Intergenic
910025575 1:82647087-82647109 GAGCTGTGAATATAGATGAGGGG - Intergenic
910595790 1:88978955-88978977 GAGTTGTGATTTTTGCTAAAGGG + Intronic
913693045 1:121297737-121297759 GCTGTGTGATTTTAGATGAAAGG + Intronic
914144511 1:144982344-144982366 GCTGTGTGATTTTAGATGAAAGG - Intronic
914269534 1:146067703-146067725 GAACTGTGATTTTGACTCAAGGG - Intronic
914532367 1:148534384-148534406 GAACTGTGATTTTGACTCAAGGG - Intronic
915478796 1:156170945-156170967 GTGCTGGGATTATAGGTCAAAGG - Intronic
916829933 1:168480668-168480690 GAAATGTGATTTTACATCTATGG - Intergenic
916836646 1:168552881-168552903 GAGCTCTAATTTTAGTTGAATGG + Intergenic
917039461 1:170788285-170788307 AAGCTTTTATTTTAGATTAAGGG - Intergenic
919925459 1:202189687-202189709 GAGCTGTGATTCTGAATCCAGGG - Intergenic
920480367 1:206316106-206316128 GCTGTGTGATTTTAGATGAAAGG + Intronic
920857994 1:209678744-209678766 GAGCAGTGATTGTAAATGAAAGG + Intergenic
921750445 1:218786377-218786399 GAGCTGTTATTTTAAAACCAAGG - Intergenic
923572259 1:235127035-235127057 GAGCTATCATTTTAGACAAATGG - Intronic
924008335 1:239637164-239637186 GACCTGTAATTCTTGATCAATGG + Intronic
924446097 1:244132951-244132973 GAGGTGTGATTACAGAGCAAGGG + Intergenic
924530979 1:244893552-244893574 GAGCTCTGAATGAAGATCAATGG + Intergenic
924746997 1:246845108-246845130 GAACTGTGATTTTATTTCAAGGG - Intronic
1065270508 10:24028188-24028210 AAGCTGAGATTTCAGATCTATGG + Intronic
1069180912 10:65357481-65357503 AAGCTTTGACTTTACATCAAAGG - Intergenic
1073263363 10:102207470-102207492 GAGCTGTGACCTTTGGTCAAGGG - Intergenic
1074534776 10:114320891-114320913 GGGCTGTGATTTCAGACCAAAGG - Intronic
1075637266 10:124037722-124037744 CAGCTTTGCTTTAAGATCAAGGG - Intronic
1075900000 10:126034202-126034224 GAGCAGTGGTTTTCAATCAAGGG + Intronic
1082050227 11:47765467-47765489 GAGCTGAAATGTTAAATCAAAGG - Intronic
1083497515 11:63070394-63070416 CAGCTTTTATTTTAGATAAAAGG - Intergenic
1086383991 11:86288496-86288518 GAGCTAACATTTTAGAGCAAAGG - Intergenic
1087366319 11:97224271-97224293 GACAAATGATTTTAGATCAAAGG - Intergenic
1089044407 11:115486923-115486945 GAGCTGAGATTTCAGATCACGGG - Intronic
1090135512 11:124194612-124194634 TAGCTGTGCATTTAGATAAAGGG + Intergenic
1090586372 11:128217353-128217375 TAGGTGTGATGTTAGATAAAGGG + Intergenic
1090991011 11:131816808-131816830 GAGTTGAGGTTTTAGGTCAAGGG + Intronic
1091413028 12:256803-256825 GAGCTGTGAATTTAAAGAAAGGG + Intronic
1093660539 12:21751438-21751460 CAGCTGTGATTTTGGATGATGGG + Intronic
1094662736 12:32486323-32486345 GTGCTGTGGTTTTAGCACAAAGG + Intronic
1094702492 12:32883619-32883641 GAGGTGTGATTCTATTTCAAAGG + Intronic
1095519624 12:43047468-43047490 GAACTGTGTTTGTAGAGCAAGGG - Intergenic
1098028002 12:66225788-66225810 AATCTGTGATTTAAAATCAATGG + Intronic
1101632008 12:106504289-106504311 GAGCTGTGATTTAAGAGGCAAGG - Intronic
1103041478 12:117699000-117699022 GAGCTGCTCTTTTAGATGAAGGG - Intronic
1104375695 12:128264435-128264457 AACTTGTGATTTTAGTTCAAAGG - Intergenic
1104771027 12:131364450-131364472 GAGCTGTGATTTTACACGAGTGG - Intergenic
1105498820 13:20953665-20953687 GAGATAAGATTTAAGATCAAAGG + Intergenic
1105641952 13:22275045-22275067 GAACTGTAATTTGAGATCAGTGG + Intergenic
1105886625 13:24648354-24648376 GAGCTGAGACTTTAGCTAAAAGG - Intergenic
1109159595 13:58956043-58956065 GTGCTGATATTTTAGAGCAAAGG - Intergenic
1109349111 13:61154043-61154065 GAGATGTGATTATAGAAGAATGG + Intergenic
1112596859 13:100815353-100815375 GAGCTGTGCTGTTGGAACAAAGG + Intergenic
1116331636 14:43604113-43604135 GAGCTGTGACTTTTTAGCAAAGG + Intergenic
1117732147 14:58733880-58733902 GAGCTGCTTTCTTAGATCAAAGG + Intergenic
1118228213 14:63922895-63922917 GTGCTGTGATTATAAATCCAGGG - Intronic
1123727685 15:23120932-23120954 GAGCTCTCATTTTATTTCAATGG + Intergenic
1124531629 15:30513315-30513337 GAGCTCTCATTTTATTTCAACGG + Intergenic
1124579795 15:30943553-30943575 GGTCTGTGATTTGAGATCACTGG - Intronic
1124767029 15:32494379-32494401 GAGCTCTCATTTTATTTCAACGG - Intergenic
1126357122 15:47808373-47808395 GAGCTGAGATTTGAAACCAATGG - Intergenic
1126426393 15:48531109-48531131 TAGCTGTGATTTGAGAAAAAAGG - Intronic
1127095977 15:55512641-55512663 GAACTGTGATGGGAGATCAATGG - Intergenic
1127346148 15:58101275-58101297 CAACTTTTATTTTAGATCAAGGG - Intronic
1127697444 15:61464467-61464489 AAGCTGTGAATTTAGCTGAAAGG + Intergenic
1129556331 15:76513901-76513923 GAGCTTTGATTTTAGTTGAGGGG - Intronic
1129828225 15:78649589-78649611 TAATTGTGACTTTAGATCAAGGG - Intronic
1131294918 15:91139437-91139459 CAGCTCTGGTTTTAGCTCAAGGG - Intronic
1131739586 15:95373508-95373530 GATCTGGGATTTTAGAGCAAGGG - Intergenic
1136171469 16:28492241-28492263 GAGCCGTGACCTTAGATCAGTGG + Intronic
1145113513 17:20186830-20186852 GTGCTGGGATTATAGATCATAGG + Intronic
1147050982 17:37794697-37794719 GAGCTGAGATTTAAAACCAAAGG - Intergenic
1148957245 17:51364000-51364022 GACCAGTTATTTTGGATCAAGGG + Intergenic
1149086776 17:52727380-52727402 CAGCTGTGATCTTAGATGAATGG - Intergenic
1153879931 18:9413041-9413063 GAGCTGAGATTCTTGATAAAAGG - Intergenic
1156941920 18:42778099-42778121 CTGCTGTGCTTTTAGAGCAAAGG + Intronic
1157557951 18:48625115-48625137 GAGATGGGATTTTAGAAAAAGGG - Intronic
1159333010 18:67025715-67025737 GTGGTGTGATTTTATATTAATGG + Intergenic
1163078632 19:14919170-14919192 TATCTATGATTTTATATCAAAGG + Intergenic
929043074 2:37764618-37764640 GAAATGTGATTTTAAATAAAAGG - Intergenic
930063949 2:47313311-47313333 GAGCTGTGATATTAGCCCCATGG - Intergenic
932569651 2:72931841-72931863 GAGCACTGATTTTAGAGCACTGG - Intronic
933010611 2:77057606-77057628 CAGCTGGGATTTTAAATCACTGG - Intronic
936854008 2:116935199-116935221 CAGGTGGGATTTTAGAACAAGGG - Intergenic
937007373 2:118529504-118529526 GCGCTGTGATTTGAGGTCAATGG - Intergenic
938344510 2:130557530-130557552 GGGCTGTGATTTTAGGTCCCGGG - Intergenic
938345323 2:130563192-130563214 GGGCTGTGATTTTAGGTCCCGGG + Intergenic
938614412 2:132982519-132982541 CAGCTTTTATTTTAGATCCAGGG + Intronic
940585015 2:155636714-155636736 GAGGTGTGATTTTAAACTAAAGG - Intergenic
941278053 2:163515942-163515964 GAGCTGTAAACTTATATCAAGGG + Intergenic
941820316 2:169837882-169837904 GAGGTGACATTATAGATCAATGG - Intronic
944987984 2:205200967-205200989 GTTCTGTGTTTTCAGATCAAAGG + Intronic
946612673 2:221476245-221476267 GAGTTGTGGTCTGAGATCAAAGG - Intronic
946902185 2:224383415-224383437 GAGCTGTGGAATTAGAGCAAAGG - Intronic
1170152730 20:13242272-13242294 AAGCTGGGCTTTTAGATGAACGG + Intronic
1171102441 20:22398039-22398061 GAGCTGTAATTTGAGGTGAAAGG - Intergenic
1174532174 20:51222675-51222697 GAGCTGGGATTTGAAACCAAAGG - Intergenic
1175622461 20:60460424-60460446 GAGCTTTGATTTTTCATGAATGG - Intergenic
1175673005 20:60921962-60921984 GAGCTGTTATTTTAGCTAGAGGG + Intergenic
1177509374 21:22064181-22064203 GAGCTGTGTTTTAAAATCTATGG - Intergenic
1182946400 22:34326659-34326681 GAGATTTGATTTTAGATAAAAGG - Intergenic
1184956113 22:47887442-47887464 GAGATGTGATTTAAGATTTAAGG + Intergenic
1185011578 22:48317553-48317575 GAGCTGACATTGTAGATAAATGG + Intergenic
1203295247 22_KI270736v1_random:36109-36131 GAAATGTGATTTTAAATAAAAGG - Intergenic
949297464 3:2542361-2542383 GAGTTGTGATTTAAGGCCAAAGG + Intronic
950362699 3:12461097-12461119 GGGCTCTGATTTTAGAAGAAGGG + Intergenic
950457944 3:13103682-13103704 CAGCTGTGATTTCAGAGCAGGGG + Intergenic
950994127 3:17476408-17476430 GAGCTGAAATTATAGATCAGTGG - Intronic
953486659 3:43304926-43304948 GAGCGGAGATTTTTGATTAATGG + Intronic
955662910 3:61320099-61320121 GAACTGTGATTTTAAATTAGAGG + Intergenic
956027357 3:64997583-64997605 GAGCTGTGGTTCTCGATCAGAGG + Intergenic
956027931 3:65003489-65003511 GAGCTGTGGTTCTCGATCAGAGG - Intergenic
957131461 3:76227695-76227717 AAGGTGTGATTTAAGACCAACGG + Intronic
961870044 3:129980830-129980852 GAGCTGTGATTATTCATGAAGGG + Intergenic
962360354 3:134737030-134737052 GAGGTGACATTTTTGATCAATGG + Intronic
963393634 3:144703241-144703263 GGGATGTGATTATAAATCAAAGG + Intergenic
963873271 3:150442996-150443018 GAGATGTGATATTAAATAAAAGG - Intronic
964671414 3:159229927-159229949 CAGCTTTGATTTTAGATACAGGG + Intronic
965765231 3:172123541-172123563 GAGTTGTCATTCTAGTTCAAGGG + Intronic
968106054 3:196001947-196001969 GAGCTGAGGTTCTAGATTAAGGG - Intergenic
970040525 4:11792306-11792328 GAGAAGTGAGTTTGGATCAAAGG - Intergenic
970555799 4:17231328-17231350 GAGATGGGATTTAAGATGAAAGG + Intergenic
972429828 4:38970085-38970107 GAGCTGTGACATTTGGTCAAGGG - Intronic
972710920 4:41593848-41593870 AAGCAGTGAATCTAGATCAAGGG - Intronic
972980016 4:44686111-44686133 GAACTGTTATTTTAGCTTAATGG + Intronic
973018041 4:45166095-45166117 GAGATGTGGTTATAGATCACTGG - Intergenic
973698124 4:53511064-53511086 CAGCTGTGATATGAGACCAAAGG - Intronic
976144423 4:82027813-82027835 GAGCTGTGATCTTAGGTAGAGGG + Intronic
979979166 4:127233646-127233668 AAGCTGTGCTATTAGATCCAAGG - Intergenic
981565821 4:146100329-146100351 CAGCTTTTATTTTAGATTAACGG + Intergenic
981612617 4:146611426-146611448 TAGCTGTCATTTTAGAAAAAAGG + Intergenic
981853788 4:149262909-149262931 GAGATGAGCTCTTAGATCAAAGG - Intergenic
983255753 4:165398564-165398586 TAGCCCTGATTTTAGGTCAATGG + Intronic
983941293 4:173537087-173537109 GAACCGTGAATTTAGACCAAAGG - Intergenic
984021828 4:174494864-174494886 GAGCTTGGATTTTATTTCAAGGG - Intronic
986068578 5:4260303-4260325 GAACTGTGATTTTAGTAGAACGG + Intergenic
987021071 5:13872064-13872086 GAGCTGTGGTTTTTGATCTAAGG - Intronic
988487407 5:31678320-31678342 GAGTTGTGATCTGAGATCCAAGG + Intronic
988869858 5:35377198-35377220 GAGCTGGGATTTTGAAGCAAGGG - Intergenic
989265408 5:39467576-39467598 GAGATGTGATTGAAGAACAATGG + Intergenic
990466875 5:56078991-56079013 TAGCTGTGTGTTTAGATCAGAGG + Intergenic
990805949 5:59662046-59662068 AGTCTGTCATTTTAGATCAAAGG + Intronic
994667157 5:102719349-102719371 GAGCAGTGATTCTTGACCAAGGG + Intergenic
994978919 5:106846836-106846858 GATCTAACATTTTAGATCAATGG - Intergenic
995345476 5:111111109-111111131 GAGGTGAGATTTTAGTTCAAGGG + Intronic
995733292 5:115269412-115269434 GAACCTTTATTTTAGATCAATGG - Intronic
999079768 5:148832030-148832052 GAGCTAGCATTCTAGATCAAAGG + Intergenic
1000628660 5:163567217-163567239 GGGCTGTGGTTTTCAATCAATGG - Intergenic
1001941791 5:175745033-175745055 CAGCTTTTATTTTAGACCAAGGG + Intergenic
1003396222 6:5754663-5754685 AAGCTGTTATTTTAGAACACTGG - Intronic
1004755370 6:18604868-18604890 GGGCTATGATTGCAGATCAAAGG + Intergenic
1008784341 6:55147578-55147600 GAACTGAGATTTTAACTCAAGGG + Intronic
1015361579 6:132345726-132345748 GAGCTGTGTTTCTAGAACAACGG + Intronic
1015493711 6:133857747-133857769 TAGCTGATATTTTAGATCAATGG - Intergenic
1018510514 6:164519868-164519890 CAGCTGTGGTCTCAGATCAAAGG + Intergenic
1018803158 6:167238790-167238812 GAGCTGAGAAGTTAGAACAAAGG - Intergenic
1020252430 7:6480288-6480310 AAGCGGTGGTTTTAGATGAAGGG - Intronic
1022049548 7:26652182-26652204 GAGCTGGATTTTTGGATCAATGG + Intergenic
1027522054 7:79221476-79221498 CTGCTGTCATTTTATATCAAAGG + Intronic
1028936158 7:96466225-96466247 GAGCTGAGAATTTATCTCAAGGG - Intergenic
1029486388 7:100844968-100844990 GAGCTGTAATAGGAGATCAATGG + Intronic
1030305852 7:108018417-108018439 GAGCTGTGATCTTTGGACAAGGG - Intergenic
1033153358 7:138935800-138935822 AAGCTTTTATTTTATATCAAGGG + Intronic
1035877966 8:3212082-3212104 GACCTGTAATGCTAGATCAAAGG + Intronic
1038007628 8:23446259-23446281 GAGTTGTCCTTTTAGAACAAAGG - Intronic
1038089962 8:24241692-24241714 GAACTGTGATAGAAGATCAATGG + Intergenic
1039758076 8:40544148-40544170 GAGCTGGGATTTTCAAGCAAAGG + Intronic
1049045257 8:140145478-140145500 GAGCTGTTATTATAAATAAATGG + Intronic
1055319385 9:75067546-75067568 GAGATGAGATTTTAGAGCAAGGG + Intronic
1056796910 9:89664908-89664930 GGGCTGTGTTTTTAGAGCAAAGG - Intergenic
1057076086 9:92138867-92138889 GAGCTGTGATTCTGAATCCAGGG - Intergenic
1057720574 9:97528638-97528660 GTGCTGTGATTTCAGAGCATGGG - Intronic
1058379105 9:104359165-104359187 GAACTGTGAATTAAGACCAATGG + Intergenic
1059266938 9:113042854-113042876 AAGCTGTGATTTTGCATTAAAGG + Exonic
1060579047 9:124727131-124727153 GAGCTTTCATTTTAGACGAATGG - Intronic
1061921020 9:133782553-133782575 GAGCTGTGATTTTAGATCAATGG - Intronic
1188807043 X:34604479-34604501 GAGCAGTGATTTCTTATCAAGGG + Intergenic
1188864074 X:35292821-35292843 GAGCTGTGATGTTTGCTCAGTGG + Intergenic
1188963985 X:36528022-36528044 GAGCTGTGATGTTTGCTCAGTGG - Intergenic
1189244648 X:39554143-39554165 GGGCTGTGATTTTAAGTCAGGGG + Intergenic
1191903137 X:66059184-66059206 TAGATGTGATTTTAGAACAATGG - Intergenic
1195298579 X:103504314-103504336 CAGCTTTTATTTTAGATCCAGGG - Intronic
1195597159 X:106705043-106705065 GAGCTATGATTGTAGATCACAGG + Intronic
1199405216 X:147449603-147449625 GAGCAGTGGTTATAAATCAATGG - Intergenic
1199813419 X:151373516-151373538 GAGCTGTTTTTTTAGATCATTGG + Intergenic
1201297168 Y:12473828-12473850 GAACTGTGATGGGAGATCAATGG - Intergenic