ID: 1061924501

View in Genome Browser
Species Human (GRCh38)
Location 9:133799316-133799338
Sequence CGCAGCGCTGGGAGGGTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 185}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061924501_1061924511 8 Left 1061924501 9:133799316-133799338 CCTGACACCCTCCCAGCGCTGCG 0: 1
1: 0
2: 0
3: 14
4: 185
Right 1061924511 9:133799347-133799369 CCAGTGACTGGTACTTCCTCAGG No data
1061924501_1061924509 -4 Left 1061924501 9:133799316-133799338 CCTGACACCCTCCCAGCGCTGCG 0: 1
1: 0
2: 0
3: 14
4: 185
Right 1061924509 9:133799335-133799357 TGCGCGTGGGGTCCAGTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061924501 Original CRISPR CGCAGCGCTGGGAGGGTGTC AGG (reversed) Intronic
900203283 1:1420663-1420685 CCCAGCGCTGGGTGGGCGGCAGG - Intronic
901881981 1:12199372-12199394 CCCAGCCCAGGGAGGGTGTGGGG + Intronic
902515217 1:16986362-16986384 CAAAGGGCAGGGAGGGTGTCAGG + Intronic
902531581 1:17094072-17094094 CGGAGCACTAGGAGCGTGTCTGG - Intronic
902777634 1:18684826-18684848 AGCAGGGGTGGGAGGGTTTCCGG + Intronic
904481060 1:30793583-30793605 AGCAGCGGTGGGAGGGGGTGGGG + Intergenic
905016608 1:34782332-34782354 GGCAGCCATGGGAGTGTGTCAGG + Intronic
906703462 1:47876695-47876717 AGCAGTGCTGGGAGGGGTTCCGG + Intronic
907091447 1:51729598-51729620 CGCAGCGGCGGGAGGGCGTCCGG - Intronic
907300494 1:53483798-53483820 TGCAGAGGTGGGAGGGGGTCAGG + Intergenic
915523842 1:156464361-156464383 GGGAGGGCTGGGAGGGGGTCAGG + Exonic
916128822 1:161593591-161593613 AGCAGCGGTGGGAGGATGGCCGG + Intronic
916750961 1:167722292-167722314 CGCCGCGATGGGCGTGTGTCGGG - Intronic
917064304 1:171075091-171075113 TGCAGAGCTGGGCAGGTGTCTGG - Intergenic
920336546 1:205248981-205249003 GGCAGAGCTGGGAGGGCTTCTGG + Intronic
923261483 1:232272265-232272287 CGCAGCCCTGGGTGGGCGGCTGG + Intergenic
1067103821 10:43351617-43351639 CCCAGCGCTGGGCAGGGGTCTGG - Intergenic
1070162357 10:73874073-73874095 GGCAGCGTTGGGAGGTGGTCGGG + Intronic
1072548403 10:96458001-96458023 CCCAGCTCTGGGACGGTGCCTGG + Intronic
1073217194 10:101843242-101843264 CACAGGGCTGAGAGGGTGTCTGG - Intronic
1073495509 10:103887444-103887466 CTCAGTGCTGGGAGGGAGTCTGG + Intronic
1074457657 10:113609494-113609516 CTCACCCCTGGGAGGGTGACAGG - Intronic
1075590374 10:123686907-123686929 CACAGAGCTGGGAGAGAGTCTGG - Intronic
1076688704 10:132209707-132209729 CTCAGCGCTGGCATGGTGTGGGG + Intronic
1077024831 11:434486-434508 CGCAGCACTGGGAGTGTGCAGGG - Intronic
1077887415 11:6395935-6395957 GGCAGTGCTGGGAGAGTGTCGGG - Exonic
1078620476 11:12902644-12902666 CGCAGCGCTAGCAGGTTATCTGG - Intronic
1083658679 11:64242156-64242178 AGCAGCGGGGGGAGGGGGTCAGG - Exonic
1083945682 11:65921333-65921355 CGAAGGGCAGGAAGGGTGTCGGG - Exonic
1084028750 11:66468313-66468335 GGCTGCGTTGGGTGGGTGTCTGG - Intronic
1084114305 11:67032965-67032987 CTCAGTGCTGGGAGGGCGTCAGG + Intronic
1087077795 11:94141882-94141904 CGAAGCACTGGAACGGTGTCTGG + Intronic
1087659111 11:100964995-100965017 CGCAGGGCTGGGAAGGACTCGGG + Intronic
1089346184 11:117793189-117793211 AGCAGCGATGGCAGGGTGCCAGG - Intronic
1090994193 11:131850482-131850504 CACAGAGCTGGGAGGCTTTCGGG + Intronic
1096116882 12:49060188-49060210 CCCGGCGCTGGGTGTGTGTCAGG - Intergenic
1096460330 12:51818624-51818646 CCCCTGGCTGGGAGGGTGTCTGG - Intergenic
1096762579 12:53854764-53854786 CCCAGCTCTGGGAGGTGGTCTGG - Intergenic
1104019145 12:124980286-124980308 CACAGTGCAGGGCGGGTGTCTGG - Intronic
1104131747 12:125900364-125900386 CTCAGCCCTGGGCAGGTGTCAGG - Intergenic
1105454924 13:20531521-20531543 CGCAGGGCTGGGGAGGTCTCAGG - Intergenic
1106096567 13:26650325-26650347 TGCTGTGCTGGTAGGGTGTCGGG - Intronic
1107430282 13:40334248-40334270 GGCAGGGATGGGAGGGTGTGGGG + Intergenic
1111697961 13:91649164-91649186 CACAGCGCTGGGGAGGTCTCAGG - Intronic
1116972572 14:51081955-51081977 CCCAGGGCAGGGAGGGTGGCTGG - Intronic
1120357935 14:83458271-83458293 CGCAGGGCTGGGGAGGTCTCAGG - Intergenic
1121013395 14:90534652-90534674 CCGAGCGCTGGGAGGGTATGGGG + Exonic
1121246612 14:92465427-92465449 CCCAGAGCTGGAAGGATGTCAGG - Intronic
1121391774 14:93582151-93582173 AGCAGCCCTGGAGGGGTGTCAGG - Intronic
1121820523 14:96962181-96962203 CCCAGCCCTGGGAGGGTGTTAGG - Intergenic
1122080423 14:99263225-99263247 GGCAGCCTTTGGAGGGTGTCAGG - Intronic
1122699986 14:103581904-103581926 CACAGAGCAGGGAGGGTGTCTGG - Intronic
1202858019 14_GL000225v1_random:63647-63669 CACAGGGTTGGGACGGTGTCGGG - Intergenic
1125105088 15:35961552-35961574 TGCAGCACTGGGATGGTGTGTGG - Intergenic
1126864750 15:52924758-52924780 AGCAGCCCAGGGAGGGTGTGGGG - Intergenic
1127225202 15:56919747-56919769 CGCCGCGGTGGGAGCGAGTCGGG + Intronic
1129161992 15:73752458-73752480 CGGAGGGCTGGGAGGGCGCCGGG + Exonic
1129709536 15:77813463-77813485 GGGAGTGCTGGGAGGGTGTTGGG + Intronic
1130997570 15:88912491-88912513 TGGAGCGCTGGGAGGGAGTCAGG - Intronic
1133125845 16:3645554-3645576 GGCAGCACTGGGAGCGTGTGGGG + Intronic
1133238721 16:4402539-4402561 CACAGGGCTGGGCGGGTGGCCGG - Intronic
1134452834 16:14373920-14373942 TGCTGCGGTGGGAGGGTGACTGG - Intergenic
1139282964 16:65785524-65785546 CCCAGCCCTGGCTGGGTGTCAGG + Intergenic
1139440290 16:66963338-66963360 CACAGCCCTGGGAGGGTGTGCGG + Exonic
1139956190 16:70694101-70694123 CTCAGGGCTGGGACGGTGTTGGG + Intronic
1140280312 16:73547758-73547780 CGCACAGCTGGGAGGGAGCCAGG - Intergenic
1140304949 16:73794290-73794312 AGAAGGGCTGGGAGGGGGTCTGG - Intergenic
1141471313 16:84240386-84240408 CTGAGCGCTGGGTGGGAGTCAGG + Intergenic
1141891635 16:86930247-86930269 GGGAGCGCTGGGAGACTGTCTGG - Intergenic
1142095491 16:88237395-88237417 CGGAGGGCAGGGAGGGTGACTGG - Intergenic
1142095579 16:88237705-88237727 CGGAGGGCAGGGAGGGTGACTGG - Intergenic
1142297192 16:89232102-89232124 GGCAGTGCTGGGAGGGGGCCTGG + Exonic
1143492455 17:7292376-7292398 CCCAGCGCTGGCAGGTTGTAAGG - Intronic
1144815059 17:18028181-18028203 CGAAGCCCTGGGTGGGTCTCAGG + Intronic
1144955285 17:19015999-19016021 GGAAACGCTGGGAGGGTGTGAGG - Intronic
1147322862 17:39656632-39656654 CGCAGTGCTGGGAGGGAGATGGG + Intronic
1149002316 17:51770212-51770234 GGCGGGGCGGGGAGGGTGTCAGG - Intronic
1149970281 17:61211051-61211073 CCCAGCGCTGGGTGGGGGACAGG + Intronic
1151671337 17:75573286-75573308 AGCCGGGCTGGGTGGGTGTCGGG + Intronic
1151790721 17:76304099-76304121 TACAGCGCTGGGGGGATGTCAGG + Intronic
1151830034 17:76544232-76544254 CGCTGGGCTGGGAGGGGGGCTGG - Intronic
1152073901 17:78147253-78147275 GGCAGAGCTGTGAGGGTCTCAGG - Intronic
1152135097 17:78499136-78499158 GGAAGAGCTGGGAGGGTGACAGG + Intronic
1152520857 17:80855838-80855860 CGCAGCGCTGGGGGCGGCTCAGG - Intronic
1160808877 19:1004493-1004515 GGCAGGGCGGGGGGGGTGTCAGG - Intronic
1161016904 19:1987694-1987716 TGCAGCACAGGGAGGGTGTGGGG + Intronic
1161036705 19:2089076-2089098 CGCAGCCCTGTGAGGCTGGCAGG + Intronic
1161129423 19:2579369-2579391 CGCAGGTCTGGGTGGGTGCCAGG - Intronic
1161363965 19:3868088-3868110 TTCAGACCTGGGAGGGTGTCTGG - Intronic
1161364031 19:3868339-3868361 CACAGACCTGGGAGGGTGCCTGG - Intronic
1161364059 19:3868424-3868446 CACAGACCTAGGAGGGTGTCTGG - Intronic
1161911636 19:7198487-7198509 CGCGGCGCTGGGCGTGTGCCCGG + Intronic
1164571920 19:29380845-29380867 AGCACCTCTGGGTGGGTGTCTGG - Intergenic
1164792873 19:31002916-31002938 TCCAGGGCTGGGAGGGTGCCAGG + Intergenic
1165355090 19:35299622-35299644 CGCAGCTCTGGGCAGTTGTCCGG - Exonic
1166303220 19:41923708-41923730 GGCTGTGCTGGGGGGGTGTCTGG + Intronic
1166303262 19:41923822-41923844 AGCTGTGCTGGGGGGGTGTCTGG + Intronic
1167658199 19:50780155-50780177 CACGGGGCTGGGAAGGTGTCAGG - Intergenic
1167696580 19:51018915-51018937 CGGAGCGCTGGGTGGGTGCTGGG + Intronic
1167756508 19:51416507-51416529 CGCAGCCCTGGGAGGGGGATGGG - Intronic
925565811 2:5253042-5253064 GGCAGAGCTGGGAGGGAGTGGGG + Intergenic
925692630 2:6540347-6540369 CGCAGGACTGGAAAGGTGTCAGG - Intergenic
925725178 2:6865257-6865279 AGCAGCGCTTGCCGGGTGTCAGG + Exonic
926786576 2:16523970-16523992 CGCACCACTGGGAGGTTGTGAGG + Intergenic
927106724 2:19834100-19834122 AGCATGGCTGGGAAGGTGTCAGG + Intergenic
928100448 2:28434345-28434367 CACAGCCCTGGGAGGCTTTCTGG + Intergenic
930153263 2:48079506-48079528 AGCATCTCTGGGAGGGTGGCCGG - Intergenic
934484795 2:94695644-94695666 CTCAGAGCGGGGAGGGTGACAGG + Intergenic
936287679 2:111193345-111193367 CCCAGAGCTGGGAGGGTGGGTGG + Intergenic
938135600 2:128754029-128754051 TGCAGCCCTGGAAGGATGTCAGG - Intergenic
946311422 2:218884265-218884287 CGCAGGGCTGGCTGGGTGCCAGG + Intronic
1169430438 20:5531521-5531543 CTCAGCACAGGGAGGGTGCCAGG + Intergenic
1175727260 20:61327592-61327614 CTCAGGGCTGGGAGGCTGTAGGG + Intronic
1175868465 20:62194697-62194719 AGCAGCCCTGGGTGGCTGTCAGG + Intronic
1176168502 20:63686678-63686700 GGAAGGGCTGGGAGGGCGTCAGG + Intronic
1178024169 21:28446186-28446208 CACATGGCTGGGTGGGTGTCAGG - Intergenic
1179882928 21:44300812-44300834 GGCAGAGCTGGGTGGGGGTCCGG + Intronic
1179988159 21:44932483-44932505 GGGAGGGCTGGGAGGGCGTCTGG + Intergenic
1180915118 22:19480280-19480302 CGCAGGGCGGGCAGAGTGTCAGG + Intronic
1182299389 22:29329278-29329300 CGGAGGGCTGGGAGGGAGCCTGG + Intronic
1183063571 22:35349418-35349440 CCCAGGGCTGGGAGGGCCTCAGG + Intergenic
1183386399 22:37517983-37518005 AGCAGCGCTGGGCGGGTTCCTGG + Exonic
1184472073 22:44701912-44701934 CGCAGTGCTGGGCGGGGGGCGGG + Intronic
1184877163 22:47283165-47283187 CTCAGCGCTGGGAGGGAGGCAGG + Intergenic
1185119538 22:48957767-48957789 TGCAGTGCTGGGTGTGTGTCGGG - Intergenic
950098632 3:10344386-10344408 CGGAGCCTTGGGAGGGTGGCTGG - Intronic
950554321 3:13686056-13686078 CGCAGGGGTGGCAGGGTGGCTGG + Intergenic
951080475 3:18445324-18445346 CGGCGCGCTGGGAGGGAGCCCGG - Intronic
953551832 3:43909011-43909033 CTCAGGGCTGGGAGGGTGTAGGG + Intergenic
953948643 3:47170620-47170642 TGTAGAGCTGGGAGGGAGTCTGG - Intergenic
961112041 3:124292540-124292562 CAGAGCCCTGAGAGGGTGTCTGG + Intronic
961723699 3:128912152-128912174 GTCAGCACTGGGGGGGTGTCTGG - Intronic
967690063 3:192463629-192463651 TGCTGGGCTGGGAAGGTGTCGGG - Intronic
968309357 3:197670316-197670338 CTCAGCTCTGGCATGGTGTCTGG + Intergenic
968726798 4:2251617-2251639 GGCAGGGCTGGGAGTGTGTGAGG - Intronic
970856014 4:20650312-20650334 CGCAGAGCTGGGAAGGCCTCAGG + Intergenic
973774125 4:54230091-54230113 CGCTGCTCTGGGAGAGAGTCGGG + Intronic
976169131 4:82285208-82285230 CGCGGCGCTGCGAGGTGGTCCGG + Intergenic
981348478 4:143700923-143700945 CGCCGCGCTGGGCGCGTATCTGG - Intergenic
983020569 4:162670882-162670904 TGCAGGGCTGGGAAGGTCTCAGG + Intergenic
984947329 4:184980009-184980031 CACAGAGCAGGCAGGGTGTCTGG + Intergenic
985789615 5:1918571-1918593 CGCCGGGGAGGGAGGGTGTCTGG + Intergenic
986273984 5:6257560-6257582 CTCAGAGCTGGGAGGCTGGCGGG - Intergenic
987072861 5:14354160-14354182 AGCAGGGCTGGGAGGGTGGTTGG + Intronic
987303943 5:16620449-16620471 CGCATGGCTGGGAAGGTCTCAGG - Intergenic
989479382 5:41912535-41912557 CACATGGCTGGGAAGGTGTCAGG + Intronic
995357665 5:111257997-111258019 CCTAGCACGGGGAGGGTGTCGGG + Intronic
996395067 5:123005338-123005360 CAGCCCGCTGGGAGGGTGTCCGG - Intronic
998401128 5:141849698-141849720 CGCGACGCTGGGCGGGTGTGGGG + Intergenic
999715400 5:154356209-154356231 CGCAGCTCTGGGATGATGCCAGG + Intronic
1000021419 5:157322297-157322319 CAGAGCCCTGGGTGGGTGTCAGG - Intronic
1002094915 5:176824952-176824974 CACAGTGCTTGGTGGGTGTCAGG + Intronic
1002194453 5:177494663-177494685 GACAGCGCTGGGCGGGTGGCTGG + Intronic
1002533784 5:179864947-179864969 GGCAGGGCTGGGAGGGTGCAGGG + Intronic
1006473465 6:34240894-34240916 GACAGCGCTGGTAGGGAGTCAGG + Exonic
1009973302 6:70647184-70647206 CCCAGCCCTGGGAGAGAGTCAGG + Intergenic
1013220584 6:108074345-108074367 CGCAGAGCTGACAGGGTGTCTGG - Exonic
1015388107 6:132649569-132649591 CGCAGGGCTGGGAAGGCCTCAGG + Intergenic
1019625963 7:2015756-2015778 CGCACACCTGGGTGGGTGTCTGG - Intronic
1019701340 7:2476235-2476257 CTCAGGGCTGAGAGGGCGTCAGG - Intronic
1019760391 7:2808253-2808275 CGCTGCTCTAGGTGGGTGTCGGG - Intronic
1020006813 7:4787784-4787806 CGCAGCGCTGGCAGAGGGTGAGG - Intronic
1020382056 7:7557489-7557511 AGCACCGCTGGGTGGGGGTCGGG - Intergenic
1020947488 7:14631315-14631337 TGCACAGCTGTGAGGGTGTCAGG - Intronic
1024518421 7:50282018-50282040 TGCAGCTGTGGGAGGGTGGCTGG - Intergenic
1026836894 7:73645641-73645663 AGCAGAGCTGGGAGGAGGTCTGG - Intergenic
1032263824 7:130356615-130356637 CACAAGGCTGTGAGGGTGTCTGG + Intronic
1033131684 7:138750689-138750711 CAGAGCGCTGGGAGGCTGGCCGG - Intronic
1033348018 7:140540491-140540513 AGCAGGGCAGGGAGGGTGGCTGG + Intronic
1034119967 7:148618261-148618283 AGCAGGGCTGGGAAGGCGTCAGG + Intergenic
1036668520 8:10764266-10764288 CACAGGGCTGGGAAGGTGGCAGG + Intronic
1037938473 8:22931066-22931088 GGCAGTGATTGGAGGGTGTCAGG - Intronic
1039425207 8:37479665-37479687 AGCAGCACTGGGCGGGTGGCAGG + Intergenic
1039952005 8:42180060-42180082 AGCAGCGCTGGGAGGGAGAAAGG + Exonic
1040495472 8:47961281-47961303 GGCAGCGCTGGGTGGGTGCGCGG + Intronic
1047039330 8:120975042-120975064 TGAAGCGCAGGGAGGTTGTCAGG + Intergenic
1049181492 8:141225500-141225522 CCAAGCGCTGGCTGGGTGTCAGG + Intronic
1049612609 8:143562432-143562454 CTCAGCACTGGGAGAGAGTCAGG - Exonic
1049694500 8:143976802-143976824 CGCAGCTCTGGGTGGGGGCCGGG - Intergenic
1049779860 8:144423981-144424003 CGCCTGGCTGGGAGGGTCTCGGG + Exonic
1049796220 8:144498389-144498411 CACAGGGCTGGCAGGTTGTCAGG + Intronic
1061089571 9:128419412-128419434 CCCAGCGGTGGGAGGGTGAAGGG + Intronic
1061629146 9:131860621-131860643 CGCAGCGCTGGCACGGGGCCTGG + Exonic
1061666360 9:132162813-132162835 CCCGGCGCCGGGAGGGGGTCGGG + Intronic
1061775355 9:132959371-132959393 CTCAGGGCTGGGAGGGCCTCAGG - Intronic
1061907582 9:133706776-133706798 CGCAGGGCTGAGAGGGCCTCGGG + Intronic
1061924501 9:133799316-133799338 CGCAGCGCTGGGAGGGTGTCAGG - Intronic
1062689761 9:137835127-137835149 CGCAGGTCTGGGAAGGTGGCTGG - Exonic
1062726139 9:138074714-138074736 CCCAGTGATGGTAGGGTGTCGGG + Intronic
1186240770 X:7563271-7563293 CTCAGGGCTGGGAGAGTGTGTGG + Intergenic
1186349992 X:8731429-8731451 CGGGGCACTGGGAGGGAGTCTGG - Intronic
1186399183 X:9241115-9241137 AGCAGGTCTGGGATGGTGTCTGG - Intergenic
1186518406 X:10184565-10184587 TGCAGTGCTGGGAAGCTGTCTGG + Intronic
1189069413 X:37847657-37847679 GGCAGCGCTGGGCGGGCTTCGGG + Intronic
1190650350 X:52563196-52563218 CGCAGAGCTGTGAGGGTGTGAGG - Intergenic
1192225900 X:69227639-69227661 GGCAGCCCTGGGAGGGCTTCTGG - Intergenic
1194227584 X:91280029-91280051 GGCAGGGATAGGAGGGTGTCAGG + Intergenic
1196840187 X:119852708-119852730 CGCAGCGCGGGGAGGATGGCTGG - Intronic
1200216273 X:154369464-154369486 CCCAGGGCTGGGAGACTGTCTGG + Intronic
1201177182 Y:11316191-11316213 CGCGGGGTTGGGACGGTGTCAGG + Intergenic