ID: 1061925993

View in Genome Browser
Species Human (GRCh38)
Location 9:133806314-133806336
Sequence CCCTGGCATGCACAGAGATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 252}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061925993_1061925997 -5 Left 1061925993 9:133806314-133806336 CCACATCTCTGTGCATGCCAGGG 0: 1
1: 0
2: 2
3: 26
4: 252
Right 1061925997 9:133806332-133806354 CAGGGTGTGATTCAGGTAGAAGG 0: 1
1: 0
2: 0
3: 20
4: 210
1061925993_1061925999 9 Left 1061925993 9:133806314-133806336 CCACATCTCTGTGCATGCCAGGG 0: 1
1: 0
2: 2
3: 26
4: 252
Right 1061925999 9:133806346-133806368 GGTAGAAGGTTCTATGGCGATGG 0: 1
1: 1
2: 0
3: 6
4: 71
1061925993_1061925998 3 Left 1061925993 9:133806314-133806336 CCACATCTCTGTGCATGCCAGGG 0: 1
1: 0
2: 2
3: 26
4: 252
Right 1061925998 9:133806340-133806362 GATTCAGGTAGAAGGTTCTATGG 0: 1
1: 0
2: 1
3: 5
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061925993 Original CRISPR CCCTGGCATGCACAGAGATG TGG (reversed) Intronic
900141437 1:1140828-1140850 CCCTGGCAGCCACAGAGCTCAGG + Intergenic
900388080 1:2419675-2419697 CCCTGGCATCCACAGACCCGGGG + Intergenic
901712952 1:11130102-11130124 CGCTGGCAGGCCCAGAGATCCGG - Intronic
902981599 1:20127254-20127276 CCTTGGCACCCACAGAGATTGGG - Intergenic
903303130 1:22393084-22393106 CCTGGGCCTGCACAGAGCTGTGG + Intergenic
907526960 1:55059377-55059399 CCCTGGCAGGGACACTGATGAGG + Intronic
908961681 1:69705502-69705524 CCAGGGCATACACACAGATGAGG + Intronic
909068456 1:70963648-70963670 CCCTGGCCTGCACACAGCAGGGG + Intronic
909342233 1:74545089-74545111 CCATGGGATGCCCAGATATGTGG + Intergenic
911568263 1:99490832-99490854 TCCTGGCAAGCAAAGACATGTGG - Intergenic
911719068 1:101170254-101170276 ACCTGGCTTGAACAGACATGAGG + Intergenic
912801396 1:112722130-112722152 CTCTGGGAGGCACAAAGATGGGG - Intronic
914490378 1:148147475-148147497 CCCAGGCAAGCACAGGGCTGGGG - Intronic
915558679 1:156674347-156674369 CACTGGCAAGGACAGAGGTGAGG - Intronic
917479055 1:175394886-175394908 CACATGCATGCACAGTGATGAGG - Intronic
920821539 1:209386292-209386314 CCATGTCAAGGACAGAGATGAGG - Intergenic
920840333 1:209548543-209548565 GCCTGGCTGGCACAGAGTTGAGG - Intergenic
922788130 1:228293706-228293728 CACAGGCAGGCACAGACATGGGG - Intronic
923838355 1:237640166-237640188 CCCTTGCATGCCCAGGAATGAGG + Intronic
924199722 1:241646253-241646275 CCCTGGGATGGAAAGAAATGGGG + Intronic
1064074986 10:12261621-12261643 CCCTGGCTTCCAGAGAGCTGAGG - Intergenic
1067716953 10:48697308-48697330 CTCTGTGATGCCCAGAGATGTGG - Intronic
1072511294 10:96128807-96128829 GTCTGGCTTGCACAGAAATGAGG + Intergenic
1073140233 10:101242434-101242456 CCCTGGCTTGGACAGAAACGGGG - Intergenic
1073509649 10:104035080-104035102 CCGTGGCAGGGACAGAGGTGGGG - Intronic
1074870461 10:117571870-117571892 CGTTGGCTAGCACAGAGATGGGG + Intergenic
1075087938 10:119426071-119426093 GCCTGGCATGCACAGCCATCTGG + Intronic
1075841864 10:125511663-125511685 CACTGGGATGGACAGAGCTGGGG - Intergenic
1076024529 10:127100798-127100820 CCTTGGCAGGAACAGAGCTGTGG + Intronic
1076209378 10:128628077-128628099 CGCTGGCTTGCTCAGAAATGTGG - Intergenic
1076863448 10:133154636-133154658 CCCTGGCAGGGACAGTGAGGAGG + Intergenic
1077411493 11:2405917-2405939 CCCGGTCACTCACAGAGATGAGG - Intronic
1079130518 11:17744498-17744520 CTCTGGCAGGCACAGACCTGGGG + Intronic
1082086316 11:48052912-48052934 GCCTGGCAGCCACAGAGATGAGG + Intronic
1082160535 11:48883861-48883883 CCCTGCTGTGCACAGGGATGGGG + Intergenic
1082161831 11:48896545-48896567 CCCTGCTGTGCACAGGGATGGGG - Intergenic
1082236146 11:49821669-49821691 CCCTGCTGTGCACAGGGATGGGG + Intergenic
1082239606 11:49856215-49856237 CCCTGCTATGCATAGGGATGGGG + Intergenic
1082242551 11:49888136-49888158 CCCTGCTGTGCACAGGGATGCGG - Intergenic
1082609649 11:55281589-55281611 CCCTGCTGTGCACAGGGATGGGG + Intergenic
1082657037 11:55868939-55868961 CCCTGCTGTGCACAGGGATGGGG - Intergenic
1083888464 11:65584130-65584152 CCCCTGCAAGCTCAGAGATGGGG + Intronic
1084542675 11:69797298-69797320 GCCAGGCTGGCACAGAGATGAGG + Intergenic
1084700702 11:70784775-70784797 CCCTGACATTTACCGAGATGGGG - Intronic
1085309720 11:75509019-75509041 TCCTGGCATGAACAGGGAAGTGG + Intronic
1087276539 11:96166630-96166652 CGCTGGCATTCACCCAGATGGGG + Intronic
1087600697 11:100311315-100311337 CATTGTCATTCACAGAGATGAGG + Intronic
1089541097 11:119189367-119189389 CACTGGAATGCCCAGAAATGGGG - Intronic
1091216708 11:133906767-133906789 CCCTGGGATGCACTGGGATGTGG - Intergenic
1095363132 12:41368261-41368283 TCCTGTCCTGCACAGAGATCTGG - Intronic
1096847944 12:54418326-54418348 CCCTCGCCTGAACAGAGATTGGG + Intronic
1098084761 12:66830442-66830464 CGCTGGCCTGCAGACAGATGAGG + Intergenic
1100480229 12:94970757-94970779 ATCTGGAATGCAGAGAGATGTGG + Intronic
1101410805 12:104466468-104466490 CGCTGGCAAGCATGGAGATGGGG - Intronic
1103100584 12:118171087-118171109 TGCTGGCATTCACTGAGATGAGG - Intronic
1105893484 13:24698880-24698902 ACCTGGTGGGCACAGAGATGAGG + Intronic
1106569509 13:30914428-30914450 AACTGGCATGCACTGTGATGAGG + Intronic
1110541672 13:76713270-76713292 CCATGGGATGCCCAGATATGTGG - Intergenic
1111906018 13:94257162-94257184 CCCTGGCCTGCAGAGAGTTTAGG + Intronic
1114060929 14:19015362-19015384 GTCTGGCATGCACAGATTTGAGG - Intergenic
1114065192 14:19054124-19054146 TGGTGGCATGGACAGAGATGGGG + Intergenic
1114097071 14:19345878-19345900 TGGTGGCATGGACAGAGATGGGG - Intergenic
1114101327 14:19384617-19384639 GTCTGGCATGCACAGATTTGAGG + Intergenic
1116194594 14:41706982-41707004 CCCTGGCATGTAGAGACAGGAGG + Intronic
1119296799 14:73539287-73539309 TCCTGCCATGCACAGGGAGGTGG - Intronic
1119401446 14:74365388-74365410 CCCTGCCAGGCAGAGAGCTGGGG + Intergenic
1119676786 14:76561792-76561814 ACCTGCCATGCAGAAAGATGTGG + Intergenic
1119880010 14:78092448-78092470 CACTGGCCTTCAGAGAGATGAGG - Intergenic
1121035987 14:90704027-90704049 GCCAGGCATGCACTGAGATGGGG + Intronic
1121049559 14:90811564-90811586 CACGGGCATCCACAGTGATGTGG - Intronic
1122470253 14:101961486-101961508 CCCTGACAGCCCCAGAGATGTGG + Intergenic
1122651549 14:103229561-103229583 CCCTGGCCTGCACACACAGGTGG + Intergenic
1122999828 14:105287376-105287398 CCCAGGCATGCCCAAAGATGGGG + Intronic
1123048962 14:105531512-105531534 GCCTGGCATGGAGAGAGAAGAGG + Intergenic
1123099198 14:105784248-105784270 CCCTGATAAGCACAGAAATGTGG - Intergenic
1123491435 15:20785043-20785065 TGGTGGCATGGACAGAGATGAGG - Intergenic
1123547937 15:21354134-21354156 TGGTGGCATGGACAGAGATGAGG - Intergenic
1124115725 15:26841967-26841989 TCCTGGCATGCCAAGTGATGTGG - Intronic
1124657743 15:31522925-31522947 CCCTGGTATGGAGACAGATGGGG - Intronic
1124706420 15:31970321-31970343 CACTGGCACGGCCAGAGATGGGG - Intergenic
1128815780 15:70607086-70607108 TCCTGGCAAGCACAGCCATGGGG + Intergenic
1129198330 15:73984030-73984052 CCCTGCTATGCAGAGAGCTGCGG - Exonic
1129252514 15:74316630-74316652 CACTGGCTGGCACTGAGATGTGG - Intronic
1129669422 15:77598877-77598899 TCCTAGCATGCACAGTCATGAGG - Intergenic
1129767493 15:78179444-78179466 AACTGGCATGCAAAGAGAAGGGG + Intronic
1129851458 15:78796294-78796316 CCCAGGCAAGCACAGGGTTGTGG + Intronic
1129968652 15:79758417-79758439 CCCTGGGATGCAGAGAGGAGAGG + Intergenic
1130446704 15:84008846-84008868 CCTTGTCATTCACTGAGATGAGG - Intronic
1202956267 15_KI270727v1_random:81364-81386 TGGTGGCATGGACAGAGATGAGG - Intergenic
1132584060 16:698470-698492 CCCTGGCCTGCCCAGAGGGGTGG - Intronic
1132738846 16:1401031-1401053 TCCTGGCTGGCACACAGATGAGG - Intronic
1135341529 16:21652593-21652615 CCCCGGCATACACAGAAATGGGG - Exonic
1136026134 16:27470166-27470188 TCCTGACATCCACAGAAATGAGG + Exonic
1136395414 16:29989879-29989901 GCAGGGCATGCACAGAGCTGGGG + Intronic
1139339143 16:66256376-66256398 CCCTTGGATGCAAAGAGATTTGG + Intergenic
1139599315 16:67977017-67977039 GCCTGTCCTGCCCAGAGATGTGG + Intronic
1140777497 16:78263412-78263434 CCCTGAAGTGCACAGAGAAGAGG + Intronic
1141107501 16:81245518-81245540 GCCTGGGATGCACACAGTTGGGG + Exonic
1142168560 16:88607180-88607202 CCCAGGCACGCCCAGAGAGGTGG - Intronic
1142328232 16:89432410-89432432 CCGTGGCATGCACTGTGTTGAGG + Intronic
1143606584 17:7990247-7990269 CCCTGGCCTTCACAGAGCAGGGG + Intergenic
1144808837 17:17985551-17985573 CACTGACATGCACAGGGCTGAGG + Intronic
1144874416 17:18390037-18390059 CAGTGGCATGCAGTGAGATGAGG - Intergenic
1145157809 17:20554383-20554405 CAGTGGCATGCAGCGAGATGAGG + Intergenic
1145415386 17:22710183-22710205 ACATGGCATGGACAGAGGTGAGG - Intergenic
1145919268 17:28598516-28598538 CCCCAGCTTGCACAGTGATGGGG + Exonic
1146845589 17:36179686-36179708 CAGTGGCAGGCAGAGAGATGAGG + Intronic
1146873806 17:36391527-36391549 CAGTGGCAGGCAGAGAGATGAGG + Intronic
1146881163 17:36442617-36442639 CAGTGGCAGGCAGAGAGATGAGG + Intergenic
1147065584 17:37921344-37921366 CAGTGGCAGGCAGAGAGATGAGG - Intergenic
1147238933 17:39077823-39077845 CCCTGTCAGGGACAGAGAGGGGG + Intronic
1149286675 17:55172815-55172837 TCCTGGCTTGCCCAGAGCTGAGG - Intergenic
1149848739 17:60022438-60022460 CAGTGGCATGCAGCGAGATGAGG + Intergenic
1149861429 17:60124086-60124108 CAGTGGCATGCAGCGAGATGAGG - Intergenic
1150209375 17:63433831-63433853 CCCTGGGAAGCTCTGAGATGAGG - Exonic
1150248578 17:63693666-63693688 CCCGGCCATGTTCAGAGATGTGG - Exonic
1150440742 17:65189532-65189554 CCCTCGAAGGCACAGAGCTGAGG + Intronic
1150908243 17:69361561-69361583 TCCTGGCATGCACAGGGCTAAGG - Intergenic
1151669511 17:75564332-75564354 ACCTGGCAGGCACAGAGGAGCGG - Exonic
1152233549 17:79126616-79126638 CCCTGCCATGCAGAGAGATGGGG - Intronic
1152394382 17:80023617-80023639 TCCTGGCCTGCACCGAGGTGAGG - Intronic
1152410669 17:80120933-80120955 CCCTGGCAAGCCCAGAGAAAGGG + Intergenic
1152592426 17:81220263-81220285 CCCTGGCATACACTGACATTGGG - Intronic
1152608381 17:81304035-81304057 CCCTGGCATGCAGAGAGAGAAGG - Intergenic
1203193053 17_KI270729v1_random:207077-207099 ACATGGCATGGACAGAGGTGAGG - Intergenic
1203202417 17_KI270730v1_random:6512-6534 ACATGGCATGGACAGAGGTGAGG - Intergenic
1153310503 18:3673161-3673183 CCCAGGCACGCACAGAGGTGTGG - Intronic
1153431752 18:5025043-5025065 CCATGGCATGCACAGGGTTGGGG - Intergenic
1154246351 18:12702864-12702886 CCCTGGCAAGCAAGGCGATGGGG - Exonic
1156213924 18:34977325-34977347 TCCTGGGGTGCACAGAGCTGGGG - Intronic
1157481563 18:48058520-48058542 CCCTGGGATGACCAGAGAGGTGG - Intronic
1159034710 18:63265528-63265550 CCCATGCATGCACATAGAAGAGG + Intronic
1160685903 19:436496-436518 CCCAGCAATGCAGAGAGATGGGG + Intronic
1160874350 19:1290306-1290328 CCCCAGGATGCCCAGAGATGGGG - Intronic
1161303932 19:3556781-3556803 CCCAGGCAGGCAGAGAGAGGGGG + Intronic
1161478699 19:4499996-4500018 CCCTGGGACGCCCAGAGAGGGGG + Intronic
1162459986 19:10809217-10809239 GCCTGCCATGCATAGAGAAGAGG - Intronic
1162811173 19:13165000-13165022 CCAGGGCATGGACAGGGATGGGG + Intergenic
1163625471 19:18386962-18386984 CCATGGAGGGCACAGAGATGGGG - Intronic
1163703539 19:18799144-18799166 GCCTGGCGTGCAGAAAGATGTGG - Intergenic
1164640482 19:29821613-29821635 CCCTGGCATGGAAAGAGAGAGGG - Intronic
1166183360 19:41123905-41123927 CCCTGGCAGGCACATGGCTGGGG - Intronic
1167863865 19:52308100-52308122 CCCTAGCATGGATGGAGATGGGG + Intronic
1168477689 19:56688979-56689001 CCCTGGCATGGACACAGCTGTGG - Intergenic
1168485739 19:56760397-56760419 CCCTGGCATGGACACAGCTGTGG - Intergenic
925148635 2:1599893-1599915 GTGTGGCATGCACAGAGCTGCGG - Intergenic
926119439 2:10234281-10234303 GCCTGGCAAGCACAGTGGTGGGG + Intergenic
927437755 2:23084811-23084833 CCCTCTGATACACAGAGATGTGG + Intergenic
927955287 2:27203637-27203659 CCTTGTCATGCACACAGATGGGG + Intronic
927965127 2:27263359-27263381 CGCAGGCATGCACAGAGTGGTGG - Intronic
928377678 2:30789270-30789292 CCCGAGCATGCACAGAGAATTGG - Intronic
932195095 2:69776386-69776408 CCCTGGCTTGCAGAAATATGTGG - Intronic
932283269 2:70512821-70512843 CACTGCCATGCATAGAGAAGGGG - Intronic
932397050 2:71455546-71455568 ACCTGGCCTGCCCAGAGCTGAGG - Intronic
934050918 2:88210161-88210183 CCTTGGTATGGACAGAGCTGAGG + Intergenic
934655303 2:96114251-96114273 CCCTGGCAGGCGCTGGGATGGGG - Exonic
935135254 2:100294350-100294372 CCATGGCACACACAAAGATGGGG + Exonic
936862111 2:117030446-117030468 CCCAGGCAGGCACAGACCTGTGG - Intergenic
937115102 2:119399317-119399339 CCCCAGGATGGACAGAGATGGGG - Intergenic
937333353 2:121045596-121045618 GCCTGGCATGGACAGAGTGGTGG + Intergenic
938482445 2:131673126-131673148 TGGTGGCATGGACAGAGATGGGG + Intergenic
941110837 2:161417391-161417413 CACTGGCATGCACGGACAGGTGG + Intronic
942814235 2:180033479-180033501 CCTTGGCATGTCCAGAGATGTGG + Intergenic
943526634 2:189024762-189024784 TGCTGGCATGTACTGAGATGGGG - Intergenic
943581020 2:189683625-189683647 CCCTGGCATGATCAGAGAGCTGG + Intronic
947310992 2:228801945-228801967 CCCTGGAATTCACATAGATGGGG - Intergenic
947519092 2:230829964-230829986 CTCCGGCCTGCACAGAGCTGAGG - Intergenic
947533234 2:230925826-230925848 CCCAGGCCTGCACAGAGATTTGG + Intronic
948510696 2:238462452-238462474 CCCTGGCAGGGACAGAACTGGGG - Intergenic
948884003 2:240874080-240874102 CCCAGCCCTGCACAGAGGTGAGG - Intronic
1170546200 20:17437379-17437401 CCCAGGCTTGGACAGAGCTGAGG + Intronic
1172025184 20:31943585-31943607 CCCTGACATGCAAGGAGAAGAGG - Exonic
1172175438 20:32969487-32969509 GCCTGGCTGGCACAGAGAAGTGG - Intergenic
1173139873 20:40472421-40472443 CCTTTGCATGAACAAAGATGTGG - Intergenic
1175039677 20:56036548-56036570 CGATGGCATGAACAGAGATATGG + Intergenic
1176447196 21:6830773-6830795 GGGTGGCATGGACAGAGATGGGG + Intergenic
1176825366 21:13695799-13695821 GGGTGGCATGGACAGAGATGGGG + Intergenic
1177516015 21:22152616-22152638 CCCTGGAATGCAGAGAGCAGAGG + Intergenic
1179306268 21:40156160-40156182 TCCTGGAATCCACAGGGATGAGG + Intronic
1180261706 21:46674787-46674809 CCCTGGCAGGCCCAGGGGTGCGG - Intergenic
1180483681 22:15776744-15776766 TGGTGGCATGGACAGAGATGGGG + Intergenic
1180711191 22:17840861-17840883 CCCCGGCATGCACGGAGGAGCGG + Intronic
1180799449 22:18624952-18624974 CCTCAGCATGCACAGGGATGGGG + Intergenic
1181222269 22:21370314-21370336 CCTCAGCATGCACAGGGATGGGG - Intergenic
1181568091 22:23751684-23751706 CCCTGGGATGCAGAGAGTTGGGG - Intergenic
1181638028 22:24183307-24183329 CCTCAGCATGCACAGGGATGGGG - Intronic
1182699451 22:32223558-32223580 CACTGACTGGCACAGAGATGGGG - Intronic
1183072099 22:35403344-35403366 CCCTGGGAAGCTCAGGGATGGGG - Intronic
1184839122 22:47042304-47042326 CTCTGGCCAGGACAGAGATGTGG - Intronic
1184849553 22:47112489-47112511 CTCTGCCAAGCACAGAGCTGGGG - Intronic
950873834 3:16252090-16252112 CCCTCCCTTGCACAGAGATTAGG + Intergenic
953537994 3:43790384-43790406 CAGGGGCATGCACAGAGAGGTGG - Intergenic
955371548 3:58356215-58356237 CCCTGGCATGCCAAGATAGGGGG + Intronic
955713565 3:61805073-61805095 CCCTGGCAAGGTCAGAGAAGTGG - Intronic
957982252 3:87525403-87525425 CCCAAGGCTGCACAGAGATGGGG - Intergenic
959100623 3:102005654-102005676 CCATGGGATGCACAGATATTTGG - Intergenic
959692670 3:109216570-109216592 GACCGGCATGCACAAAGATGTGG - Intergenic
961651761 3:128420471-128420493 CCTTGGCTGGCACAGAGGTGTGG + Intergenic
962121472 3:132565186-132565208 CCCTGGCAAGCACTGTAATGAGG + Intronic
963838636 3:150082138-150082160 TCCAGGCATGTTCAGAGATGTGG - Intergenic
965759263 3:172057758-172057780 CCAAGGCATGCACTGAGGTGGGG - Intronic
967807993 3:193732093-193732115 CCCTGGCTTGCCCAGGGCTGTGG + Intergenic
967984561 3:195085456-195085478 CGCTGGCATGCTTAGACATGGGG - Intronic
968928892 4:3565692-3565714 GGCTGTCATGCACGGAGATGAGG + Intergenic
970219102 4:13790272-13790294 CCATTTCATGAACAGAGATGGGG - Intergenic
971858948 4:32079558-32079580 CCCAGGGCTGCACAGAGAAGTGG + Intergenic
980594872 4:134941235-134941257 CCCTGGTATGCACAAAGTTAAGG + Intergenic
981672250 4:147300291-147300313 CCCTGGGATGCACATACATGGGG + Intergenic
981824638 4:148926233-148926255 CCCTGGCAAGCCCAGAGACTGGG - Intergenic
983533882 4:168837108-168837130 CCCTGGACTGCAGAGCGATGGGG + Intronic
983925470 4:173396608-173396630 CTCTGGCATGAACACAGAAGAGG - Intronic
985571086 5:645561-645583 CCCTGGCGTGCACAGCTTTGGGG - Intronic
986064283 5:4220662-4220684 CCCACGCATTCAAAGAGATGGGG - Intergenic
993748133 5:91627810-91627832 CTCAGGCATGCACAAAGATGAGG + Intergenic
994065566 5:95536480-95536502 AGCTGGCATGAGCAGAGATGTGG - Intronic
997377289 5:133406239-133406261 ACCTGGCATGCAGGGAGAGGAGG + Intronic
998000642 5:138622254-138622276 GCCTGGCATGCATAGGAATGTGG - Intronic
998252357 5:140561700-140561722 CCCTAGCAGGGGCAGAGATGGGG + Exonic
998536071 5:142932031-142932053 CCCTGGCCTGCAGAGAAAGGAGG - Exonic
999720026 5:154392606-154392628 CTCTGACATACACAGATATGAGG + Intronic
999938525 5:156515626-156515648 CCATGGGTTGCACAGATATGTGG - Intronic
1000639647 5:163686359-163686381 TCCTGGCAAGCTCAGAGAGGAGG + Intergenic
1002850663 6:993613-993635 GCATGGTATGCACTGAGATGTGG - Intergenic
1005058646 6:21755565-21755587 GCCTGTCTTGCACAGAGATATGG - Intergenic
1005763664 6:28989766-28989788 CCCCGGCAACCACAGAGATACGG - Intergenic
1006372926 6:33656576-33656598 CCCTGGCTTCCTCAGACATGTGG + Intronic
1011256479 6:85427031-85427053 CCATGGCATGCTCAGAGAGCTGG + Intergenic
1011506628 6:88051538-88051560 GCCTGGCATCCACAGTGATAAGG - Intronic
1015128518 6:129783357-129783379 CCCTAGAATTCAAAGAGATGGGG + Intergenic
1018175231 6:161172561-161172583 GCCTGCCACCCACAGAGATGTGG + Intronic
1019593532 7:1847690-1847712 CCCAGGCCTGCCCAGAGCTGAGG - Exonic
1019800357 7:3084006-3084028 CCCTAGAAGACACAGAGATGGGG + Intergenic
1019877476 7:3827023-3827045 CCTTGGGATGGAAAGAGATGGGG - Intronic
1021605566 7:22406081-22406103 TACAGGCATGCACAGAGATGGGG + Intergenic
1022017867 7:26367607-26367629 CCCGGGCAAGCACAGATCTGAGG - Intronic
1022305678 7:29144664-29144686 CCCTGGGATGCACAGAACTAAGG - Intronic
1024209756 7:47192974-47192996 CCCAGGCAAGCACAGAGGGGAGG + Intergenic
1024210289 7:47197469-47197491 CCCCTGTATGCACAGAGAAGAGG + Intergenic
1027162535 7:75813200-75813222 TCCAGGGATGCACAGAGCTGGGG + Intronic
1027413947 7:77953959-77953981 CCCTCACATGCACAGTAATGCGG + Intronic
1028027615 7:85866542-85866564 CCATGGGATGCACAGATCTGTGG - Intergenic
1028916895 7:96269153-96269175 CTGTGCCAAGCACAGAGATGAGG + Intronic
1029422087 7:100477134-100477156 ACCTGGCAGGCACAGAGAAGAGG + Intronic
1031715966 7:125109111-125109133 CCCTGGGCTGCACAGAGCAGTGG + Intergenic
1032878163 7:136059975-136059997 CCCAGGCATGCAAAGAGCTGGGG + Intergenic
1033534367 7:142298570-142298592 TCCTGGAATTCACTGAGATGAGG + Intergenic
1033599396 7:142877772-142877794 TCCTGGCATTTACAGAGAGGTGG + Exonic
1035954452 8:4060660-4060682 ACCTGGCATGAACATAGATAAGG + Intronic
1037154959 8:15688726-15688748 CCCTGGCATACAGAGAGGAGAGG - Intronic
1038463227 8:27734517-27734539 CCCTGGGACCAACAGAGATGGGG + Exonic
1039300966 8:36208402-36208424 CCAAGGCATCCACAGAGAAGGGG + Intergenic
1040759063 8:50815484-50815506 CCCTGGGATGCCCAGATATATGG - Intergenic
1044962487 8:97544307-97544329 CCCTGGCACACCCAAAGATGTGG + Intergenic
1047315158 8:123726454-123726476 TCCTGCCATGCACTGAGCTGTGG + Intronic
1047518516 8:125576225-125576247 CGCTGGGATGCCCAGAGAGGTGG - Intergenic
1049164208 8:141116562-141116584 TGCTGGCTGGCACAGAGATGTGG + Intergenic
1049629900 8:143648175-143648197 CTCTGTAATGGACAGAGATGAGG + Intronic
1049717572 8:144100153-144100175 CCCTGGCATGGACTGAGGTGAGG - Intronic
1050365849 9:4873203-4873225 AGCTGGCATGCACCCAGATGTGG - Intronic
1051150294 9:14072433-14072455 CCTTGGCAGGAACAGAGAGGAGG - Intergenic
1055454029 9:76456461-76456483 AGCTGCCATGCACAGAGCTGGGG - Intronic
1055576196 9:77662175-77662197 CCCTGGCAAGCACAGATGTTTGG + Intergenic
1057735779 9:97658426-97658448 CACTGGCTTGCACTGAGGTGCGG - Intronic
1060340074 9:122767666-122767688 CTCAGGCATGCACAAAGATGTGG + Intergenic
1060901147 9:127259301-127259323 CGCAGGCATGAACAGAGCTGAGG - Intronic
1061221494 9:129254513-129254535 CCCTGGCTGGCACAAAAATGAGG + Intergenic
1061663420 9:132146172-132146194 CCCTGTCACTCACAGGGATGAGG + Intergenic
1061896885 9:133652841-133652863 CCGTGGCATGCACAGTGGCGTGG + Intronic
1061925993 9:133806314-133806336 CCCTGGCATGCACAGAGATGTGG - Intronic
1062025329 9:134337623-134337645 CCCTGGCATGCAGAGAGTTGGGG + Intronic
1203521994 Un_GL000213v1:53758-53780 GGGTGGCATGGACAGAGATGGGG - Intergenic
1187052220 X:15706324-15706346 CCTTGTCAATCACAGAGATGGGG - Intronic
1187308071 X:18115156-18115178 CCCTGGCATAAAAAGAGCTGTGG - Intergenic
1187362559 X:18641975-18641997 CCCTGGCAGGCGCCGAGCTGAGG + Exonic
1187365244 X:18661271-18661293 CCCTTGCATGCCCTGAGATGGGG - Intronic
1188586278 X:31779342-31779364 CCCAGGCATGAACAGACTTGGGG - Intronic
1190117296 X:47634604-47634626 CCCTTGCATGCCCAGTGATGTGG + Intergenic
1192677275 X:73211111-73211133 CCCTGTCACACACAGAGATTGGG - Intergenic
1192970865 X:76228434-76228456 CACTGGCATGGACAGAGTTGAGG - Intergenic
1194917296 X:99722066-99722088 CTCAGGCATGCACAGAGATCTGG + Intergenic
1196556209 X:117087502-117087524 CGATGGAATACACAGAGATGAGG + Intergenic