ID: 1061927051

View in Genome Browser
Species Human (GRCh38)
Location 9:133811069-133811091
Sequence CCTTCCCGGGGAGCCTGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061927051_1061927060 8 Left 1061927051 9:133811069-133811091 CCCAGCCAGGCTCCCCGGGAAGG No data
Right 1061927060 9:133811100-133811122 AGGCCCTGCTGCCTCCACAAAGG No data
1061927051_1061927068 25 Left 1061927051 9:133811069-133811091 CCCAGCCAGGCTCCCCGGGAAGG No data
Right 1061927068 9:133811117-133811139 CAAAGGGCCACCATCCCTCGGGG No data
1061927051_1061927061 9 Left 1061927051 9:133811069-133811091 CCCAGCCAGGCTCCCCGGGAAGG No data
Right 1061927061 9:133811101-133811123 GGCCCTGCTGCCTCCACAAAGGG No data
1061927051_1061927069 26 Left 1061927051 9:133811069-133811091 CCCAGCCAGGCTCCCCGGGAAGG No data
Right 1061927069 9:133811118-133811140 AAAGGGCCACCATCCCTCGGGGG No data
1061927051_1061927067 24 Left 1061927051 9:133811069-133811091 CCCAGCCAGGCTCCCCGGGAAGG No data
Right 1061927067 9:133811116-133811138 ACAAAGGGCCACCATCCCTCGGG No data
1061927051_1061927066 23 Left 1061927051 9:133811069-133811091 CCCAGCCAGGCTCCCCGGGAAGG No data
Right 1061927066 9:133811115-133811137 CACAAAGGGCCACCATCCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061927051 Original CRISPR CCTTCCCGGGGAGCCTGGCT GGG (reversed) Intronic