ID: 1061928746

View in Genome Browser
Species Human (GRCh38)
Location 9:133821299-133821321
Sequence TGCCAACAAGAGACCCACTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 141}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061928746_1061928751 12 Left 1061928746 9:133821299-133821321 CCGCAGTGGGTCTCTTGTTGGCA 0: 1
1: 0
2: 1
3: 8
4: 141
Right 1061928751 9:133821334-133821356 TCGCTCCTGAGCCCCTGGAGGGG No data
1061928746_1061928750 11 Left 1061928746 9:133821299-133821321 CCGCAGTGGGTCTCTTGTTGGCA 0: 1
1: 0
2: 1
3: 8
4: 141
Right 1061928750 9:133821333-133821355 GTCGCTCCTGAGCCCCTGGAGGG No data
1061928746_1061928755 23 Left 1061928746 9:133821299-133821321 CCGCAGTGGGTCTCTTGTTGGCA 0: 1
1: 0
2: 1
3: 8
4: 141
Right 1061928755 9:133821345-133821367 CCCCTGGAGGGGAGGCAGCGAGG No data
1061928746_1061928757 24 Left 1061928746 9:133821299-133821321 CCGCAGTGGGTCTCTTGTTGGCA 0: 1
1: 0
2: 1
3: 8
4: 141
Right 1061928757 9:133821346-133821368 CCCTGGAGGGGAGGCAGCGAGGG No data
1061928746_1061928748 7 Left 1061928746 9:133821299-133821321 CCGCAGTGGGTCTCTTGTTGGCA 0: 1
1: 0
2: 1
3: 8
4: 141
Right 1061928748 9:133821329-133821351 GACTGTCGCTCCTGAGCCCCTGG No data
1061928746_1061928749 10 Left 1061928746 9:133821299-133821321 CCGCAGTGGGTCTCTTGTTGGCA 0: 1
1: 0
2: 1
3: 8
4: 141
Right 1061928749 9:133821332-133821354 TGTCGCTCCTGAGCCCCTGGAGG No data
1061928746_1061928752 15 Left 1061928746 9:133821299-133821321 CCGCAGTGGGTCTCTTGTTGGCA 0: 1
1: 0
2: 1
3: 8
4: 141
Right 1061928752 9:133821337-133821359 CTCCTGAGCCCCTGGAGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061928746 Original CRISPR TGCCAACAAGAGACCCACTG CGG (reversed) Intronic
900568251 1:3345924-3345946 AGCCAACAAGAGCCCCAAAGAGG + Intronic
902128026 1:14233734-14233756 TGCATACAAAAGACACACTGTGG - Intergenic
902458666 1:16554561-16554583 TTCCAACAAGCTTCCCACTGTGG + Intergenic
902493491 1:16853355-16853377 TTCCAACAAGCTTCCCACTGTGG - Intronic
904570069 1:31456992-31457014 CTACATCAAGAGACCCACTGGGG - Intergenic
914354589 1:146872920-146872942 TGTCTACAAGAGACTCACTTTGG + Intergenic
914977130 1:152376776-152376798 TGACAATAAGAGAACAACTGGGG + Intergenic
915315055 1:155023816-155023838 TGCCAAGGTGAGACCCCCTGGGG - Exonic
1063167820 10:3479814-3479836 TGCCATCAAAAGACCAGCTGAGG + Intergenic
1064294784 10:14069007-14069029 TGGAAACAAGAGAGCCACTGAGG - Intronic
1066592021 10:37006053-37006075 AGCCGACAAGAGACACATTGTGG + Intergenic
1069458686 10:68574127-68574149 TGCCAGCAGAAGACCAACTGTGG + Exonic
1071027767 10:81136731-81136753 TGCCAGCAAAGGACCTACTGTGG - Intergenic
1072512931 10:96147286-96147308 TGACATCAAAAGACACACTGAGG - Intronic
1075901004 10:126042930-126042952 AGCCAACAAGAAACCCAGTGGGG - Intronic
1075921660 10:126218478-126218500 AGCCAACAAGAGACATACTGAGG + Intronic
1076329646 10:129654856-129654878 TAGAAACAAGTGACCCACTGTGG - Intronic
1079491470 11:20993291-20993313 TGCCCACAAGGAACCCATTGTGG - Intronic
1081600134 11:44487193-44487215 TGCTAACAAGTGACTCACGGTGG - Intergenic
1083954968 11:65978076-65978098 TGCCCACTAGAGACAAACTGAGG - Intronic
1086391997 11:86374838-86374860 GACCAACGAGAGACCCAATGAGG - Intronic
1088967860 11:114742518-114742540 TGCCAAAAAGAGACCCCGTTAGG - Intergenic
1089413452 11:118266624-118266646 AGCCAGCAGGAGACTCACTGGGG + Intergenic
1091048607 11:132348091-132348113 TTCCTTCAAGAGCCCCACTGTGG + Intergenic
1092332050 12:7593893-7593915 TACCAAAAAGAGCCACACTGGGG - Intergenic
1093046502 12:14452240-14452262 TGCCTACAAGAGGCTCACTTTGG - Intronic
1093359859 12:18210734-18210756 AACCAAGAAGAGACACACTGGGG + Intronic
1098600935 12:72331022-72331044 TGCCGACATGAAACCCTCTGTGG + Intronic
1102407940 12:112690436-112690458 TACCAAAAAGAGCCTCACTGGGG - Intronic
1104538229 12:129638769-129638791 TGTGAACAAGAGTCCCACTCAGG + Intronic
1106504700 13:30360953-30360975 TGCCCACAAGAGACCTAGGGGGG + Intergenic
1108666776 13:52640662-52640684 TGCCCTCCAGAGACACACTGGGG + Intergenic
1112424934 13:99289716-99289738 TGCAAACAAGAAACACACTGTGG - Intronic
1112630272 13:101153639-101153661 TGCCAAGAGCAGCCCCACTGAGG - Intronic
1113122514 13:106939476-106939498 TGCCAAAAAGAGACCATCAGAGG + Intergenic
1119129017 14:72154755-72154777 AGCAAACAACAGAACCACTGGGG - Intronic
1119874525 14:78046223-78046245 TGCCAACAAGAGCCCACCTCTGG - Intergenic
1120686642 14:87545531-87545553 TGCCATTGAGAGATCCACTGGGG + Intergenic
1121041931 14:90756841-90756863 TTCCAAAAAGAGAACCAATGAGG + Intronic
1121678026 14:95770232-95770254 TTCCAAATAGAGACACACTGGGG - Intergenic
1122505583 14:102229824-102229846 TGCCCACTAGAGTCCCACGGGGG + Intronic
1122639657 14:103151322-103151344 TGCCAACAAATGACCTACCGAGG + Intergenic
1128576083 15:68776041-68776063 TGCTTATTAGAGACCCACTGTGG + Intergenic
1130047839 15:80460037-80460059 AGCCAACAGGAGAGGCACTGGGG - Intronic
1130083137 15:80752293-80752315 TGCAAACATCAGAGCCACTGTGG - Intronic
1135052608 16:19204770-19204792 TGCCCTCAACAGAGCCACTGAGG - Intronic
1136121160 16:28135708-28135730 TGTCTACAAGAGACTCACTTTGG - Intronic
1137555638 16:49468759-49468781 AGCCAACAAGAGGCCATCTGAGG + Intergenic
1138410627 16:56837040-56837062 TGGCAACCACAGACACACTGGGG + Intronic
1138525836 16:57606830-57606852 TGCCAAGACTAGGCCCACTGAGG + Intergenic
1139979430 16:70842618-70842640 TGTCTACAAGAGACTCACTTTGG - Intronic
1140998209 16:80281752-80281774 TGCCATCAAGGGACCCACAAGGG + Intergenic
1142277814 16:89132217-89132239 TGCGTACAAGAGTCTCACTGAGG - Intronic
1143164961 17:4893063-4893085 TGCCACCAGGTGACTCACTGCGG - Exonic
1143227666 17:5321007-5321029 TGCCTACAAGAAACCCACTTTGG + Intronic
1144194529 17:12877359-12877381 TGTCTACAAGAGACCCACCCTGG + Intronic
1144664227 17:17091168-17091190 TTTCAGCAAGAGACCCACCGAGG + Intronic
1149816134 17:59725604-59725626 GCCAAACAAGAGAGCCACTGAGG - Intronic
1152629488 17:81403892-81403914 TGGCAGCACGAGCCCCACTGGGG - Intronic
1152672118 17:81614876-81614898 TGCCAACAAGACACACACACAGG + Intronic
1153708526 18:7772769-7772791 TGCCAACAGGACACACATTGTGG + Intronic
1153739978 18:8114367-8114389 TGCGAAGGAGGGACCCACTGTGG - Intronic
1157051931 18:44176311-44176333 TGCAAAGAAGAGACACTCTGAGG - Intergenic
1157349780 18:46874033-46874055 TTGCATCAAGAAACCCACTGGGG + Intronic
1159723805 18:71928217-71928239 TGTCTACAAGAGACTCACTTTGG - Intergenic
1160464456 18:79064693-79064715 TCCTATCAAGATACCCACTGGGG + Intergenic
1161293735 19:3508963-3508985 TGCCAACAGGGGGCCCGCTGTGG - Intronic
1161976636 19:7611223-7611245 AGACAACATGAGGCCCACTGGGG - Intronic
1163795843 19:19337636-19337658 TTCCTGCCAGAGACCCACTGTGG + Intronic
1164660090 19:29956651-29956673 TTTCAACAAGAGACCCATTCTGG + Intronic
1167748942 19:51368459-51368481 CGCCAACAAGAGGGCCACAGTGG - Exonic
925350759 2:3199560-3199582 GGGACACAAGAGACCCACTGGGG + Intronic
928165459 2:28968463-28968485 TGCAACCAACAGACACACTGAGG - Intronic
933310374 2:80652905-80652927 TGTCTACAAGAGACTCACTTTGG + Intergenic
936340794 2:111630915-111630937 AGCCAACCAGAGACCTAGTGGGG - Intergenic
937975831 2:127581675-127581697 AGCCCCCAGGAGACCCACTGAGG + Intronic
942931731 2:181502009-181502031 TGGCAAAAAGAGGCCCACAGAGG + Intronic
944296952 2:198076554-198076576 TACCAATAAGGGACCCACTAGGG + Intronic
946843919 2:223842599-223842621 TGCCAACAAGAGGCCAGGTGAGG + Intergenic
948097047 2:235343647-235343669 TGCAAACCAGAGATCCCCTGGGG + Intergenic
1168750472 20:278208-278230 TGCCAAGAAGAGAGCCAATGGGG + Intronic
1168844692 20:935873-935895 TGTTAGGAAGAGACCCACTGGGG - Intergenic
1171195173 20:23191444-23191466 TGACAAAAAGGGACCCACTATGG + Intergenic
1171416098 20:24981523-24981545 GGCCAACAGGAGACCCGCTGGGG - Intronic
1174403066 20:50286350-50286372 TGCGAACAGGAGACACACCGAGG - Intergenic
1175615995 20:60398708-60398730 TGCTCACCAGAGACGCACTGCGG - Intergenic
1175827020 20:61941945-61941967 TGCCAAGGTGAGCCCCACTGAGG - Intergenic
1176059034 20:63164137-63164159 GGGCACCAAGGGACCCACTGTGG - Intergenic
1177201447 21:17961327-17961349 TGACAACAAGATGCTCACTGCGG - Intronic
1178718954 21:34991408-34991430 TGTCATCAAGGGCCCCACTGGGG - Intronic
1179338821 21:40485112-40485134 TGACAACACAAGACTCACTGAGG + Intronic
1184389762 22:44196549-44196571 TGCCAGCAACAGTCCCACCGGGG - Intronic
1184754973 22:46510532-46510554 TGCCAACAGGAGAGGCGCTGCGG + Intronic
950477584 3:13223659-13223681 TGCCCACAAGAGACACACTGGGG + Intergenic
952178281 3:30891068-30891090 TACCAACAAGAGAACAGCTGTGG + Intronic
954996846 3:54889556-54889578 TGCTAACACGAGAGACACTGGGG + Intronic
955382717 3:58452970-58452992 TGCCATTAAGAAACCCACTGAGG - Intergenic
956164866 3:66389457-66389479 AGCCTACAAGAGACACAGTGTGG + Intronic
957933636 3:86914384-86914406 TCCCCACAAATGACCCACTGTGG + Intergenic
960432734 3:117589695-117589717 TGCCAACAAGAGAAACAATTAGG - Intergenic
961786993 3:129353328-129353350 TGCTTACAAGAGACATACTGGGG - Intergenic
965323131 3:167271573-167271595 TTGCATCAAGGGACCCACTGGGG + Intronic
967044395 3:185723520-185723542 TGCCACCAACAGAGACACTGGGG - Intronic
969877239 4:10144861-10144883 TGCTAACAAGAAACCCAGTCTGG - Intergenic
972358048 4:38300347-38300369 TGCCTACAAGAAACTCACTTTGG + Intergenic
972701268 4:41496371-41496393 TGCTAGCTAGAGTCCCACTGGGG - Intronic
976801725 4:89000058-89000080 GGCCAAGAAGAGGCCCATTGGGG - Intronic
990761475 5:59134702-59134724 TTCCAACAGGGGACCCACAGTGG + Intronic
990994889 5:61722377-61722399 TGCCTATAAGAAACCCACTTTGG - Intronic
991484895 5:67124842-67124864 TGCCACAGAGAGACCCAGTGAGG + Intronic
991517016 5:67448328-67448350 TACCTACAAGAGACCCAGTTAGG - Intergenic
991536360 5:67673245-67673267 TGACAACAAGAGACATTCTGTGG - Intergenic
992106880 5:73456514-73456536 TGGGAACAATAGACACACTGGGG - Intergenic
992785925 5:80170621-80170643 TGCCAAAAACTGACCCACGGTGG - Intronic
993003572 5:82406907-82406929 TGCAAACAAGAGACCCAGGTGGG - Intergenic
994062991 5:95502271-95502293 TGCCAATAAAACACTCACTGAGG + Intronic
1004180748 6:13378739-13378761 TGCCAGCAGGAAAGCCACTGCGG + Intronic
1004492207 6:16128232-16128254 TGCCTCCAAGCAACCCACTGTGG + Intergenic
1005004328 6:21272696-21272718 TGCCAACACGACACCCATTTGGG + Intergenic
1005784322 6:29227504-29227526 AGCCAAGATGAGGCCCACTGAGG + Intergenic
1008563956 6:52749298-52749320 TCCCTACAAGAGGCTCACTGGGG + Intergenic
1009541948 6:64971228-64971250 TGCCAATAAGAAAATCACTGAGG + Intronic
1009706060 6:67253391-67253413 AGCTAACAAGAGCCCCCCTGGGG + Intergenic
1012341333 6:98128661-98128683 TGCCAAAAGCAGACCCACTCAGG + Intergenic
1014391728 6:120872779-120872801 AGCTAAGAAGAGACCCACAGTGG - Intergenic
1021564975 7:22008120-22008142 TGCCAACTACAGACCCTCAGGGG + Intergenic
1023106999 7:36772295-36772317 TGCCAAGAAGAGCCCCATAGTGG - Intergenic
1023834297 7:44059389-44059411 ACCCAACCAGAGACCCACTTTGG + Exonic
1026162140 7:67878818-67878840 TGCAGACCAAAGACCCACTGGGG + Intergenic
1028257556 7:88618647-88618669 TGCAAACGATAGACACACTGTGG + Intergenic
1043314880 8:78908141-78908163 TGACAGCAACAGACCCCCTGAGG + Intergenic
1044346094 8:91106067-91106089 AGCCCACAAGAGACACTCTGTGG - Intronic
1044597572 8:93973206-93973228 TGACTGCAAGAGACCCACAGTGG + Intergenic
1049188081 8:141269890-141269912 TGCCAGCCATAGACACACTGTGG - Intronic
1049241260 8:141538390-141538412 TGCCACCAACAGAACCAGTGAGG - Intergenic
1052519609 9:29529135-29529157 TGTGAACAAGAGACTCACTTTGG - Intergenic
1053463961 9:38291419-38291441 TGGCACCAACAGACCCATTGTGG + Intergenic
1056034897 9:82594046-82594068 TGCCAACATGGGTCCCAGTGGGG - Intergenic
1057093989 9:92288161-92288183 TGTCAACATGAAACCCACTCTGG + Exonic
1058313584 9:103535936-103535958 TGTCTTCAAGAGACCCATTGCGG + Intergenic
1058653093 9:107195496-107195518 TCCCACAAGGAGACCCACTGAGG + Intergenic
1061928746 9:133821299-133821321 TGCCAACAAGAGACCCACTGCGG - Intronic
1062200684 9:135301183-135301205 TGCCAGCTAGAGTCCCCCTGTGG + Intergenic
1062388780 9:136325938-136325960 TGCCATCAGGAGGCCCACAGAGG - Intergenic
1187275310 X:17811626-17811648 TGCCAGAAATAGACCCTCTGAGG + Intronic
1188587096 X:31790717-31790739 AGCCAACAAGAGATCAAATGAGG + Intronic
1188710455 X:33390869-33390891 TACCAAAAATAAACCCACTGGGG + Intergenic
1198339434 X:135699726-135699748 TGTAAACAAGATAGCCACTGGGG + Intergenic
1198392141 X:136186950-136186972 TGTCAATAAGAGACTAACTGTGG + Intronic
1198610079 X:138388919-138388941 TGAGAACAATAGACACACTGCGG + Intergenic
1199692600 X:150320043-150320065 TGCTACCAAGAGCCTCACTGTGG + Intergenic