ID: 1061929791

View in Genome Browser
Species Human (GRCh38)
Location 9:133826635-133826657
Sequence CTAGGTGGCTGGGGGAGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1289
Summary {0: 1, 1: 1, 2: 11, 3: 138, 4: 1138}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061929791_1061929801 -10 Left 1061929791 9:133826635-133826657 CCACCCCTCCCCCAGCCACCTAG 0: 1
1: 1
2: 11
3: 138
4: 1138
Right 1061929801 9:133826648-133826670 AGCCACCTAGGATGAAGCGGTGG No data
1061929791_1061929805 30 Left 1061929791 9:133826635-133826657 CCACCCCTCCCCCAGCCACCTAG 0: 1
1: 1
2: 11
3: 138
4: 1138
Right 1061929805 9:133826688-133826710 TCATGTCCATGTCCTTCCTTTGG No data
1061929791_1061929804 5 Left 1061929791 9:133826635-133826657 CCACCCCTCCCCCAGCCACCTAG 0: 1
1: 1
2: 11
3: 138
4: 1138
Right 1061929804 9:133826663-133826685 AGCGGTGGCTAAATAAAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061929791 Original CRISPR CTAGGTGGCTGGGGGAGGGG TGG (reversed) Intronic
900146762 1:1162024-1162046 CCAGGGGTCTGGGGGTGGGGAGG - Intergenic
900183765 1:1323904-1323926 CTTGGGGGCTGGGGGACTGGGGG + Intronic
900365376 1:2309866-2309888 CTGGTGGGCTGAGGGAGGGGTGG - Exonic
900713122 1:4127603-4127625 CTAGGAGGTTGGTGGACGGGAGG - Intergenic
900993714 1:6109295-6109317 CCGGCTGGTTGGGGGAGGGGTGG - Intronic
901058360 1:6460192-6460214 CTGGCTGGCTGGGGCTGGGGCGG - Exonic
901176565 1:7304047-7304069 CTCAAGGGCTGGGGGAGGGGAGG + Intronic
901192684 1:7421961-7421983 CGCCGTGGCTGGGGGAGTGGAGG + Intronic
901453963 1:9352833-9352855 GGAGGAGGCTGGGGGAGGGAGGG - Intronic
901506804 1:9690114-9690136 ATAGGGGGCAGGGGGAGGGGAGG - Intronic
901526060 1:9824013-9824035 CGGGGTGGCGGCGGGAGGGGCGG + Exonic
901636921 1:10674837-10674859 CTGGATGGCTGGGGCAGGTGAGG - Intronic
901637802 1:10678410-10678432 GCAGGTGGGTGGGGGTGGGGGGG + Intronic
901775874 1:11560185-11560207 CCAGGTCCCTGGGGGAGGTGAGG - Intergenic
901804518 1:11729710-11729732 GGAAGTGGGTGGGGGAGGGGAGG - Intergenic
902192319 1:14772485-14772507 TTAGGTGATTGGGGCAGGGGTGG - Intronic
902518095 1:17000527-17000549 TTCAGTGCCTGGGGGAGGGGCGG + Exonic
902658828 1:17887428-17887450 GCAGGGGGCTGGGAGAGGGGAGG + Intergenic
902776197 1:18676480-18676502 ATGAGTGGCTGGGGGAGGGGAGG + Intronic
902807471 1:18869988-18870010 CCAGGTGACTTGTGGAGGGGTGG - Intronic
903172097 1:21560753-21560775 CCAGGGGCCTGTGGGAGGGGTGG + Intronic
903322840 1:22553059-22553081 CTGGGTGGCGGGGGCAAGGGGGG - Intergenic
903360155 1:22772063-22772085 CGGGGTTGCTGGGGGTGGGGTGG - Intronic
903652966 1:24932317-24932339 CAGGGCGGCGGGGGGAGGGGGGG + Intronic
903656289 1:24950593-24950615 ACAGGTGGCTGGGCGTGGGGTGG + Intronic
903748163 1:25602503-25602525 CCAGGTGTCTGGGGTGGGGGAGG - Intergenic
904030968 1:27533192-27533214 CTAGCTGGCTGGGTCAGGGAGGG + Intergenic
904035586 1:27557023-27557045 CTGTGTGGCTGGGGGTAGGGTGG - Intronic
904039544 1:27575907-27575929 TCACGTGGCGGGGGGAGGGGAGG + Intronic
904054762 1:27662808-27662830 GCAGATGGCTGGGGGAGGGGTGG - Intergenic
904058324 1:27686728-27686750 CAAGATGCCGGGGGGAGGGGAGG + Intergenic
904195681 1:28783566-28783588 CTAGGCGGCTGGGGTAAGAGTGG + Intergenic
904311592 1:29632805-29632827 CTGGGAGGCTGGGGGACTGGGGG - Intergenic
904311629 1:29632923-29632945 CTAGGGGGCTGGGGCACTGGAGG - Intergenic
904613461 1:31737611-31737633 TCTTGTGGCTGGGGGAGGGGGGG - Intronic
904690917 1:32292645-32292667 CTCAGAGGCTGGGGGAGGGGAGG - Intronic
905015089 1:34772422-34772444 AGAGGTTGCTGGGGGAGTGGAGG - Intronic
905046545 1:35007809-35007831 CTGTCTGGCTGGGGGATGGGGGG + Intronic
905384940 1:37596025-37596047 CTAGGCGGCTGGAGCGGGGGCGG - Intergenic
905420977 1:37843862-37843884 TTGGATGGATGGGGGAGGGGTGG - Intronic
905720929 1:40201073-40201095 CCAGGTTGCGGGGGGGGGGGGGG - Intronic
905985962 1:42282554-42282576 CTCAGTGGTTGGGGGAGAGGAGG - Intronic
906063415 1:42962805-42962827 GCAAGTGGGTGGGGGAGGGGTGG + Intergenic
906079739 1:43077401-43077423 CATGGTGGGTGGGGGAGGGGCGG - Intergenic
906205744 1:43985428-43985450 CTGGGTGGGGGGGGGAGGGGGGG + Intronic
906412027 1:45586149-45586171 CTGGGTGTGTGGGGGTGGGGGGG + Intronic
906494915 1:46298401-46298423 TTGGGTGGGAGGGGGAGGGGAGG - Intronic
906545923 1:46619421-46619443 CTGGGTGTCTGTGGGATGGGAGG + Intergenic
906666943 1:47628627-47628649 CTTGGTGGCTGGGGATGGAGTGG + Intergenic
906704482 1:47885004-47885026 CTGGGTGGCAGGGGAAGGGGAGG - Intronic
906717263 1:47979500-47979522 CAAGGGGGCTGAGCGAGGGGAGG + Intronic
907085710 1:51671835-51671857 CTATGTTGGTGGGGGAGGTGGGG + Intronic
907247190 1:53115797-53115819 CAGGGTGGCTAGGGGTGGGGAGG - Intronic
907485750 1:54776936-54776958 CTAGATGGCAGGGTGGGGGGTGG + Intergenic
908404599 1:63802043-63802065 TTATTTGGTTGGGGGAGGGGAGG + Intronic
909411562 1:75358992-75359014 AGAGGTTGCAGGGGGAGGGGAGG - Intronic
909474962 1:76072343-76072365 CTCGATGTCTGGGGGTGGGGGGG - Intergenic
910243663 1:85115691-85115713 CTGGGTGGCAGGGGGAGGTGGGG + Intronic
910275680 1:85446717-85446739 CTAGAGGATTGGGGGAGGGGTGG - Intronic
910546517 1:88425014-88425036 GTAGGGGGATGGGAGAGGGGTGG - Intergenic
911644398 1:100322733-100322755 ATAGAAGGCTTGGGGAGGGGAGG - Intergenic
912369722 1:109164710-109164732 CCAGTGGGCTGGGGGTGGGGTGG - Intronic
912409104 1:109467263-109467285 ACAGGTGGGCGGGGGAGGGGCGG + Intronic
912873263 1:113328934-113328956 CCAGGGGGATGGGGAAGGGGTGG + Intergenic
913201827 1:116501060-116501082 CTAGAAGGCTGGGGGAGTGCTGG - Intergenic
913300686 1:117366765-117366787 CAGGCTGGGTGGGGGAGGGGCGG + Intergenic
913581723 1:120233399-120233421 TAAGGGCGCTGGGGGAGGGGAGG - Intergenic
913592379 1:120341631-120341653 GTGTGTGGCTGGGGGTGGGGTGG - Intergenic
913650979 1:120913514-120913536 GTGTGTGGCTGGGGGTGGGGTGG + Intergenic
914044075 1:144077110-144077132 CGCGGTGGCGGGGGGGGGGGGGG - Intergenic
914170135 1:145215553-145215575 GTGTGTGGCTGGGGGTGGGGTGG - Intergenic
914351339 1:146842894-146842916 ATAGGTGGATGGTGGATGGGTGG + Intergenic
914525252 1:148459516-148459538 GTGTGTGGCTGGGGGTGGGGTGG - Intergenic
914563654 1:148844846-148844868 TAAGGGCGCTGGGGGAGGGGAGG - Intronic
914598424 1:149176314-149176336 GTGTGTGGCTGGGGGTGGGGTGG + Intergenic
914609173 1:149285380-149285402 TAAGGGCGCTGGGGGAGGGGAGG + Intergenic
914641150 1:149607618-149607640 GTGTGTGGCTGGGGGTGGGGTGG + Intergenic
914673449 1:149889447-149889469 CCGGGTGGGTGGGGGCGGGGTGG - Intronic
914676872 1:149912784-149912806 TGGGGTGGTTGGGGGAGGGGGGG - Intronic
914928409 1:151908479-151908501 CAAGGTGGTTGGTGGAGGGCAGG - Intronic
915141228 1:153769861-153769883 TTAGGTGCCTGGGAGAGGAGAGG + Intronic
915160919 1:153920136-153920158 CTTGGTGGGTGGGGGAGGAAAGG + Intronic
915351417 1:155228941-155228963 CTAGGTAGCTGGGGAGGTGGTGG + Intergenic
915354201 1:155246121-155246143 CTAGGTAGCTGGGGAGGTGGTGG + Intergenic
915357810 1:155266768-155266790 CTTGGTGGATGGGGTAGGGCAGG + Exonic
915590194 1:156866359-156866381 CGAGGGGGCTGGGGGTGTGGGGG + Intronic
915621300 1:157086562-157086584 GCAGGTGGATGGGGGTGGGGAGG - Intergenic
915940884 1:160117548-160117570 CTAAGAGGCTGGGTGAGGTGGGG + Intronic
915999043 1:160596852-160596874 GTAGGGGGCTAGGGGAGGGATGG + Intergenic
916123747 1:161551060-161551082 GTGTGTGGCGGGGGGAGGGGTGG - Intergenic
916133633 1:161632423-161632445 GTGTGTGGCAGGGGGAGGGGTGG - Intronic
916455756 1:164969730-164969752 GTAGGGGGGTGGGGGAGGTGGGG - Intergenic
916934723 1:169615779-169615801 CTAGGAGGCTTGGGGAGAAGAGG + Intronic
917188804 1:172391329-172391351 GAAGGGGGCTGGGGGAGGGGTGG + Intronic
917268084 1:173242995-173243017 GTTGGTGGGTGGGGGGGGGGGGG + Intergenic
917359553 1:174160270-174160292 CAAGGTGGGTGGGGGTTGGGGGG - Intronic
917629680 1:176879561-176879583 CTTGGGGGCGGGGGGAGAGGTGG - Intronic
918205885 1:182308907-182308929 CTAGGTGCCTGGAGGCTGGGAGG - Intergenic
918282814 1:183023138-183023160 GGAGGGGGTTGGGGGAGGGGAGG - Intergenic
919012735 1:191986289-191986311 ATTTGTGGCTGGGGAAGGGGTGG - Intergenic
919091425 1:192982512-192982534 GAAGGTGGGTGGGGGTGGGGGGG - Intergenic
919719254 1:200814123-200814145 AAAGGTGGCGGGGGGAGGGGTGG + Intronic
919762309 1:201105920-201105942 CTGGCTGGGTGGGGCAGGGGCGG - Intronic
919770264 1:201154129-201154151 CCAGGTGGCTGGCGGAGAGCCGG - Exonic
919852480 1:201682327-201682349 GTTGGTGGCTGCGGTAGGGGTGG - Intronic
920066715 1:203274283-203274305 GTAGGTGGCTGGGGGTGGGGTGG + Intergenic
920248109 1:204603487-204603509 CATGGTGGATGGGGGAGAGGTGG + Intergenic
920265063 1:204715547-204715569 CTAGGTGTGTGGGACAGGGGTGG + Intergenic
920338550 1:205260685-205260707 CCAGGGGGCTGGGGTGGGGGTGG - Intronic
920705657 1:208248685-208248707 CTAGATGGATGGAGGAGGGGAGG - Intergenic
920764783 1:208821785-208821807 CTGGGGGGTTGGGGGTGGGGGGG - Intergenic
921032987 1:211350321-211350343 CTGGGAGGCTGAGGCAGGGGGGG - Intronic
921052794 1:211523189-211523211 ATAGGTGGATTGGGGAGCGGGGG - Intergenic
921163826 1:212491687-212491709 CTGGATAGGTGGGGGAGGGGAGG - Intergenic
921342196 1:214145291-214145313 CAAGGTGGCGGCGGGAGAGGTGG + Intergenic
922218938 1:223543287-223543309 CTAGGTGGGGGCTGGAGGGGAGG - Intronic
922342469 1:224668903-224668925 TTAGGGGGCTGGTGGAGCGGGGG + Intronic
922468161 1:225859122-225859144 CTTGGTGGGTGGGGAAGGAGTGG - Intronic
922864554 1:228848502-228848524 CCAGTTGGCTGGGGGGGGGGGGG - Intergenic
923018712 1:230146709-230146731 CCAGGTTGCAGGGGGAGGGGTGG + Intronic
923092771 1:230752581-230752603 GCAGAAGGCTGGGGGAGGGGAGG + Intronic
923372435 1:233327592-233327614 CGGGGCGGCTGGGGGAGGGGCGG + Intergenic
923976996 1:239274988-239275010 CCAGGAGTCTGGGGGAGGAGGGG + Intergenic
924141920 1:241033355-241033377 AAAGCTGGCTGGGGGAGCGGGGG + Intronic
924426153 1:243952214-243952236 CAAGCTGCCTGGGGGAGGTGGGG - Intergenic
924439469 1:244074267-244074289 CTGGGTGGCTGGCGGCAGGGTGG + Intergenic
924466578 1:244304020-244304042 ACAGGTGGCTCGTGGAGGGGAGG + Intergenic
1062836641 10:640249-640271 CTTGGTGGCCGTGGGCGGGGCGG - Intronic
1062838704 10:652898-652920 CGAGGTAGCTGTGGGCGGGGAGG - Intronic
1063097051 10:2917589-2917611 CTGGGTGACAGGGGGTGGGGGGG + Intergenic
1063374727 10:5547323-5547345 TTAGGTGGCTGGGCTAGGTGGGG - Intergenic
1063391325 10:5651614-5651636 CTAGGTGTTTGGGGCGGGGGTGG - Intronic
1063821569 10:9842421-9842443 CTAGGTGGCTAGGGAAGAAGTGG - Intergenic
1063824999 10:9886518-9886540 GTTGGGGGCTAGGGGAGGGGTGG - Intergenic
1064138788 10:12772744-12772766 GGAGGAGGCTGGGGGAGAGGAGG + Intronic
1065937430 10:30532991-30533013 CTTGGTGGGTGGGGGCGAGGTGG + Intergenic
1065970087 10:30799286-30799308 CCAGGTGGCGGGGGGGGGGTGGG - Intergenic
1066296087 10:34055611-34055633 CCGGGTGGGTGGGGGATGGGCGG + Intergenic
1066747564 10:38616191-38616213 CCAGGAGGCGGGGGGTGGGGGGG + Intergenic
1067103726 10:43351301-43351323 CTAGGTGGCTGGTTGTGGGTGGG - Intergenic
1067343014 10:45419500-45419522 CTGCGGGGCTGGGGGAGGGCCGG - Intronic
1067359641 10:45566765-45566787 CTTTCTGGCGGGGGGAGGGGGGG + Intronic
1067835826 10:49640704-49640726 CAAGGGTGCTGGGGGAGGGAGGG + Intronic
1067903118 10:50262819-50262841 CAGTGAGGCTGGGGGAGGGGCGG + Intergenic
1068103842 10:52590333-52590355 CTCTGGGGCTGGGGGTGGGGTGG + Intergenic
1068684428 10:59855187-59855209 CTAGATGAATTGGGGAGGGGTGG - Intronic
1069640531 10:69952661-69952683 GTGGGTGGGAGGGGGAGGGGAGG - Intronic
1069828142 10:71266645-71266667 CTGGGAGGCTGGGGCAGGGGTGG + Intronic
1069882397 10:71601946-71601968 CTGGGTGGGCGGCGGAGGGGGGG + Intronic
1070312466 10:75283637-75283659 GCAGGAGGCTGGGGTAGGGGTGG - Intergenic
1070499969 10:77063352-77063374 CTGGGTTGCTGGGGGAGAGGTGG + Intronic
1070771143 10:79082945-79082967 TTGGGTAGCTGGGCGAGGGGAGG - Intronic
1070774839 10:79103522-79103544 CTGGGTGGGTGGGGGTGGAGAGG + Intronic
1070790870 10:79188611-79188633 CTAGGGGGGTGGGGGACAGGAGG - Intronic
1070794736 10:79210050-79210072 TTAGGGGGCTGGGGGGGCGGAGG - Intronic
1070954228 10:80454116-80454138 CGAGGCGGCTGGGGGAGGGGCGG + Intergenic
1071566498 10:86673992-86674014 CTGGGTGTTGGGGGGAGGGGAGG - Intronic
1072079292 10:92012251-92012273 CTAGGAGGGGAGGGGAGGGGAGG - Intronic
1072219459 10:93315466-93315488 CTGGGTGGCTGGGGAAATGGAGG + Intronic
1073070593 10:100790858-100790880 ATAGAGGGCTGGGGGAGGGCTGG + Intronic
1073105458 10:101030126-101030148 CTAGGTGGCCTCGGGAGGAGAGG + Exonic
1073185413 10:101612678-101612700 CTGGGATGCTGGGGGAGGGGTGG - Intronic
1073269187 10:102247400-102247422 CTTGGGGGCGGGGAGAGGGGAGG - Intronic
1073286911 10:102395096-102395118 TTAGGTGGGGGGGGGGGGGGGGG + Intronic
1073300223 10:102466689-102466711 GGAGGTGGCTGGGGGAGGCTGGG + Intronic
1073690905 10:105808616-105808638 GTAGGGGGATGGGGGTGGGGAGG - Intergenic
1073890209 10:108091843-108091865 AGAGGTGGGTGGGGGAGTGGGGG + Intergenic
1074004239 10:109403602-109403624 CTAGGTGTTTGGGGGTGGAGGGG - Intergenic
1074453775 10:113580159-113580181 TTCGGGGGCGGGGGGAGGGGGGG + Intronic
1074509468 10:114099536-114099558 CTGGATGGCTGGGGAATGGGTGG + Intergenic
1075087717 10:119424544-119424566 GTGGGTGGTTGGGGGAAGGGTGG - Intronic
1075095521 10:119468513-119468535 CTTGGGAGCTGGGGGTGGGGGGG - Intergenic
1075869810 10:125762952-125762974 GTAGGAGTTTGGGGGAGGGGAGG - Intronic
1076334413 10:129695887-129695909 TCCGGTGGATGGGGGAGGGGCGG + Intronic
1076359447 10:129876889-129876911 GTAGCTGGGTGGGGGGGGGGGGG - Intronic
1076490572 10:130858706-130858728 CTACCTGGCTGGGGAACGGGAGG - Intergenic
1076738325 10:132468491-132468513 ATGGGAGGCAGGGGGAGGGGAGG + Intergenic
1076749399 10:132535020-132535042 CTGGGGGGCAGGGAGAGGGGAGG + Intergenic
1076880634 10:133237688-133237710 CTCGATGTCTGGGGGAGGGGCGG - Exonic
1076896989 10:133317810-133317832 CTCTGTGTCTGGGGGGGGGGGGG - Intronic
1076902709 10:133347735-133347757 GAAGGGGGCTGGGGGAGGGGAGG + Intronic
1076977912 11:189491-189513 CTGGGGGGCGGGGGGAGGCGCGG + Intronic
1076993927 11:289327-289349 GTAGGCGGCTGGGGCAGGCGCGG - Intronic
1077052998 11:576077-576099 CTACGTGCGTGGGGGCGGGGTGG + Intergenic
1077166015 11:1139243-1139265 CGGGGTGGCTGGGGGAGGCGGGG + Intergenic
1077166026 11:1139263-1139285 GGGGGTGGCTGGGGGAGGGAGGG + Intergenic
1077333853 11:1994742-1994764 CTAGGTGACTGGGGTAGAGCTGG - Intergenic
1077377822 11:2213623-2213645 GTCAGGGGCTGGGGGAGGGGTGG - Intergenic
1077500959 11:2909563-2909585 CTGGGCGGCTGGGGACGGGGCGG - Exonic
1077732041 11:4741646-4741668 GGGGGTGGGTGGGGGAGGGGAGG + Intronic
1077899278 11:6476585-6476607 CTGGGTGGGTGGGTGAGGGTAGG + Exonic
1078087500 11:8243033-8243055 CCACGGGGCTGGGTGAGGGGAGG + Intronic
1078519945 11:12054857-12054879 CTGGGTGGCAGGGGGAAAGGGGG - Intergenic
1078642519 11:13109603-13109625 CCAGGTGCCTGGGGCAGGGGTGG - Intergenic
1079130766 11:17745668-17745690 CATGGAGGCTGGGGGAGGGAGGG - Intronic
1079527944 11:21413338-21413360 CAAGGGTGCTGGGGGTGGGGGGG + Intronic
1080083750 11:28253623-28253645 GTAGTTGGCGGGGGGAGGGAGGG - Intronic
1080865417 11:36190062-36190084 CTAGGGGGAGGGGGGAGGGGAGG + Intronic
1081470994 11:43371000-43371022 CTATGTTGTTCGGGGAGGGGAGG + Intronic
1081537351 11:44005378-44005400 CTGCCTGGGTGGGGGAGGGGAGG + Intergenic
1081690547 11:45074957-45074979 GAAGGTGGCTGGGTGTGGGGAGG - Intergenic
1081873946 11:46396368-46396390 CAAGGAGGATGGGGGAGGGGTGG - Intergenic
1082090563 11:48085955-48085977 CCAGGGGTCTGGGGGTGGGGTGG + Intronic
1082786778 11:57321746-57321768 CCAGGTGGCTGGGAGGGGGGTGG - Intronic
1082788360 11:57330186-57330208 CTGGGTGCCTGGGTGAGGTGGGG - Intronic
1083204923 11:61142800-61142822 CTAAGGGGTGGGGGGAGGGGGGG + Intronic
1083289677 11:61682835-61682857 CTGGATGGCAGGGGGACGGGGGG + Intronic
1083659500 11:64245651-64245673 ACAGGTGTTTGGGGGAGGGGAGG - Intronic
1083736613 11:64685247-64685269 CTGGGTGCCAGGGGGTGGGGAGG - Intronic
1083749291 11:64752629-64752651 CTGGGCGGCTGGAGGAGGAGGGG - Intronic
1083922184 11:65786994-65787016 GTTGGTGGCTGGGGCGGGGGGGG - Intergenic
1083932370 11:65853010-65853032 CCTGGTGCCTGGGGGAGGGAGGG - Intronic
1084002255 11:66302767-66302789 CAAGGTGGCTTGGGGTGGAGAGG - Intergenic
1084403032 11:68956040-68956062 GTAGGGGTCTGGGGGTGGGGCGG + Intergenic
1084403095 11:68956160-68956182 GTAGGGGCCTGGGGGTGGGGTGG + Intergenic
1084537272 11:69764552-69764574 AGAGGCTGCTGGGGGAGGGGTGG + Intergenic
1084600997 11:70145516-70145538 CCTGGCGGCTGGGGGTGGGGTGG - Intronic
1084610827 11:70202018-70202040 CGTGGTTGGTGGGGGAGGGGAGG + Intergenic
1084740732 11:71137929-71137951 CTGGGCGGCTGGTGCAGGGGTGG - Intronic
1084747374 11:71181822-71181844 CTGGGTTGGCGGGGGAGGGGGGG - Intronic
1084777551 11:71387451-71387473 CTGGCTGGCTGGGGCAGGAGGGG - Intergenic
1084890809 11:72236011-72236033 AGAGGTGGGTGGGGGAAGGGGGG - Intronic
1084944585 11:72631874-72631896 CTTGTTGGGTGGGGGTGGGGAGG - Intronic
1085083677 11:73652797-73652819 CCATGTGACTGGGGCAGGGGAGG + Intronic
1085121167 11:73968531-73968553 GCAGGTGGTTGTGGGAGGGGAGG - Intronic
1085244005 11:75083080-75083102 AAAGGAGGGTGGGGGAGGGGTGG + Intergenic
1085307799 11:75498083-75498105 GTGGGGGGCTGGTGGAGGGGGGG + Intronic
1085560018 11:77462980-77463002 AAAGGTGGGTGGGGGTGGGGTGG + Intronic
1086067038 11:82756558-82756580 CTGTGTGGCTGGGGCAGGGTTGG + Intergenic
1086220370 11:84436176-84436198 TTTGGTGGATGAGGGAGGGGAGG - Intronic
1086497069 11:87415273-87415295 ACAGGTGGCAGGGGGTGGGGAGG + Intergenic
1086584034 11:88431695-88431717 GTGGGGGGCTGGGGGTGGGGTGG + Intergenic
1086735083 11:90296461-90296483 CTGGGTGGCAGGGGGGTGGGTGG + Intergenic
1087130879 11:94668509-94668531 CCAGGGGGCTGGGGGCCGGGGGG - Intergenic
1087841759 11:102927803-102927825 CCAGCTGGGTGGAGGAGGGGAGG + Intergenic
1089297149 11:117476562-117476584 CTATGAGGCTGGTGTAGGGGAGG + Intronic
1089387305 11:118076817-118076839 CTAGAAGGTAGGGGGAGGGGGGG + Intergenic
1089613220 11:119681199-119681221 CCAGCAGCCTGGGGGAGGGGTGG - Intronic
1089650121 11:119907488-119907510 CTGGGTGGCTGGTGGACAGGTGG + Intergenic
1089796840 11:120987522-120987544 CTAGGTTCCTGGGAGAGAGGTGG + Exonic
1089966343 11:122656910-122656932 CTAGGAGAGTGGGGTAGGGGAGG + Intronic
1090221006 11:125026042-125026064 CCCTGTGGTTGGGGGAGGGGTGG + Intronic
1090619040 11:128545007-128545029 CTGGCTGGTTGGGGGTGGGGGGG + Intronic
1090818143 11:130315930-130315952 CCAGGTGCCTGGGGGCGGGCGGG + Intergenic
1090936788 11:131350209-131350231 CCATGTGCCTGGTGGAGGGGAGG - Intergenic
1202816836 11_KI270721v1_random:49924-49946 CTAGGTGACTGGGGTAGAGCTGG - Intergenic
1091479366 12:810875-810897 CCAGGCTGCTGGGGGTGGGGTGG - Intronic
1091587817 12:1826403-1826425 CCAGTTGGCGGGGGGGGGGGGGG - Intronic
1091740642 12:2958948-2958970 CTGGGAGGCCGGGGAAGGGGCGG - Intergenic
1092163668 12:6329731-6329753 CGAGGAGGCTGGGGGAGGGCCGG - Intronic
1092244014 12:6852906-6852928 CTGGGGGGCGGGGGGAAGGGTGG - Intronic
1092371015 12:7916488-7916510 CCAGGTGGCTTTGGGAGGTGTGG + Intergenic
1092759083 12:11792959-11792981 TTAGGGGGCTACGGGAGGGGTGG + Intronic
1092909689 12:13135856-13135878 CTGGAAGGCTGGGGGAGGTGTGG + Intronic
1092946363 12:13457815-13457837 CCAGTTGGCTGGTGGTGGGGAGG + Intergenic
1093325904 12:17773951-17773973 CAGGGAGGCTGGGGAAGGGGCGG - Intergenic
1093609577 12:21137541-21137563 CAGCGAGGCTGGGGGAGGGGCGG - Intronic
1094070498 12:26407481-26407503 CTGGGGGGTTGGGGTAGGGGTGG + Intronic
1094424912 12:30307296-30307318 CTCAGTGGCTGGAAGAGGGGCGG + Intergenic
1094429413 12:30350317-30350339 CTGTGTGGGTGGGGGGGGGGCGG + Intergenic
1095800600 12:46267717-46267739 CTAGGTGCCGGGGGTTGGGGAGG + Intronic
1095986951 12:48005113-48005135 AGAGCTGGATGGGGGAGGGGTGG - Intergenic
1096181905 12:49555818-49555840 CTAGGTGGCAGAGGGAGGCCAGG + Exonic
1096356875 12:50948857-50948879 CGAGGAGGAGGGGGGAGGGGAGG + Intergenic
1096489355 12:52005285-52005307 CTAGAGGACTGGGGGTGGGGAGG + Intergenic
1096505335 12:52088931-52088953 CTCGGTGCCTGGCAGAGGGGTGG - Intergenic
1096529522 12:52234146-52234168 CCAGGCAGGTGGGGGAGGGGAGG - Intronic
1096714103 12:53480840-53480862 ATAGGGGGTGGGGGGAGGGGCGG - Intronic
1096783573 12:54004651-54004673 GTCGGTGGCTGGAGGAGGGTAGG + Intronic
1096842342 12:54387267-54387289 CTGGGTGAGCGGGGGAGGGGAGG + Intronic
1096984242 12:55745731-55745753 GTTGAGGGCTGGGGGAGGGGAGG - Intronic
1097101535 12:56593261-56593283 CTTGGTGGCCGGGGAAGGGGTGG - Exonic
1097183786 12:57185516-57185538 GTTGGTGCCTGGGGGAGGGGAGG - Exonic
1097190954 12:57219467-57219489 CTAATTAGCTGGGGGAGGGCAGG + Intronic
1097191654 12:57222343-57222365 GTAAGGGGCAGGGGGAGGGGAGG - Intronic
1097416522 12:59322950-59322972 GCAGGGGGATGGGGGAGGGGAGG - Intergenic
1097455336 12:59792805-59792827 CAAGTTCCCTGGGGGAGGGGTGG - Intergenic
1097713336 12:62938411-62938433 ACAGGGGGCTGGGGGAGGGGAGG + Intergenic
1097879607 12:64675046-64675068 CGGGGTGGCGGGGGGGGGGGGGG - Intronic
1098394672 12:70005412-70005434 CACAATGGCTGGGGGAGGGGGGG + Intergenic
1098597959 12:72295126-72295148 GGGGGTGGCTGGGGGATGGGGGG + Intronic
1099131313 12:78835677-78835699 GGAGGAGGCTGGGGGATGGGAGG + Intergenic
1099987756 12:89687519-89687541 CTAGGTGGGTGGAGGTGGGGTGG + Intronic
1100407834 12:94286385-94286407 GTAGGTGGCTGAGGGTGGTGGGG - Intronic
1100749251 12:97678937-97678959 GTGGGGGGCTGGGGGAGGGATGG + Intergenic
1100891586 12:99132001-99132023 GTAGGCAGCTGGGGGAGGGGAGG - Intronic
1101148262 12:101862214-101862236 CTACTTGGCTGGGGGCTGGGGGG - Intergenic
1101237620 12:102805276-102805298 TTACATGGGTGGGGGAGGGGCGG + Intergenic
1101373985 12:104155026-104155048 CCCTGTGGCTGGGGGAGGTGAGG - Intergenic
1101757938 12:107635851-107635873 GTGGGTGGGTGGGGGGGGGGGGG - Intronic
1102260077 12:111438160-111438182 CTGGGTGGCAGGGGAAGGTGTGG + Intronic
1102439458 12:112950131-112950153 CATGCTGGCTGGGGGAGGGAAGG - Intronic
1102952954 12:117042278-117042300 CTGGGGGGCTGGGGGAGGGGAGG - Intronic
1103014398 12:117482537-117482559 CAACCTGGCTGGGGCAGGGGTGG + Intronic
1103204158 12:119115218-119115240 ATAGGTGGGTGTTGGAGGGGAGG + Intronic
1103377627 12:120469307-120469329 CGCGGAGGCGGGGGGAGGGGAGG + Intronic
1103562510 12:121800065-121800087 CCGGGCCGCTGGGGGAGGGGCGG - Intronic
1103583483 12:121933932-121933954 CAGAGTGGCTGGGGGAGGGGAGG + Intronic
1103853767 12:123950485-123950507 CTAGGAAGCTGGGTGAGGGTGGG + Intronic
1103875486 12:124123931-124123953 ATCAGTGGCTGGGGGAGGGAGGG - Intronic
1103908764 12:124340535-124340557 GGAGGCGGCTGGGGGATGGGCGG - Intronic
1103928688 12:124437720-124437742 CAGGGTGGGTGGGGGTGGGGGGG - Intronic
1104601024 12:130153519-130153541 TTGGGAGGCTGAGGGAGGGGCGG + Intergenic
1104624603 12:130340623-130340645 GGTGGTGGTTGGGGGAGGGGGGG + Intronic
1104625608 12:130351685-130351707 CTAGGAGGCAGGGGAAGGTGCGG - Intronic
1104636775 12:130442481-130442503 CTATGTGGGTTGGGGAGTGGAGG + Exonic
1104896280 12:132166554-132166576 CTGGGTGGATGAGGGATGGGTGG - Intergenic
1104972891 12:132539788-132539810 CTAGGTGGATGGGGGCTGGAGGG - Intronic
1104973053 12:132540238-132540260 CTAGGTGGATGGGGGCTGGAGGG - Intronic
1105000507 12:132687417-132687439 CTCGGGGGGCGGGGGAGGGGCGG - Intergenic
1105702610 13:22944394-22944416 CTACTTGGCTGGGGGATGAGAGG - Intergenic
1106054964 13:26229208-26229230 CTGGGGTGCTAGGGGAGGGGAGG - Intergenic
1106452425 13:29895052-29895074 CTACTTGGCGGGGGGCGGGGGGG + Intergenic
1106827709 13:33542557-33542579 CTTGGTGGGAGGGCGAGGGGCGG - Intergenic
1107961511 13:45563502-45563524 CTTGGTGGCAGGGGCAGGTGGGG - Intronic
1107998879 13:45888551-45888573 CCAGGAGCCTGGGGGAGGGGAGG + Intergenic
1108167222 13:47706438-47706460 GTAGGTGGTTGGGGGAAGGGGGG - Intergenic
1108482838 13:50892287-50892309 CTATGTGGCTGGAGGGGTGGGGG - Intergenic
1108578892 13:51812032-51812054 GTTGGTGGCTGGGTGAGTGGTGG - Intergenic
1108631130 13:52283820-52283842 GTAGGAGGTTGGGGGTGGGGAGG - Intergenic
1108655561 13:52528781-52528803 GTAGGAGGTTGGGGGTGGGGAGG + Intergenic
1108750091 13:53439814-53439836 GGAGGGGGATGGGGGAGGGGAGG - Intergenic
1109152691 13:58863209-58863231 CTAGAGGGCTGGTGGAGAGGAGG + Intergenic
1109278838 13:60332033-60332055 CTAGGTGGGTGGGTAAGAGGTGG + Intergenic
1109763332 13:66860325-66860347 TTTATTGGCTGGGGGAGGGGAGG + Intronic
1112035542 13:95493217-95493239 CTGGGTGGGTGGGGCAGGGAAGG - Intronic
1112092645 13:96098352-96098374 CTAGGTGGCTGAGGTGGTGGTGG + Intronic
1112248308 13:97754523-97754545 CCAGGTGGCGGGGAGTGGGGCGG - Intergenic
1112484580 13:99809010-99809032 TCAGATGGCTGGGGGAGGTGGGG + Intronic
1112652771 13:101416524-101416546 CGGGCAGGCTGGGGGAGGGGTGG + Intergenic
1113904110 13:113811408-113811430 CTGGGTCTCCGGGGGAGGGGAGG + Intronic
1114334104 14:21670125-21670147 CTGGGAGGCTGGTGGATGGGCGG + Intergenic
1114405693 14:22453927-22453949 GTGTGTGGCTGGAGGAGGGGAGG + Intergenic
1114512643 14:23275552-23275574 GTGGGGAGCTGGGGGAGGGGAGG - Exonic
1114551312 14:23534267-23534289 CCAGGTGGCTGTGGGTGGAGAGG + Exonic
1114610389 14:24036381-24036403 CCAGCTGGCTGAGGGCGGGGAGG + Intergenic
1115869723 14:37786329-37786351 CAACGAGGCTGGGTGAGGGGCGG - Intronic
1116434799 14:44885006-44885028 TTGGGTGGGTGGGGGCGGGGGGG + Intergenic
1116783637 14:49265085-49265107 CTTGGAGGCTGGGAGAGGGGTGG + Intergenic
1116876121 14:50113786-50113808 CTTGGGGGCGGGGGGGGGGGGGG + Intronic
1117140850 14:52790330-52790352 ACAGGTGAATGGGGGAGGGGCGG + Intronic
1117254365 14:53963350-53963372 TTAGCTGGCTCGAGGAGGGGTGG - Intergenic
1117315785 14:54569012-54569034 GGAGGAGGCTGGGGGATGGGGGG + Intronic
1117803980 14:59470940-59470962 GGGGGTGGCTGGGGGCGGGGGGG + Intronic
1117812566 14:59564417-59564439 CTGGTTGACTGGGGGAGAGGTGG - Intronic
1117980802 14:61340363-61340385 CCAGGTGGGAGGGGGCGGGGTGG + Intronic
1118104711 14:62644828-62644850 AAAGGTGGATGGGGGAGTGGTGG - Intergenic
1118313289 14:64708347-64708369 GCCGGAGGCTGGGGGAGGGGTGG - Intronic
1118404432 14:65409899-65409921 CTAGTTTGGTGAGGGAGGGGTGG + Intergenic
1119141215 14:72269132-72269154 CAAGGTGGGTGGTGGGGGGGCGG - Intronic
1119433539 14:74583687-74583709 CTAGGTGATGGGGAGAGGGGAGG - Intronic
1119470950 14:74898812-74898834 CTGTGGAGCTGGGGGAGGGGAGG - Intronic
1119558125 14:75568894-75568916 ATCGGCGGCTGGGGGAGGTGAGG - Intergenic
1119670808 14:76516874-76516896 CCAAGTGGCTGGGGGGAGGGTGG - Intergenic
1119726490 14:76924720-76924742 CTTAGAGGCTGGGGGATGGGGGG + Intergenic
1120922316 14:89766175-89766197 CCAGGTGTCTGGAGTAGGGGAGG - Intergenic
1121791238 14:96701335-96701357 CTAGGTGGGAGGGGCAGGGGAGG - Intergenic
1121846949 14:97180421-97180443 CTAGGTGGCATGGGCAGGGTGGG - Intergenic
1122061078 14:99137148-99137170 TTTGTTGGCTGGGGGAGGGCCGG - Intergenic
1122081531 14:99270760-99270782 GGAGGGGGCTGGGGGAGCGGAGG - Intronic
1122288836 14:100668654-100668676 CTGGGTGCCTGGGTGCGGGGCGG - Intergenic
1122328564 14:100897743-100897765 CTGGTTGGCGGGGGGGGGGGTGG + Intergenic
1122538324 14:102481850-102481872 GTGGGTGGCTGGGGGAATGGGGG - Intronic
1122601544 14:102924120-102924142 CTAGGAGGCAGGGAGTGGGGGGG + Intronic
1122602421 14:102928347-102928369 CCAGGGGACTGGGGGCGGGGTGG + Intronic
1122625002 14:103080255-103080277 CTAGGTGGCTGGCTGATTGGTGG + Intergenic
1122693511 14:103542291-103542313 CAGGGAGGCTGGGGCAGGGGCGG + Intergenic
1122741728 14:103875462-103875484 ACAGGTGGGTGGGGGTGGGGTGG + Intergenic
1122826174 14:104371762-104371784 CAAGGGGGCTGGGGGAGGCCAGG + Intergenic
1122877854 14:104677146-104677168 CAAGGGGCCTGGGGGGGGGGGGG + Intergenic
1122886667 14:104713373-104713395 CTAGAGGGCTGGGGGTGGTGGGG - Intronic
1122920464 14:104877852-104877874 ACAGGTGGCGGGGGGGGGGGGGG - Intronic
1123011379 14:105351089-105351111 CCAGGTGGCTGGAGGGCGGGCGG - Intronic
1123105769 14:105840434-105840456 GTAGGTGGCTGGCTGAGGGCTGG + Intergenic
1123666198 15:22610932-22610954 CCAGGTGGCTGTGGGAGAGAGGG - Intergenic
1124320022 15:28705338-28705360 CCAGGTGGCTGTGGGAGAGAGGG - Intronic
1124482489 15:30090079-30090101 CCAGGTGGCTGTGGGAGAGAGGG + Intronic
1124483687 15:30098353-30098375 CTTGGTGGGGGGGGGGGGGGCGG + Intergenic
1124488948 15:30142181-30142203 CCAGGTGGCTGTGGGAGAGAGGG + Intronic
1124519892 15:30398873-30398895 CTTGGTGGGGGGGGGGGGGGCGG - Intergenic
1124521085 15:30407130-30407152 CCAGGTGGCTGTGGGAGAGAGGG - Intronic
1124537577 15:30559090-30559112 CCAGGTGGCTGTGGGAGAGAGGG + Intronic
1124544032 15:30611145-30611167 CCAGGTGGCTGTGGGAGAGAGGG + Intronic
1124563996 15:30798580-30798602 CCAGGTGGCTGTGGGAGAGAGGG + Intergenic
1124754582 15:32396142-32396164 CCAGGTGGCTGTGGGAGAGAGGG - Intronic
1124761079 15:32448497-32448519 CCAGGTGGCTGTGGGAGAGAGGG - Intronic
1124777555 15:32600566-32600588 CCAGGTGGCTGTGGGAGAGAGGG + Intronic
1125200978 15:37100566-37100588 CTGGGGGGGTGGGGGAGGCGGGG + Intronic
1125296786 15:38211932-38211954 AGAGGTGGTTGGGGGAGGGTGGG + Intergenic
1125320671 15:38484423-38484445 AGAGGTGGCTGGGGGGGTGGAGG + Exonic
1125540351 15:40466440-40466462 CTAGGAGGGTGGGGGCGGGAAGG + Exonic
1125722594 15:41852388-41852410 CGGGAGGGCTGGGGGAGGGGAGG - Intronic
1126425553 15:48523701-48523723 AAGGGTGGCTGGGGGGGGGGGGG + Intronic
1126434178 15:48619074-48619096 CAAGGGTGCTGGGGGATGGGGGG - Intronic
1126675678 15:51157771-51157793 GGGGCTGGCTGGGGGAGGGGTGG + Intergenic
1126810987 15:52403806-52403828 AAAAGAGGCTGGGGGAGGGGAGG + Intronic
1127862600 15:63006860-63006882 GTAGGAGTCAGGGGGAGGGGAGG + Intergenic
1127927478 15:63560952-63560974 CTTGGTGGCTGAGGGAGAGTAGG + Intronic
1128113023 15:65088363-65088385 GTAGGAGGCTGGGGTAGTGGTGG + Intergenic
1128877287 15:71212832-71212854 CTGGGTGGCTGGGGGAGCTGAGG + Intronic
1129178788 15:73858645-73858667 CAAGGTGGCTGAGGCAGAGGGGG - Intergenic
1129208006 15:74048589-74048611 CCGGGTGGCGGGGGGGGGGGGGG - Intergenic
1129235897 15:74223579-74223601 ACTGGTGGCTGGGGGAGGGGTGG - Intergenic
1129321512 15:74777597-74777619 CAAAGAGGCTGGGGGAGGGGAGG + Intergenic
1129466000 15:75724477-75724499 CCAAGTGGGTGGGGGAGGAGGGG + Intronic
1129709258 15:77812197-77812219 CCTGGTGGGTGGGGGAGGTGTGG - Intronic
1129825279 15:78630869-78630891 GTTGGAGGCTGAGGGAGGGGAGG - Intronic
1129945653 15:79537489-79537511 CTGGGTGGCTGGGGGCAGGTGGG + Intergenic
1130092326 15:80831303-80831325 ATGGGTGGCTGGGGGATTGGGGG + Intronic
1131035942 15:89222026-89222048 CCTGCTGGCTGGGGGAGGGGTGG - Intergenic
1131666823 15:94579653-94579675 CAAGGTTGATGGGGGGGGGGGGG + Intergenic
1131731617 15:95287642-95287664 CTAGGAGGCTGGGGAGTGGGGGG + Intergenic
1131804469 15:96107202-96107224 CTAGATGGTTGGGGGAGGTTTGG - Intergenic
1131873632 15:96783362-96783384 CTGGGCGGGTGGGGGAGGGGTGG - Intergenic
1132671744 16:1104765-1104787 CAAGGGGGCAGGAGGAGGGGAGG + Intergenic
1132695694 16:1200850-1200872 TTAGCTGGCTGGGGGTGGGGTGG + Intronic
1132870381 16:2113138-2113160 GTAGGTGGGCGGGGGTGGGGAGG - Intronic
1132897217 16:2234794-2234816 GGAGGTGGGAGGGGGAGGGGAGG + Intronic
1132983754 16:2752868-2752890 CGAGCCGGGTGGGGGAGGGGCGG + Intronic
1133006018 16:2882421-2882443 CAAGGTGGCCGGGGTAGTGGGGG + Intergenic
1133420492 16:5642611-5642633 CTGGGTGGCTGGGGAAGGGGGGG - Intergenic
1133767463 16:8848059-8848081 CTAGGGGGCTGGGGGTGGGTGGG - Exonic
1133796264 16:9049005-9049027 AGAGATGGCTGGGGGCGGGGGGG - Intergenic
1133920716 16:10150614-10150636 CTGGGTGGGTAGGGGAGGGTGGG - Intronic
1133950511 16:10387827-10387849 CCGGGTGGCGGGGGGAGGGGGGG - Intronic
1133979451 16:10622446-10622468 CTTGCTGGGTGGGGGTGGGGAGG + Intergenic
1134112643 16:11524745-11524767 CTGGGTGGCTGGAGGGAGGGAGG - Intergenic
1134224415 16:12380415-12380437 CTAGGTGGATGGATGAGGGGTGG - Intronic
1134459426 16:14418773-14418795 CTATGAGGCGGGGGCAGGGGGGG + Intergenic
1134717042 16:16362468-16362490 GTAGGTGGGCGGGGGTGGGGAGG + Intergenic
1134785389 16:16937687-16937709 CTGGGTTGGTGGGGGTGGGGGGG + Intergenic
1134957709 16:18389691-18389713 GTAGGTGGGCGGGGGTGGGGAGG - Intergenic
1135113357 16:19707659-19707681 GTAGGGAGGTGGGGGAGGGGAGG - Intronic
1135139475 16:19909228-19909250 CTAGTTGGGATGGGGAGGGGAGG + Intergenic
1135468896 16:22711967-22711989 CTAAGTGGGTGGGGATGGGGAGG + Intergenic
1135980321 16:27142167-27142189 CTAGATGGGTCGGGGAGGGTTGG - Intergenic
1136624559 16:31454072-31454094 CGAGGTGGGTGGGGGAGGGAAGG + Intergenic
1136707054 16:32200135-32200157 CCAGGGGCCGGGGGGAGGGGCGG + Intergenic
1136760856 16:32729282-32729304 CCAGGGGCCGGGGGGAGGGGCGG - Intergenic
1136807247 16:33141104-33141126 CCAGGGGCCGGGGGGAGGGGCGG + Intergenic
1137870643 16:51947037-51947059 CTAGGTGCCTGGTGGCCGGGTGG - Intergenic
1138242977 16:55443991-55444013 TTGGGTGGCAGGGGGAGGGGAGG + Intronic
1138290683 16:55844226-55844248 TTAGGTGGTTGTGGGAGGGGTGG - Intergenic
1138328432 16:56193368-56193390 CTGGGAGGGTGGGGGAGGAGAGG - Intronic
1138386755 16:56640713-56640735 CAAAGTGACTGGGGGAGTGGAGG + Intronic
1138439708 16:57026662-57026684 CCAGGTGGCTAAGGAAGGGGCGG - Exonic
1138442253 16:57042089-57042111 CTCTGAGGCTGGGGCAGGGGGGG + Intronic
1138465379 16:57186284-57186306 CTAGGGGACTGAGGGAGGGCTGG + Intronic
1138536730 16:57664164-57664186 CTGGGGGGCTGAGGGAGGGAGGG - Exonic
1138659578 16:58509365-58509387 CTAGGTGGTGTGGGGTGGGGTGG - Intronic
1138736067 16:59251629-59251651 GTAGGGGGCTAGGGGAGGGATGG - Intergenic
1138957745 16:61991823-61991845 CTGGGTGGGTTGGGGAGTGGTGG - Intronic
1139485751 16:67255738-67255760 CAGGGAGGCTGGGGGAGGAGTGG - Exonic
1139582924 16:67883941-67883963 CCAGGTAGCTGGGGATGGGGGGG - Exonic
1139646687 16:68336525-68336547 CTAGGTTGCAGGGAGAGGGAGGG - Intronic
1139662426 16:68430176-68430198 GTTAGTGGCTGGGGGAGGGAGGG - Intronic
1139957501 16:70700158-70700180 CTTTGGGGCTGGGGGTGGGGAGG - Intronic
1139982699 16:70872656-70872678 ATAGGTGGATGGTGGATGGGTGG - Intronic
1140269744 16:73454690-73454712 TTGGGTGGGTGGGGGAGAGGGGG - Intergenic
1140328082 16:74025304-74025326 GCAGGGGGCTGGGGGAGGTGAGG - Intergenic
1140406205 16:74713358-74713380 CTGGGAGGCAGGGGGAGGTGAGG + Exonic
1140442285 16:74997632-74997654 GTGGGAGGCTGGGGGTGGGGGGG - Intronic
1140471675 16:75218907-75218929 CTCCCTGGCTGGGGGAGCGGGGG + Intergenic
1141082087 16:81061488-81061510 CTGGGCCGCTGGGGAAGGGGAGG + Exonic
1141490718 16:84370803-84370825 CAAAGTGGCTGGGGGAGGGGAGG - Intronic
1141648619 16:85380510-85380532 CAGGGTGGCGGGTGGAGGGGGGG - Intergenic
1141668767 16:85480556-85480578 CTGGGTGGCGGGGGAAGGTGGGG - Intergenic
1141671765 16:85495852-85495874 CCAGGAGGCTGGAGGTGGGGAGG + Intergenic
1141864438 16:86740507-86740529 CTAGGTGGAGGTGGGAGGGGAGG + Intergenic
1142111476 16:88333824-88333846 CTGCGTGGCAGGGGGTGGGGGGG + Intergenic
1142112487 16:88339777-88339799 CATGGTGGCAGGGGGATGGGGGG + Intergenic
1142185633 16:88693538-88693560 CGCGGTGGCCGGGGGTGGGGAGG - Intergenic
1142213388 16:88819184-88819206 GCAGGTGGCCGGGGGTGGGGAGG - Intronic
1203063008 16_KI270728v1_random:989596-989618 CCAGGGGCCGGGGGGAGGGGCGG - Intergenic
1142465334 17:133956-133978 CTGGGGGGCGGGGGGAGGCGCGG + Intergenic
1143029724 17:3961192-3961214 ATGGGTGGCTGGGGACGGGGCGG + Intronic
1143202916 17:5124299-5124321 CTGGGTGGTTGGGTGGGGGGTGG - Intronic
1143385930 17:6530472-6530494 CTTGGGGAGTGGGGGAGGGGAGG + Intronic
1143480999 17:7227364-7227386 GCAGGTGGCTGGAGAAGGGGAGG - Intronic
1143558356 17:7676462-7676484 CTAGGGGGCTGGGGTTGGGGTGG + Intronic
1143795299 17:9331316-9331338 CTAGGGTGGAGGGGGAGGGGAGG - Intronic
1143815053 17:9506408-9506430 AAAGGTGGGTGGGGGGGGGGGGG - Intronic
1143874488 17:9981545-9981567 GGAGATGGCTGGGGGAGGTGAGG - Intronic
1144062857 17:11598946-11598968 AAAGCTGGGTGGGGGAGGGGAGG + Intronic
1144703243 17:17351915-17351937 CAAGGTGGCGGGGGGCGGGGTGG - Intergenic
1144756505 17:17682906-17682928 GGTGGGGGCTGGGGGAGGGGAGG + Intronic
1145378854 17:22376146-22376168 CTAGCTGGGTGGTGGAGGGTTGG + Intergenic
1145379330 17:22378516-22378538 CTAGCTGGGTGGTGGAGGGTTGG + Intergenic
1145379808 17:22380886-22380908 CTAGCTGGGTGGTGGAGGGTTGG + Intergenic
1145380288 17:22383261-22383283 CTAGCTGGGTGGTGGAGGGTTGG + Intergenic
1145380767 17:22385608-22385630 CTAGCTGGGTGGTGGAGGGTTGG + Intergenic
1145381246 17:22387983-22388005 CTAGCTGGGTGGTGGAGGGTTGG + Intergenic
1145381979 17:22391758-22391780 CTAGCTGGGTGGTGGAGGGTTGG + Intergenic
1145382454 17:22394122-22394144 CTAGCTGGGTGGTGGAGGGTTGG + Intergenic
1145383308 17:22398308-22398330 CTAGCTGGGTGGTGGAGGGTTGG + Intergenic
1145383676 17:22400043-22400065 CTAGCTGGGTGGTGGAGGGTTGG + Intergenic
1145383821 17:22400776-22400798 CTAGCTGGGTGGTGGAGGGTTGG + Intergenic
1145384259 17:22402978-22403000 CTAGCTGGGTGGTGGAGGGTTGG + Intergenic
1145384578 17:22404440-22404462 CTAGCTGGGTGGTGGAGGGTTGG + Intergenic
1145761029 17:27425613-27425635 CTAGGGGGCTGGAGGAGCAGCGG + Intergenic
1146256062 17:31392062-31392084 CGGGGGAGCTGGGGGAGGGGCGG - Intronic
1146646484 17:34580275-34580297 CTCGGCGGCTGGGGCAAGGGTGG - Intergenic
1147250832 17:39151660-39151682 CTGGGTCGGTGGGGGTGGGGGGG + Intronic
1147332928 17:39709537-39709559 GTAGGCGGCTGGGGCAGTGGCGG - Intronic
1147387074 17:40089076-40089098 CAGAGAGGCTGGGGGAGGGGAGG - Intronic
1147817369 17:43219862-43219884 CTAGCTGGCTGGGGGAACGAGGG + Exonic
1147898791 17:43770003-43770025 CTGCGTGGCTGGGGGAGGTGAGG + Intronic
1148142456 17:45338406-45338428 CTCAGTGGCTGGGGGAGGAGTGG - Intergenic
1148194082 17:45700711-45700733 CTAGGTGGCTGGGCCAGGTCGGG + Intergenic
1148345164 17:46898244-46898266 TTTGTTGGCTGGGGGAGGGTGGG - Intergenic
1148441136 17:47712072-47712094 CTCTGTGGCTGGGGGCAGGGCGG + Intergenic
1148691615 17:49530503-49530525 CCAGGGGGTTGGCGGAGGGGAGG - Intergenic
1148783915 17:50135945-50135967 GTACGTGGCTGGGGGCTGGGCGG - Intronic
1148792417 17:50180853-50180875 CTGGGTGGGTGGAGGAGGAGAGG - Intergenic
1148901397 17:50881006-50881028 TTGGGAGGCTGGGGGAGGGGGGG - Intergenic
1149532761 17:57408583-57408605 CTGGGTGGGTAGGGGCGGGGGGG + Intronic
1149596718 17:57868586-57868608 GGAGGTGGCTAGGGGAGGGGCGG - Intronic
1149608307 17:57940478-57940500 CAAGGTTACTGCGGGAGGGGAGG - Intronic
1149737221 17:59007212-59007234 GTGGGTGGGTGGGGGTGGGGTGG - Intronic
1150217336 17:63477842-63477864 CCACGGTGCTGGGGGAGGGGAGG - Intergenic
1150303805 17:64067453-64067475 CCAGGTAGGTGGGGGAGTGGCGG + Intronic
1150811348 17:68359661-68359683 CAATGTGGCTGAGCGAGGGGTGG - Intronic
1150980726 17:70138827-70138849 CTAGTTGGCCTGGGGAAGGGAGG + Intergenic
1151312223 17:73300287-73300309 CTTGGAGGCTGGGGGTGGTGGGG - Intronic
1151315798 17:73321779-73321801 CAAGGTGGCGGGGGAAGGAGAGG - Intergenic
1151349808 17:73525106-73525128 CTTGGTGCCCTGGGGAGGGGTGG - Intronic
1151426239 17:74032759-74032781 GTTAGAGGCTGGGGGAGGGGAGG - Intergenic
1151522687 17:74641577-74641599 CCTAGTGGCTGGGGAAGGGGAGG - Intergenic
1151564993 17:74892993-74893015 CTAGGTGAGTGGGGAGGGGGTGG - Intronic
1152115738 17:78385993-78386015 CAGGGTGCCTTGGGGAGGGGAGG - Intronic
1152241531 17:79163749-79163771 CCAGGTGCCTGAGGGAGGTGGGG - Intronic
1152286353 17:79415382-79415404 CTCCCTGGGTGGGGGAGGGGAGG - Intronic
1152298619 17:79482865-79482887 CAAGCGGGCTGGGAGAGGGGCGG - Intronic
1152336116 17:79701047-79701069 GTAGGAGGGTGGGGGAGAGGAGG + Intergenic
1152336160 17:79701162-79701184 GTAGGAGGGTGGGGGAGGAGAGG + Intergenic
1152344175 17:79741647-79741669 ATGGTGGGCTGGGGGAGGGGGGG - Intronic
1152405632 17:80096486-80096508 CTAGGAAGCTGAGGGAGGGATGG - Intronic
1152468211 17:80477228-80477250 CCCGGGAGCTGGGGGAGGGGAGG - Intronic
1152576298 17:81142773-81142795 CTGGCTGGCTGGGGCGGGGGTGG - Intronic
1152701746 17:81822994-81823016 CCAGGTGGCTGGGGGAGGGCAGG + Intronic
1152888843 17:82868300-82868322 AAAGGTGGCTTGGAGAGGGGTGG + Intronic
1153051668 18:907158-907180 CTCGGAGGCTGGGGTGGGGGTGG + Intronic
1153661104 18:7327123-7327145 GTAGGTGGGTGGGGGAGAGCAGG + Intergenic
1153827904 18:8893662-8893684 CTGTGTGGCTGGAGGAGAGGAGG + Intergenic
1154000144 18:10475782-10475804 CAAGATGGCTGAGGGGGGGGGGG + Intronic
1155083750 18:22435111-22435133 CTAAGTGGGTGGGGGTGAGGCGG + Intergenic
1155326860 18:24673109-24673131 CAAGGGCGGTGGGGGAGGGGAGG - Intergenic
1155392267 18:25350117-25350139 CTAGCTGGCTGCGGCGGGGGCGG - Intronic
1155986220 18:32233502-32233524 CAGCGAGGCTGGGGGAGGGGCGG - Intronic
1156325533 18:36071506-36071528 CCAAGGGGCTGGGGGCGGGGGGG + Intergenic
1156583418 18:38405658-38405680 GTGGGTGGCTGAGGCAGGGGAGG + Intergenic
1157222946 18:45840265-45840287 CTAGGTGGGTGGGGTAGGGTAGG - Intronic
1157257697 18:46153252-46153274 GGAAGGGGCTGGGGGAGGGGAGG + Intergenic
1157300316 18:46474364-46474386 GTAGGGGGCAGGGGGTGGGGAGG + Intergenic
1157977524 18:52342449-52342471 AAAGGTGGGTGGGGGTGGGGGGG + Intronic
1158280533 18:55820777-55820799 CTGTGTGGTTGGGGTAGGGGAGG - Intergenic
1158321329 18:56267571-56267593 GCAGGTGGCTGGGTGACGGGAGG + Intergenic
1158702402 18:59760312-59760334 AGAGCTGGCTGGGGGAGGGAAGG - Intergenic
1159961286 18:74557535-74557557 CTAGGAGAGTGGGGGTGGGGAGG - Intronic
1160019260 18:75167748-75167770 TTAGCTGCCTTGGGGAGGGGAGG + Intergenic
1160048232 18:75407354-75407376 GTTGGTGGATGGGGGTGGGGAGG + Intronic
1160231792 18:77054397-77054419 CCAGGAGGCTGCGGGAGGGAGGG + Intronic
1160246743 18:77165536-77165558 CTATGAGGCTGGGGGAAGGCTGG + Intergenic
1160272888 18:77403696-77403718 CTGGGACCCTGGGGGAGGGGTGG + Intergenic
1160469109 18:79111396-79111418 CTAGGTGGATGGGGATGAGGTGG - Intronic
1160519994 18:79501608-79501630 CTTTTTGGCGGGGGGAGGGGGGG - Intronic
1160585562 18:79911687-79911709 CTAGGGGGGTGGGGGATGGCTGG - Intronic
1160588311 18:79925270-79925292 GCAGGTGGCTGTGGGAGAGGAGG + Intronic
1160747807 19:720069-720091 CGCTGCGGCTGGGGGAGGGGAGG - Intronic
1160789866 19:918396-918418 CAGGGGCGCTGGGGGAGGGGGGG + Intronic
1160832874 19:1111716-1111738 CTAGGAGTCTAGGGGAGGGCAGG - Intronic
1160846373 19:1167962-1167984 CTTGGAGGATGTGGGAGGGGTGG - Intronic
1160864835 19:1251990-1252012 CCAGGAGGCTGGGGGAGGGGAGG + Intronic
1160905985 19:1451943-1451965 CCAGGTGGAGGAGGGAGGGGAGG + Exonic
1160947677 19:1651279-1651301 CTCCGAGGCTGGGGGTGGGGAGG + Intronic
1160990826 19:1859702-1859724 CGTGGTGGCGGGGGGCGGGGTGG - Intronic
1161082794 19:2319802-2319824 CTAGGTGGCCGGGGCCGGGGAGG + Intronic
1161091020 19:2360149-2360171 GCAGGGGGCCGGGGGAGGGGCGG + Intergenic
1161376149 19:3939977-3939999 CTTGGTGTCTGGGGGTGCGGTGG + Intronic
1161523335 19:4738226-4738248 CTGGGTGGCAGGGGTGGGGGTGG + Intergenic
1161851189 19:6738952-6738974 CCAGATGTCTGGGGGAGGGGCGG + Intronic
1161957739 19:7505967-7505989 CTGGGTGGCTGGGTCGGGGGTGG - Exonic
1162016513 19:7849331-7849353 GTAGGTGGCTGGGGGGTGGCTGG + Intronic
1162050461 19:8029407-8029429 CTGGGAGGCTGGGGGGGCGGTGG - Intronic
1162131101 19:8526660-8526682 CTCGCTGGTTGGGGCAGGGGCGG + Intronic
1162403004 19:10457422-10457444 CAAGGTGGGCGGGGGGGGGGGGG + Intronic
1162706056 19:12555590-12555612 CCAGGTGGCTGCGGGAGCGGCGG + Intronic
1162796238 19:13089023-13089045 TTCGGTGGCGGTGGGAGGGGTGG + Intronic
1162806484 19:13140252-13140274 CCAGGAGGCGGGGGGAGAGGAGG - Exonic
1162989706 19:14294103-14294125 CCAGGTGGTGTGGGGAGGGGTGG - Intergenic
1163000437 19:14363525-14363547 TTTGGAGGCTGGGGGTGGGGAGG + Intergenic
1163446790 19:17351684-17351706 CCAGGAGGCTGGAGGAGGGGAGG + Exonic
1163488842 19:17605550-17605572 CTAGGTGGCCTGGGGACTGGAGG - Exonic
1163727725 19:18932199-18932221 CTAGGGGGCGGGGCCAGGGGTGG + Intronic
1164254737 19:23517505-23517527 CCAAGTGGCCGGGGGTGGGGGGG + Intergenic
1164642123 19:29833689-29833711 CTTGGTGCGTGGGGGCGGGGGGG - Intergenic
1164649703 19:29882899-29882921 TTAGCTGGCTGGGGGAGGGGTGG + Intergenic
1164655157 19:29915607-29915629 CCAGTTGGGTGGGGGTGGGGGGG + Intergenic
1164839247 19:31380263-31380285 AGATGTGGCTGCGGGAGGGGAGG + Intergenic
1165007230 19:32817289-32817311 GTAGGGGGCTGGGCGGGGGGTGG - Intronic
1165061806 19:33208423-33208445 CGAGGGGCCTGGGGTAGGGGCGG + Exonic
1165105088 19:33464504-33464526 GCAGGTGGGTGGGGGTGGGGAGG - Intronic
1165313493 19:35041692-35041714 GGAGGGGGCTGGGCGAGGGGCGG - Intronic
1165357427 19:35312531-35312553 CTAGGGGGTGGAGGGAGGGGTGG + Intronic
1165420014 19:35717976-35717998 CGGGGAGGCGGGGGGAGGGGCGG - Intergenic
1165453971 19:35900296-35900318 CTAGGTGTTTGGAGGAGGAGGGG - Intronic
1165504267 19:36214921-36214943 CAAGTTCGCGGGGGGAGGGGAGG + Exonic
1165725112 19:38107269-38107291 CTTGGGGCCTGGGGTAGGGGTGG + Intronic
1165742610 19:38212445-38212467 CAAGGGGGCTGGGGGAGGTGAGG + Intronic
1165906614 19:39198132-39198154 CCAGGTTGCTGAGGGTGGGGAGG + Intronic
1166053652 19:40275755-40275777 TTGGGAGGCTGGGGGGGGGGGGG + Intronic
1166317643 19:41998008-41998030 AGATGGGGCTGGGGGAGGGGAGG - Intergenic
1166338439 19:42122678-42122700 CAAGGTGGCTGGGGGTAAGGGGG - Intronic
1166343115 19:42150422-42150444 GGAGAGGGCTGGGGGAGGGGTGG + Intronic
1166409165 19:42544851-42544873 TTGGGAGGCTGGGGGGGGGGCGG + Intronic
1166798946 19:45444265-45444287 GCGGCTGGCTGGGGGAGGGGGGG - Intronic
1166885683 19:45959667-45959689 ATGGGAGGCTGGGGGCGGGGTGG + Intronic
1167042118 19:47028403-47028425 CTAGGGGGCTGGGGAGGCGGGGG + Intronic
1167065606 19:47183633-47183655 CCAAGTGGGTGGGGGAGTGGGGG - Intronic
1167158727 19:47754655-47754677 GTAGGAGGCCCGGGGAGGGGAGG - Intronic
1167223279 19:48218056-48218078 CAAGGGGCCTGGGAGAGGGGTGG - Intronic
1167270144 19:48501849-48501871 AGAGGTGGCTGGGAGAGGAGGGG - Intronic
1167492933 19:49802289-49802311 CAGGGAGGCTGGGGCAGGGGAGG - Intronic
1167515135 19:49918886-49918908 TTGGGAGGCTGGGGGGGGGGGGG + Intronic
1167631826 19:50630261-50630283 CCACCTGGCTGGGGGATGGGGGG - Intronic
1167650839 19:50727749-50727771 CCAGGTGCGTGGGGGAGGGCAGG + Intergenic
1168241831 19:55092537-55092559 CCAGGGTGCTGGGGCAGGGGAGG + Exonic
1168350648 19:55674067-55674089 AGAGGCGGCTGGGGGAGGGTGGG + Exonic
925147207 2:1589134-1589156 CAAGGAGGCTGGGGGTGTGGAGG + Intergenic
925151034 2:1615069-1615091 CCAGGTTGCTGGGAGAGGTGAGG + Intergenic
925697711 2:6598787-6598809 CTAGGTGGCTCTGGGATGGCAGG - Intergenic
925830006 2:7884471-7884493 CCAGGAGCCTGGGGGTGGGGAGG + Intergenic
926195744 2:10762747-10762769 CTGGGTGGCTGGGTGGAGGGAGG - Intronic
926205620 2:10832919-10832941 CTCAGTGGCTGGGGGGGCGGGGG - Intronic
926224144 2:10955416-10955438 CTAGCTGGCTGGGGCTGGGTGGG - Intergenic
926519281 2:13889980-13890002 GTAGTTGGATGGTGGAGGGGAGG + Intergenic
927334755 2:21908901-21908923 CAGTGAGGCTGGGGGAGGGGCGG - Intergenic
927461712 2:23305032-23305054 CTATGTGGGTGGTGGAGGGAGGG - Intergenic
927650237 2:24908622-24908644 TTACCTGGTTGGGGGAGGGGTGG - Intronic
928118853 2:28567050-28567072 CTTGGGGGCCGGGGGCGGGGAGG + Intronic
928280408 2:29941327-29941349 TGTGGTGGCAGGGGGAGGGGTGG + Intergenic
928452563 2:31389432-31389454 CAAGGTGGCTGGCTGGGGGGAGG - Intronic
928511564 2:32009364-32009386 CTAGGGGCTTGGGGGTGGGGGGG - Intronic
928582182 2:32719873-32719895 ATATTTGGCTGGGGGATGGGAGG - Intronic
928857717 2:35819246-35819268 CCAGCTGGCTGGGTGAGGGCAGG + Intergenic
929053453 2:37856818-37856840 CTTGGTGGCTGGGGTGGAGGAGG - Intergenic
929099863 2:38301511-38301533 CTGAGAGGATGGGGGAGGGGTGG - Intronic
929147809 2:38722036-38722058 CTAGGTGGGGGGGGGGGGTGGGG - Intronic
929198058 2:39206480-39206502 CTAGGGGCCTGGGTGAGGGCAGG + Intronic
929487713 2:42369705-42369727 TTAGAGAGCTGGGGGAGGGGTGG + Intronic
929570950 2:43022454-43022476 CTGGGAGGTTGGGGGGGGGGGGG + Intergenic
929626237 2:43410720-43410742 CCAGGGAGGTGGGGGAGGGGAGG + Intronic
930136365 2:47906549-47906571 CGGGGCGGCGGGGGGAGGGGTGG + Intergenic
930244049 2:48965152-48965174 AAAGGTGGCTAGGGGAGTGGAGG + Intronic
930290769 2:49490740-49490762 CTGGGTGGATGTGGCAGGGGTGG - Intergenic
930366807 2:50449529-50449551 GTAGGTGTGTGGGGGAGGGAAGG + Intronic
930730748 2:54725175-54725197 CTTTGTGGCTGGGGTCGGGGTGG + Exonic
931005291 2:57843623-57843645 CTGGTTGGCGGGGGGCGGGGGGG + Intergenic
931039083 2:58276536-58276558 CTAGCTGCTTGGGGGTGGGGGGG - Intergenic
931254325 2:60556751-60556773 AAATCTGGCTGGGGGAGGGGCGG - Intergenic
931377317 2:61719018-61719040 ATGGGGGCCTGGGGGAGGGGAGG - Intergenic
931809473 2:65840930-65840952 CCAGGAGGTTGGGGGTGGGGTGG - Intergenic
931932413 2:67154184-67154206 GTAGGGGGCTGGAGGAGAGGTGG + Intergenic
932116798 2:69058020-69058042 CTAGAAGGCTGAGAGAGGGGAGG + Intronic
932292554 2:70594777-70594799 CAATGTGGCTGGGGTAGGGATGG - Intergenic
932338333 2:70943643-70943665 CCTGTAGGCTGGGGGAGGGGCGG - Exonic
932493231 2:72134308-72134330 CTAGGGGGCGGGGGGGAGGGTGG + Intronic
932586942 2:73036339-73036361 CCAGGAGGCTGGGGGAAGGGAGG + Intronic
933653108 2:84864905-84864927 CTAGGTGGATGCTGGAGGAGTGG - Intronic
933722832 2:85409303-85409325 CCATGGGGCTGGGGGAGGGGAGG + Intronic
933729475 2:85446187-85446209 CTAGGAGGCTGAGGCAGAGGGGG - Intergenic
933887289 2:86730260-86730282 TTTGGGGGGTGGGGGAGGGGGGG + Intronic
933922886 2:87066453-87066475 TTTGGGGGGTGGGGGAGGGGGGG - Intergenic
933943656 2:87266178-87266200 TGAGGTGGCTGTGGGAGAGGAGG + Intergenic
934260971 2:91477360-91477382 CGAGGCGGCGGGGGGCGGGGGGG - Intergenic
934299565 2:91769027-91769049 CCAGTGGCCTGGGGGAGGGGCGG - Intergenic
934857909 2:97740180-97740202 CCAGCTGGATGGGGGAGGGGGGG - Intergenic
935196486 2:100819793-100819815 CGCCGGGGCTGGGGGAGGGGGGG - Intergenic
935314431 2:101817485-101817507 CTGGATGGATGGGGGTGGGGAGG - Intronic
935341824 2:102065618-102065640 CTAGGAAGCTGGGAGAGGGTTGG - Intronic
935739174 2:106131314-106131336 CAACGAGGCTGGGGGAGGGGCGG + Intronic
936090973 2:109501175-109501197 CTAGGTGGGTGGGCCAGGGCAGG + Intronic
936231166 2:110700580-110700602 CTAGTTGGCTGGGGTTGGGATGG + Intergenic
936336564 2:111595401-111595423 TGAGGTGGCTGTGGGAGAGGAGG - Intergenic
937149943 2:119679356-119679378 GCCGGTGGCTGGGGGAGGAGGGG - Exonic
937351021 2:121161956-121161978 CGTGGTTGCTGTGGGAGGGGAGG - Intergenic
937366201 2:121263845-121263867 CTGGGTGCCTGGGGCAGAGGTGG + Intronic
937369515 2:121287572-121287594 CCAGGCGGAAGGGGGAGGGGAGG - Intergenic
937432285 2:121848917-121848939 CTAGATGTCTGGTGAAGGGGAGG + Intergenic
937884919 2:126893170-126893192 CTTGGAGGATGGGGGTGGGGTGG + Intergenic
937991389 2:127664283-127664305 GTAGGTGGCCAGGGGCGGGGCGG - Intronic
938027301 2:127961244-127961266 CTAGAGGGGTTGGGGAGGGGAGG - Intronic
938081983 2:128374935-128374957 GTAGGTGGGTGGGGGAGAGGGGG + Intergenic
938107709 2:128544646-128544668 CCAGGAGGTGGGGGGAGGGGAGG + Intergenic
938122308 2:128642591-128642613 CTAAGAGGCTAGAGGAGGGGAGG - Intergenic
938140125 2:128788032-128788054 CTAGGAGTCTGGGGGCGGAGGGG - Intergenic
938157458 2:128953299-128953321 ATGGGTGGCTGGGGGCGGGGAGG + Intergenic
938301732 2:130219342-130219364 CCAAGTGGCTGGGAGAGGGAAGG - Intergenic
938454968 2:131455109-131455131 CCAAGTGGCTGGGAGAGGGAAGG + Intergenic
938802845 2:134778602-134778624 ATAGGTGGCAGGTGGTGGGGCGG - Intergenic
938982389 2:136539059-136539081 CTTTGAGGCCGGGGGAGGGGAGG - Intergenic
939105322 2:137942187-137942209 CCAGGAGGCTGGGGGTGGAGAGG + Intergenic
939148439 2:138444595-138444617 CTAGTGAGCTGGGGGTGGGGTGG - Intergenic
939540161 2:143484120-143484142 TTGGGAGGCTGGGGGTGGGGTGG + Intronic
939600505 2:144183804-144183826 CAAGTTGGTTGGGGGTGGGGAGG - Intronic
939800107 2:146697851-146697873 AAAGGTGGCGGGGGGCGGGGGGG + Intergenic
940033579 2:149289897-149289919 CTTGGTGGTGGAGGGAGGGGTGG + Intergenic
940453926 2:153872611-153872633 GTTGGTGGCGGGGGGGGGGGGGG + Intronic
941020717 2:160405902-160405924 TGAGGTGGGTGGGGGAGGAGGGG + Intronic
941168481 2:162109087-162109109 CTAGGTGACTGGGTGGGTGGAGG - Intergenic
942068667 2:172295781-172295803 CTTGGTGGCTGAGGCAGGTGTGG + Intergenic
942315437 2:174693006-174693028 CGTGGTGACTGGGGGGGGGGGGG - Intergenic
942482844 2:176407493-176407515 TTGAGAGGCTGGGGGAGGGGCGG - Intergenic
942749932 2:179276223-179276245 CCCGGGGGATGGGGGAGGGGTGG - Intergenic
942891125 2:180990160-180990182 CCTGGTGGCTGGGGAAGGGGAGG - Intronic
943247379 2:185473153-185473175 CCAGGGGGCTGAGGGAGGGCGGG + Intergenic
943369596 2:187001495-187001517 CTCGGGGGCTGGGGGCAGGGAGG + Intergenic
943767597 2:191678804-191678826 CCACGTGGGTGGGGGAGGGGAGG - Intronic
944115213 2:196178514-196178536 TTGGGAGGCTGGGGGAAGGGGGG - Intergenic
945068857 2:205971250-205971272 CCAGGAGGCTGGGGCAGGAGGGG - Intergenic
945102574 2:206275156-206275178 CGAGGTGGCGGGGCGAGGGAAGG + Intronic
945231043 2:207590330-207590352 GAGGGTGGCTGGGGTAGGGGTGG - Intronic
945945936 2:215995502-215995524 ATTGGTGGCGGGGGGTGGGGTGG - Intronic
946248440 2:218399922-218399944 CTAGGGGGGAGGGGGAGGGAGGG - Exonic
946370799 2:219280178-219280200 CTAGGGGGAAGGGGGAGGGGAGG - Intronic
946372851 2:219290965-219290987 CTGGAGGCCTGGGGGAGGGGAGG + Intronic
946540363 2:220677491-220677513 GTAGGGGGCTGGGGCAGGTGAGG - Intergenic
946913998 2:224496698-224496720 CATGGGGGCTGGGGGAGGAGGGG + Intronic
947749734 2:232525976-232525998 CTCGGAGGCGGGGGGTGGGGAGG - Intronic
947865787 2:233397194-233397216 CAGGGTGGCTGGGGGGGGGGGGG + Intronic
948025512 2:234773035-234773057 CATGTTGGCTGGGGGAGGTGGGG - Intergenic
948375645 2:237518664-237518686 CGAGGTGGCTGAGGAGGGGGTGG - Intronic
948431155 2:237919881-237919903 TTAGGTGGCAGGGGCAGGGCTGG - Intergenic
948473837 2:238203761-238203783 CGGGGCGGCTGGGGGCGGGGCGG + Intergenic
948505024 2:238422660-238422682 CTTGGGAGCTGGAGGAGGGGAGG + Intergenic
948753394 2:240145029-240145051 CCAGGGGGATGGGGGCGGGGTGG - Intergenic
948778905 2:240305005-240305027 CCACGTGGCTGGAGGAGGTGAGG - Intergenic
948814340 2:240502279-240502301 CTGGGAGCCTGGGGGTGGGGTGG - Intronic
948837161 2:240631392-240631414 CCAGGTGGGTGGGGGTGGGAAGG - Intergenic
948878201 2:240841363-240841385 CAAGGAGGCTGGGAGATGGGGGG - Intergenic
948889331 2:240899266-240899288 ACAGGTGGCTGGGCTAGGGGAGG - Intergenic
948925623 2:241095065-241095087 CAAGGTGGGTGTGGGGGGGGGGG - Exonic
948958574 2:241315042-241315064 CGACGTGGCTCGGGGACGGGAGG - Intronic
949014063 2:241699672-241699694 GGATGTGGCTGGGGGTGGGGCGG + Intergenic
1168793494 20:595922-595944 GAAGGTGGGTGGGGGTGGGGAGG + Intergenic
1168999893 20:2161206-2161228 GTATGTGGCTGGGGTAGGGCAGG - Intronic
1169068464 20:2707573-2707595 GGAGGATGCTGGGGGAGGGGAGG + Intronic
1169087400 20:2835982-2836004 ATAGGAGGCTGGGTAAGGGGAGG + Intronic
1170460840 20:16574997-16575019 CTAGCTGGCTGGGGCAGGGGAGG + Intergenic
1170569707 20:17625789-17625811 CTGGATGGCGGGGGGAGGGGAGG - Intronic
1170781724 20:19431288-19431310 CAAGGGAGCTGGGGGAGGGTTGG + Intronic
1172011148 20:31846627-31846649 CTAGGAGGATGGGGTAGGAGTGG - Intergenic
1172017384 20:31885839-31885861 ATAGGTGACTTGGAGAGGGGAGG + Intronic
1172041707 20:32051247-32051269 GGAGGTGGTCGGGGGAGGGGAGG - Intergenic
1172057534 20:32164947-32164969 CGGAGTGGGTGGGGGAGGGGAGG - Intronic
1172095296 20:32457387-32457409 CAGAGTGGGTGGGGGAGGGGTGG + Intronic
1172466111 20:35155704-35155726 CTGGCTGGCGGGGAGAGGGGTGG + Intergenic
1172628981 20:36365824-36365846 CTAGGGGGCTCTGGGATGGGAGG - Intronic
1172936287 20:38622868-38622890 AAAGCTGGCTGGGAGAGGGGAGG + Intronic
1173387594 20:42603348-42603370 CCAGGGGGCTAGGGGTGGGGTGG + Intronic
1173441329 20:43079175-43079197 AGAGGGGGCTGGGGGGGGGGAGG - Intronic
1173571043 20:44076318-44076340 GTAGGTGGCGGGGGGGGGGGGGG - Intergenic
1173622921 20:44450220-44450242 CTGGGTAGCTGGGGTCGGGGTGG + Intergenic
1174017809 20:47502468-47502490 CTGGGAGGCTGGGGTGGGGGGGG - Intronic
1174053866 20:47785298-47785320 GTGGGTGGCTGGGGGACGCGGGG - Intronic
1174390478 20:50215848-50215870 CTGGGGGGCTGGGGGTGGGAGGG + Intergenic
1174446944 20:50596832-50596854 CTCGGGGGCTGGGGCAGGTGAGG + Intronic
1175319386 20:58074605-58074627 CTTGATGGCAGGGGGAGTGGTGG + Intergenic
1175337667 20:58206739-58206761 GTGGCTGGCTGGGGGAGGGGAGG - Intergenic
1175345279 20:58268598-58268620 CTAGCTGGATGGAGGAGGTGAGG + Intergenic
1175776992 20:61659757-61659779 CTTGGAGGCAGGAGGAGGGGTGG + Intronic
1175780021 20:61676414-61676436 GAAGGTGGATGGGGGAGGGATGG + Intronic
1175798664 20:61788328-61788350 CTGAGGGGCTGGGGGAGGGCTGG + Intronic
1175817307 20:61889986-61890008 ATAGGTGGCTGATGGATGGGTGG + Intronic
1175901330 20:62361019-62361041 CTAGGGGGCTGGGCTGGGGGAGG - Intronic
1176273400 20:64248263-64248285 CTGGGTGGCTGGGGTGGGCGGGG - Intergenic
1176309699 21:5143008-5143030 AAAGGTGGCTGGAGGAGGGGAGG + Intronic
1177080372 21:16632003-16632025 TCAGGTGGCTGGGGCAGAGGTGG - Intergenic
1177524469 21:22273873-22273895 GTAGGTGGCTGGGGGAGGGATGG + Intergenic
1177833697 21:26168991-26169013 CTAGGAGGCTGGGGGAAAAGAGG + Intronic
1178123142 21:29489815-29489837 CTAGGGGTCTGGGGTAGGGCTGG + Intronic
1178702851 21:34848184-34848206 CAAGGAGGCTGAGGGTGGGGAGG + Intronic
1179309757 21:40185246-40185268 CTGGGTGGCTCAGGGAAGGGAGG + Intronic
1179449692 21:41460056-41460078 CTAGATGGATGGGGCAGGAGAGG + Intergenic
1179481819 21:41683114-41683136 CTCGGTGGCCAGGGGTGGGGTGG + Intergenic
1179494681 21:41764139-41764161 CTAAGTGTCTGGGGGCTGGGCGG + Intronic
1179513366 21:41889876-41889898 TTGGGAGGCTGAGGGAGGGGTGG - Intronic
1179643148 21:42760258-42760280 CTGGGTGGCTTTGGGAGGAGAGG + Intronic
1179729293 21:43358683-43358705 GAAGGTGGGTGGGGGAGTGGGGG + Intergenic
1179788691 21:43743455-43743477 CTCGGGGGCTGGGGGGAGGGAGG - Intronic
1179802259 21:43816601-43816623 CCAGGGGGGTTGGGGAGGGGTGG - Intergenic
1179847359 21:44119025-44119047 AAAGGTGGCTGGAGGAGGGGAGG - Intronic
1179893631 21:44350015-44350037 CCAGGTCTCTGGGGGAGGGCGGG + Intergenic
1180965802 22:19787412-19787434 CCAGGTGGCCGGAGCAGGGGTGG - Exonic
1180999771 22:19982554-19982576 CAAGGTGTCTGGGGCAGGTGAGG - Intronic
1181034084 22:20161613-20161635 GTTGGGGGCTGGGGGAGGGAAGG + Intergenic
1181293804 22:21818915-21818937 GTCGGGGGCTGGGGGAGGGGAGG + Intronic
1181387702 22:22557871-22557893 AGAGGAGGCTGGGGGTGGGGAGG + Intronic
1181534404 22:23534155-23534177 AAAGGGGGGTGGGGGAGGGGTGG + Intergenic
1181652220 22:24265849-24265871 TTTGGTGGTTGTGGGAGGGGTGG - Intergenic
1181697923 22:24603126-24603148 CTAGTGGCCTGGGGGCGGGGCGG - Intronic
1181980280 22:26761246-26761268 CTGGGTGTCTGTGGGAAGGGTGG + Intergenic
1182393778 22:30020683-30020705 CCAGGTGGCTGCGGGAAGGCTGG - Exonic
1182541683 22:31046541-31046563 CTCTGGGGCCGGGGGAGGGGGGG - Intergenic
1182649465 22:31839519-31839541 CTAGGTGATCAGGGGAGGGGGGG - Intronic
1182777509 22:32841680-32841702 GTTGGTGGGTGGGGTAGGGGAGG + Intronic
1182796354 22:32994271-32994293 CCTGGTGTCTGGGGGAGGGAGGG - Intronic
1182801493 22:33035331-33035353 TTTGGTGGCGGGGGGGGGGGGGG - Intronic
1183010722 22:34944426-34944448 CATGGTGGCGGGGGGCGGGGGGG - Intergenic
1183307136 22:37088598-37088620 GCAGGTGGTTGGGGGTGGGGAGG - Intronic
1183311023 22:37109573-37109595 CTGGCTGGGTGGGGGTGGGGAGG - Intergenic
1183410764 22:37653875-37653897 TGAGTTGGCTGTGGGAGGGGAGG + Intronic
1183427336 22:37746740-37746762 CTAGGGGGCTGGAGGGGAGGTGG - Intronic
1183439113 22:37813213-37813235 CTGGAAGGCTGGGGGAGGCGGGG + Intronic
1183623258 22:38986925-38986947 CTGGGTGGCTGGGGACGGGGGGG + Intronic
1183668155 22:39256936-39256958 GTAGGGTGCTGGGGGAGGGAGGG - Intergenic
1183831557 22:40420797-40420819 CAGGGTGGCTCGGGGAGGGCAGG + Intronic
1183852030 22:40598199-40598221 CTAGGAGGCTGGGGAGGGGCGGG - Intronic
1184000758 22:41671654-41671676 CAAGGTGGCGGGGGGAGGCGGGG + Intergenic
1184120137 22:42444667-42444689 CAGGAAGGCTGGGGGAGGGGCGG - Intergenic
1184289984 22:43493475-43493497 GGTGGAGGCTGGGGGAGGGGTGG - Intronic
1184301104 22:43561540-43561562 CTGGGTGTGTGGGGGCGGGGCGG - Intronic
1184453627 22:44597162-44597184 GAACGTGGCTGGGGGAGGGAGGG + Intergenic
1184484028 22:44765475-44765497 CTAGGGGCCCTGGGGAGGGGTGG + Intronic
1184531845 22:45061380-45061402 GCAGCTGGCTGTGGGAGGGGAGG - Intergenic
1184569877 22:45315758-45315780 CTACCTGGCTGGGGAAAGGGTGG + Intronic
1184653902 22:45931775-45931797 CTGGGAGGCTGGCAGAGGGGAGG - Intronic
1184698357 22:46151683-46151705 CAAGGAGGCTGGGAGAGGAGGGG - Intronic
1184769669 22:46589861-46589883 CTGAGGGGCTGAGGGAGGGGAGG - Intronic
1185012576 22:48322535-48322557 CCAGGTGTCTGGGGGGCGGGAGG + Intergenic
1185082152 22:48715456-48715478 CGAGGAGGCTGGGGGTGGGGCGG + Intronic
1185114800 22:48926608-48926630 GTAGGTGGGGAGGGGAGGGGAGG - Intergenic
1185204159 22:49528388-49528410 AGAGGTGGCTGGGAGAGGGGAGG - Intronic
1185248968 22:49789669-49789691 GTAGGTGGTTGGGGGAAGGGGGG - Intronic
1185313725 22:50170183-50170205 CTGCGTGGCGGGGGGCGGGGTGG + Intergenic
1185321576 22:50202446-50202468 GCAGGTCGCTGGGGGTGGGGAGG - Intronic
1185323752 22:50215626-50215648 CCAGGGGGGTGGGGGGGGGGGGG + Intronic
1185346814 22:50314014-50314036 CTCGGTGTCTGGGGGGTGGGTGG - Intronic
949156461 3:832556-832578 GTAGGGGACTGGGGGAGAGGTGG + Intergenic
949540588 3:5029106-5029128 TTGGGAGGCTGGGGGGGGGGGGG - Intergenic
949556358 3:5156841-5156863 TTGGGAGGCTGGGGGCGGGGAGG - Intronic
950065597 3:10109043-10109065 CTGGATGGCTGAGGGAAGGGAGG + Intergenic
950090663 3:10291948-10291970 CTGGGTGGCTTGGGGGAGGGTGG + Intronic
950107019 3:10394755-10394777 CTGGCTGGCAGGGGGAAGGGAGG + Intronic
950122255 3:10489641-10489663 ATAGGAGGCAGGGAGAGGGGAGG - Intronic
950177203 3:10883043-10883065 CAAGGGGGCGGGGGGCGGGGAGG + Intronic
950484121 3:13262876-13262898 GGAAGTGGCTGGGGGAGGGGAGG + Intergenic
950486709 3:13278251-13278273 TAAGGAGGCTGGGGGTGGGGGGG - Intergenic
950521115 3:13498612-13498634 AAAGGGGGCTGGGGGAGGGCGGG + Intronic
950831572 3:15879914-15879936 CTGGGGGGCTGGGGGCAGGGAGG - Intergenic
950991355 3:17441538-17441560 CAAGGTGGCTGGAGGACTGGGGG + Intronic
952382515 3:32816542-32816564 GGAGGGGGCTGGGGGAGGGGAGG - Intergenic
953339696 3:42123099-42123121 GTAGGAAGCTGCGGGAGGGGTGG + Intronic
953344005 3:42160120-42160142 CTATGAGCCTGGAGGAGGGGCGG - Intronic
953407877 3:42668561-42668583 CTGGGTGGCTGTGGGATGGTGGG + Intergenic
953865130 3:46577121-46577143 CCAGGTGCCCGGGAGAGGGGAGG - Intronic
954012221 3:47651426-47651448 CTCGATTGGTGGGGGAGGGGAGG - Intronic
954054758 3:48012655-48012677 GTGTGTGGCTGGGGGCGGGGTGG - Intronic
954210345 3:49093726-49093748 CCCTGTGGATGGGGGAGGGGTGG - Intronic
954434895 3:50490775-50490797 CTATGTGGCTGGGAGGGGTGGGG - Intronic
954478460 3:50772304-50772326 GTGGGTGGCTGGGTGAGGGGAGG + Intronic
954608849 3:51933715-51933737 CCTGGTGGCTGGGGTAGGGCAGG - Exonic
954661451 3:52229015-52229037 CTAGGAGGCTGGAGCAGGGCCGG - Exonic
954706702 3:52484855-52484877 CAAGGTGGGTGGGGAAGGGAAGG - Intronic
954715421 3:52524415-52524437 CTGGGTGGATGGGGCAGGAGGGG + Exonic
955067670 3:55546802-55546824 GTAAGTGGCTGGGTTAGGGGTGG - Intronic
956747534 3:72321421-72321443 CATGGAGGCTGGGGTAGGGGAGG + Intergenic
956750367 3:72340039-72340061 ATAGCTGGGTGGGGGTGGGGCGG + Intergenic
956845067 3:73175087-73175109 CAAGGGGGCTGGGGGCAGGGTGG - Intergenic
957424936 3:80025322-80025344 TTGGGAGGCTGGGGGGGGGGGGG - Intergenic
957613926 3:82505261-82505283 CTTGGTGGCTGGGGTGGGGGTGG - Intergenic
958560774 3:95744849-95744871 GCAGGCGGCTGGGGGAGGTGGGG - Intergenic
958917401 3:100064871-100064893 CCAGGGGCCTGGGGGTGGGGTGG + Intronic
960286563 3:115836657-115836679 CTAAGTGGGTGGGCGAGGGGAGG + Intronic
960815027 3:121663381-121663403 CTGGTAGGATGGGGGAGGGGAGG + Exonic
960869881 3:122238186-122238208 CTGGGGGGATAGGGGAGGGGTGG - Intronic
960955330 3:123027273-123027295 CGAGGTGGCAGCGGGAGGCGCGG + Intronic
961180583 3:124873423-124873445 GTATGTAGGTGGGGGAGGGGAGG - Intronic
961660952 3:128468604-128468626 CAGGGTGGCCGGGGGTGGGGTGG - Intergenic
961754679 3:129121070-129121092 GTGGGTTGCTGGGGGGGGGGGGG - Intronic
961952173 3:130761745-130761767 CCAGGGGGATGGGGGAGGAGTGG - Intergenic
962312218 3:134334648-134334670 CAAGGAGGCTGCGGGAAGGGTGG + Intergenic
962493038 3:135911928-135911950 CATGGTGGCTGGGGTAGGGGTGG - Intergenic
963289211 3:143470186-143470208 CTTTCCGGCTGGGGGAGGGGTGG + Intronic
963514683 3:146293606-146293628 CAGCGAGGCTGGGGGAGGGGCGG - Intergenic
963514692 3:146293629-146293651 CAGCGAGGCTGGGGGAGGGGCGG - Intergenic
965264030 3:166518119-166518141 GTTGGGGGCTGGGGGAGGGGTGG - Intergenic
966313871 3:178624720-178624742 CTTGGGGGCTCAGGGAGGGGTGG + Intronic
966749565 3:183309317-183309339 CTAGGGGGCTGGGGGTTGTGGGG - Intronic
967148419 3:186626391-186626413 GAAGGTGGCTGAGGCAGGGGAGG - Intergenic
967239142 3:187419168-187419190 CCAGTTGGCTGGGCGAGGGGAGG + Intergenic
967278984 3:187804416-187804438 CTAGGGTGCTGGGGGTGGGCAGG + Intergenic
967569879 3:191016149-191016171 CAGTGAGGCTGGGGGAGGGGCGG - Intergenic
967858633 3:194135679-194135701 AAAGGGGGCGGGGGGAGGGGGGG - Intergenic
967904130 3:194486892-194486914 CTACGTCGCTGGCGGCGGGGGGG - Intronic
967950623 3:194837605-194837627 GTAGGTGGTTGGGGGAGGGCTGG + Intergenic
968181148 3:196596259-196596281 CTCTGTGGCTGGGGGATGAGGGG + Intergenic
968287338 3:197516760-197516782 CTCAGTAGGTGGGGGAGGGGTGG - Intronic
968539152 4:1154251-1154273 CTGGGTGGGTGGGGGAGAGCTGG + Intergenic
968771915 4:2512848-2512870 GTAGGGGCCTGGGGGAGGGCAGG + Intronic
968905150 4:3447439-3447461 CCCGGTGGCTGGGGGAGGGCTGG + Intronic
968912421 4:3483050-3483072 CTAGGTGGCCAGGGGTGTGGAGG + Intronic
968924544 4:3540150-3540172 CTAGAAGGCGGGGGGTGGGGGGG - Intergenic
969315959 4:6381447-6381469 CTGGGTGGCAGGGGTAGGTGTGG - Intronic
969409806 4:7020452-7020474 CCCTGTGGTTGGGGGAGGGGCGG + Intronic
970119782 4:12740714-12740736 CTGGGAGGCTGGGGGACTGGGGG + Intergenic
970791177 4:19859900-19859922 GTGGGTGGCGGGGGTAGGGGAGG - Intergenic
970878242 4:20897505-20897527 GTGGGTGGCGGGGGGAGGGAGGG - Intronic
971499958 4:27308176-27308198 AAAGGAGGATGGGGGAGGGGAGG - Intergenic
972450005 4:39187572-39187594 TTAGGTGGGTGGGGCAGGGCAGG - Intronic
973748247 4:53985697-53985719 TTAGGAGGCTGAGGCAGGGGTGG - Intronic
975633072 4:76421234-76421256 CTTCGTAGTTGGGGGAGGGGAGG + Intronic
976379198 4:84380047-84380069 CCAGGGGTCTGGGGGTGGGGTGG - Intergenic
976832953 4:89335707-89335729 CAAGGTGGCAGGTGGAGGGAAGG - Intergenic
977689925 4:99894566-99894588 CGCGGTGGGCGGGGGAGGGGCGG - Intergenic
977839519 4:101685371-101685393 ATAGGTGGCAGATGGAGGGGAGG - Intronic
977897416 4:102380455-102380477 CAGCGAGGCTGGGGGAGGGGCGG - Intronic
978268557 4:106859035-106859057 GTAAGGGGATGGGGGAGGGGAGG + Intergenic
978620073 4:110628998-110629020 CGCGGGGGGTGGGGGAGGGGAGG + Intronic
978620543 4:110631861-110631883 TTGGCTGGTTGGGGGAGGGGCGG - Intronic
979274826 4:118803407-118803429 CTAGGGAGATGGGGGAGGGGAGG - Intronic
979347123 4:119601439-119601461 GGAGGTGGCGGGGGGTGGGGTGG - Intronic
980173557 4:129318102-129318124 TTGGGAGGCTGGGGGGGGGGGGG - Intergenic
980482542 4:133405551-133405573 ATTTGGGGCTGGGGGAGGGGTGG - Intergenic
980542048 4:134208194-134208216 CAGCGAGGCTGGGGGAGGGGCGG + Intergenic
980613286 4:135185339-135185361 GCAGGTGGCGGGGGAAGGGGCGG - Intergenic
982033532 4:151324762-151324784 CTCGGCGGCTGGGGGAGGGAGGG + Intronic
982112565 4:152070421-152070443 GTTGGAGGCTGGGGGAGGTGAGG - Intergenic
982435908 4:155383429-155383451 GTGGGAGGCGGGGGGAGGGGCGG - Intergenic
982777385 4:159455753-159455775 CTGGGGGGCGGGGGGAGGGGGGG - Intergenic
982831052 4:160061303-160061325 GTGGGTGGCTAGGGGAGGGATGG - Intergenic
983076878 4:163337379-163337401 GTAGGAGGCTGGGAGAGGGGTGG - Intronic
983495935 4:168442412-168442434 CAGCGAGGCTGGGGGAGGGGCGG + Intronic
983938833 4:173521708-173521730 CTGGAGGGCTGGGGGAAGGGAGG + Intergenic
983948073 4:173608769-173608791 TAATGAGGCTGGGGGAGGGGCGG - Intergenic
1202764990 4_GL000008v2_random:141968-141990 TTAGATGGTTGGGGGTGGGGAGG - Intergenic
985574165 5:665886-665908 GGTGGTGCCTGGGGGAGGGGTGG - Intronic
985611377 5:891534-891556 CTGCGTGGCTGGAGGAGGGGAGG - Intronic
985625477 5:983085-983107 CTGGATGGCTGGGGGTGGAGTGG + Intergenic
985648346 5:1095622-1095644 CGAGGTGGCCGGAGGAGGGCAGG + Intronic
985783971 5:1884808-1884830 GAAGGAGGGTGGGGGAGGGGAGG - Intronic
985784872 5:1888152-1888174 CGAGGTGGCGGGGGCAGGGTAGG - Intergenic
985877337 5:2609988-2610010 CTTGGGGGCGGGGGGGGGGGGGG + Intergenic
986348671 5:6857193-6857215 GAAGGTGGCAGGGGGTGGGGGGG + Intergenic
986731423 5:10637461-10637483 CACGGCGGCGGGGGGAGGGGTGG + Intronic
986799733 5:11246715-11246737 GTAGGTGGGTGGGGGGGTGGGGG + Intronic
987201946 5:15586260-15586282 CAAGGGGGAGGGGGGAGGGGAGG - Intronic
987523083 5:19012603-19012625 TTGGGTGGGTGGGGGTGGGGTGG - Intergenic
988183228 5:27825406-27825428 TTGGGTGGGTGGGGGTGGGGGGG + Intergenic
989255774 5:39364475-39364497 CTGGGTGGCTGCGAGTGGGGTGG + Exonic
989983238 5:50667250-50667272 GTCTGTGGCTGGGGGTGGGGTGG + Intronic
990278850 5:54228487-54228509 CTGGGTGGGTGGGGGTGGGGGGG - Intronic
990449100 5:55918794-55918816 CTGGGTGGGTGGTGGGGGGGTGG - Intronic
990509922 5:56481004-56481026 CTTGGGGGGTGGGGGCGGGGCGG - Intronic
991274727 5:64831320-64831342 CATGGTGGTGGGGGGAGGGGAGG - Intronic
992109789 5:73482091-73482113 CAAGGTGGCTGGGAAAGAGGCGG + Intergenic
992171449 5:74105817-74105839 TGAGGTGGTTGGGGGAGGGGGGG - Intergenic
992350119 5:75920477-75920499 CTGGGTGGCTGTGGTTGGGGGGG - Intergenic
993705011 5:91160031-91160053 CTAGGGGGCTGGGGATGGTGGGG - Intronic
993807891 5:92436056-92436078 CTACTTGGGTGGGGGAAGGGTGG + Intergenic
993807949 5:92436312-92436334 CTAAGCCCCTGGGGGAGGGGTGG + Intergenic
993900210 5:93579761-93579783 CCAGCCGGCTGGGGGCGGGGAGG - Intergenic
993937741 5:94024565-94024587 CTAGGTGTGTGGTGGTGGGGTGG - Intronic
994274835 5:97822881-97822903 CCAGGGGGATGGGGAAGGGGTGG + Intergenic
994669795 5:102752372-102752394 CTAGGAGGCTTGGGGAGGTTCGG - Intergenic
995400534 5:111736012-111736034 CCAAGTGTCTGAGGGAGGGGCGG + Intronic
995410197 5:111848651-111848673 CAAGGTGGCAGGGGATGGGGGGG - Intronic
995503689 5:112836166-112836188 CACGGTGGCGGGGGGGGGGGGGG - Intronic
995531835 5:113099029-113099051 CTAGGTGGGTGGGTGAGTGACGG + Intronic
995852986 5:116565908-116565930 GTAGGAGTCTGGGGGAGGGGCGG + Intronic
995946319 5:117651132-117651154 CTAGATGGCTGGGAGAAGGCAGG - Intergenic
996927492 5:128845785-128845807 CTGGCGGGGTGGGGGAGGGGTGG - Intronic
997010612 5:129872656-129872678 ATAGGTGGGTATGGGAGGGGTGG + Intergenic
997367362 5:133334719-133334741 CTAGGTACATGGGGGAGGGGTGG + Intronic
997667037 5:135638397-135638419 TTTGGTAGGTGGGGGAGGGGAGG + Intergenic
997976872 5:138446038-138446060 CTGGGTGGGTGGGGCAGGGCGGG - Exonic
998385799 5:141756528-141756550 CTGGGTGGCATGGAGAGGGGTGG - Intergenic
998521129 5:142801684-142801706 GGCGGGGGCTGGGGGAGGGGTGG - Intronic
998909810 5:146946865-146946887 TTGGGTGGTTGGGGTAGGGGTGG + Intronic
999249312 5:150172651-150172673 GTAAGAGGCTGGGGGAGGAGGGG + Intronic
999474582 5:151886915-151886937 CCAGGTGCTTGGGGGTGGGGTGG - Intronic
1000171654 5:158708242-158708264 CAAGGTGGCTGGGTGAGGGATGG - Intronic
1000201766 5:159018007-159018029 CCAGGAGGCTGGGGCAGGGACGG - Intronic
1000386088 5:160675863-160675885 GCAGGGGGGTGGGGGAGGGGGGG + Intronic
1000679985 5:164171622-164171644 CTGGGGGGCTGGAGGTGGGGTGG - Intergenic
1000990147 5:167903518-167903540 TTGGGTGGCTGGGGTGGGGGTGG + Intronic
1001095547 5:168772937-168772959 CTAAGTGGCTGCGAGAGGGATGG + Exonic
1001191771 5:169638035-169638057 AGTGGTGGCTGGGGGAAGGGAGG + Intronic
1001392307 5:171388584-171388606 CCACGTGGTTGGGGGAGGGAGGG + Intronic
1001432012 5:171669970-171669992 CTGGGTGGCGGGGGTGGGGGTGG - Intergenic
1001494189 5:172176451-172176473 CCAGGTGGGTGTGGGAGGGAAGG - Intronic
1001514502 5:172346026-172346048 CTGGGTGGGTGGAGGTGGGGCGG - Intronic
1001958505 5:175865043-175865065 GTATGTGGTTGGGGGAGGGTTGG - Intronic
1002075722 5:176707264-176707286 CTATGAGGAAGGGGGAGGGGAGG + Intergenic
1002189783 5:177472542-177472564 CTGGGGGGCGGGGTGAGGGGCGG + Intronic
1002201553 5:177531514-177531536 GCGGGTGGCTGGGGGTGGGGGGG + Intronic
1002291770 5:178205109-178205131 CCACGCGGCGGGGGGAGGGGCGG + Intronic
1002346545 5:178551911-178551933 GAAGGTGGCAGTGGGAGGGGAGG - Intronic
1002431072 5:179204178-179204200 CCAGGAGTCGGGGGGAGGGGAGG + Intronic
1002436966 5:179237601-179237623 CTGGGAGGCTGGGGGAGATGAGG + Intronic
1002469902 5:179428945-179428967 CTAGGAGGCTGCAGGATGGGTGG + Intergenic
1003183061 6:3808264-3808286 CCAGGTGGGTGGGGAGGGGGAGG + Intergenic
1003511100 6:6781293-6781315 GCAGGAGGCTGGGGGAGGGCAGG + Intergenic
1003709844 6:8577032-8577054 CGAGGAGGGTTGGGGAGGGGAGG - Intergenic
1003871294 6:10404950-10404972 CAGGCTGGCTGGGGGAGGGCAGG - Intronic
1004017233 6:11743466-11743488 CAAGGGGGCTGAGGGAGGGAGGG - Intronic
1004161881 6:13221425-13221447 CTGGGTGGGTGGGGAGGGGGAGG + Intronic
1004185184 6:13415421-13415443 CAAGGTGGGTGGAGGAGGTGGGG - Intronic
1004270020 6:14186780-14186802 CGGGGTGGGTGGGGGATGGGGGG - Intergenic
1004843352 6:19612728-19612750 CTCTGGGGTTGGGGGAGGGGTGG - Intergenic
1005715638 6:28544538-28544560 GTAGGGGGGTGGGGGAGTGGAGG + Intergenic
1006390147 6:33753580-33753602 CAAGGTGGCTGGGGTGGGAGTGG + Intergenic
1006429713 6:33988215-33988237 CCAGGTGGCCCAGGGAGGGGAGG - Intergenic
1006470766 6:34227423-34227445 GTGGGTAGCTGGGGGAGGGGAGG - Intergenic
1006472074 6:34235238-34235260 GAAGAAGGCTGGGGGAGGGGCGG - Intergenic
1006554395 6:34853029-34853051 CCAGGAGGCTGGGGGTGGGGTGG + Intronic
1006606283 6:35259842-35259864 GTTGGTGGCTGCGGGAGGAGTGG + Intronic
1006614614 6:35318011-35318033 CTAGGTGGCTTGGGTCTGGGTGG + Intronic
1006700459 6:35968777-35968799 GTAAGGGGCTGGGGGCGGGGGGG - Intronic
1006793919 6:36720451-36720473 CTGGGCGGCTGGAGGAGGTGCGG + Exonic
1006922264 6:37634754-37634776 CAAGGTGGAGGGGGGATGGGGGG - Exonic
1006963528 6:37958736-37958758 GTCGGTGGGTGGGGAAGGGGGGG - Intronic
1007286971 6:40754861-40754883 CCAGGTGTCTGGGGGCAGGGAGG + Intergenic
1007328417 6:41082181-41082203 ATTGGTGGCAGGGGTAGGGGTGG - Intronic
1007363446 6:41374115-41374137 CCGTGTGGCTGGGGGAGGGGTGG + Intergenic
1007400538 6:41600113-41600135 CAGGGTGGATGGAGGAGGGGTGG - Exonic
1007404334 6:41625192-41625214 TGATGGGGCTGGGGGAGGGGAGG - Intergenic
1007643747 6:43364436-43364458 CTAGGCGGGTGGGGGAGAGCTGG - Intronic
1008282536 6:49613598-49613620 CTAGCTGGGTGGGGCAGGTGGGG - Intronic
1009036372 6:58121476-58121498 GTAGGTGGCTGGGGGTGGTAGGG - Intergenic
1009842279 6:69092806-69092828 GTGGGTGACTGGGGGAGGGAAGG + Intronic
1010092084 6:71994849-71994871 CTAAGTGCCTGGGGAAGGGAAGG + Intronic
1010376443 6:75176176-75176198 CTAGGTTGCAGGGGGAAGAGAGG + Intronic
1010755670 6:79663878-79663900 CAGCCTGGCTGGGGGAGGGGCGG - Intronic
1011001222 6:82590635-82590657 ATAGGGGTCTGGGGGAGGGAGGG - Intergenic
1011217556 6:85020969-85020991 GTTGGTGGCTGGGGGATGAGAGG + Intergenic
1011322889 6:86116383-86116405 GTCTGTGGTTGGGGGAGGGGTGG + Intergenic
1011666801 6:89642128-89642150 CTGGGGGGTTGGGGGAGGGGGGG + Intergenic
1013097987 6:106963296-106963318 CATGGTAACTGGGGGAGGGGAGG - Intergenic
1013154331 6:107478589-107478611 CTAGGAGGCTGAGGGAGGCTTGG - Intergenic
1013596078 6:111662263-111662285 GTGGCTGCCTGGGGGAGGGGAGG + Intronic
1013826356 6:114215540-114215562 CTGGCTTCCTGGGGGAGGGGTGG - Intronic
1015029726 6:128580422-128580444 CAAGGCGGCTGCGGGAGGAGCGG - Intergenic
1015541413 6:134317796-134317818 CCAGGTAGCTGGGGGCGGGGAGG - Exonic
1016181529 6:141153609-141153631 GTAGGGGGGCGGGGGAGGGGGGG - Intergenic
1016337979 6:143029387-143029409 GTAGGTGGGTGGGGGACTGGGGG - Intergenic
1016459371 6:144266136-144266158 CCTGCTGGATGGGGGAGGGGTGG - Intergenic
1017078082 6:150638418-150638440 CTGAGTGGTAGGGGGAGGGGTGG - Intronic
1017140378 6:151184474-151184496 GTAGGGGGCTGGGGGAGTGGGGG - Intergenic
1017651709 6:156589345-156589367 CTCAGTGGGTGGGGGTGGGGGGG - Intergenic
1017729630 6:157303823-157303845 CATGGTGGCGGGGGGAGGGGGGG + Intronic
1017743741 6:157428630-157428652 CTCGGGGGCTAGGGGCGGGGTGG - Intronic
1017809428 6:157974354-157974376 GCAGGTGGCTGGGGGTGGAGCGG - Intergenic
1017967269 6:159277209-159277231 CTGTGTGGCTGGGAGAAGGGAGG + Intergenic
1018144613 6:160872749-160872771 ATAGGGGGCTGGGGGAAGTGGGG - Intergenic
1018182699 6:161238052-161238074 TTGGGGGGCTGGGGGTGGGGGGG + Intronic
1018215074 6:161518637-161518659 CTAGGGGGCTGGGTGAGCGGAGG - Intronic
1018511877 6:164533063-164533085 CTCCGTGGCAAGGGGAGGGGAGG + Intergenic
1018811415 6:167300761-167300783 CTAGGAGGCTGGGGGACTCGGGG + Intronic
1019510195 7:1413976-1413998 GGAGGTGGCGGGGGGGGGGGGGG - Intergenic
1019523744 7:1471694-1471716 CTGGGTGGCTGGGGTGGGGTGGG - Intronic
1019696794 7:2450794-2450816 CTGGGTGCCTGGGAGAGGGTGGG - Intergenic
1019856089 7:3609698-3609720 TTGGGTGGCGGGGGGTGGGGAGG - Intronic
1020049594 7:5072810-5072832 CGCTGTGCCTGGGGGAGGGGGGG - Intronic
1020080922 7:5285263-5285285 CTGGGGGGTTGGGGGTGGGGTGG - Intronic
1020151449 7:5684899-5684921 ATGGGGGGCTGGGGGTGGGGTGG + Intronic
1020256269 7:6504392-6504414 GTAGGGGGCCGGGGCAGGGGCGG + Intronic
1021084196 7:16402119-16402141 AAAGGTAGCTGGGGCAGGGGAGG + Intronic
1021684030 7:23164155-23164177 GTAGTTGGCGGGGGGTGGGGTGG - Intronic
1021729864 7:23585763-23585785 CTTGGTGGATGGGGTAGGGCAGG + Intergenic
1021731483 7:23599367-23599389 CTAGTTGGCTTTGGAAGGGGAGG + Intronic
1021734994 7:23634324-23634346 CTATTTGGCAGGGGGTGGGGAGG + Intronic
1021863906 7:24935716-24935738 CTATGTGCCTGGGGGTGGGGTGG + Intronic
1021896356 7:25239687-25239709 CTGGGGGGCGGGGGGTGGGGAGG + Intergenic
1021903034 7:25306496-25306518 CCAGTTGGCTGGGGAAGGGTGGG - Intergenic
1022020889 7:26398556-26398578 CTCGGCGGCTGGGGGGTGGGCGG + Intergenic
1022157898 7:27678747-27678769 GTGGGTGGGTGGGGGTGGGGTGG - Intergenic
1022221965 7:28322583-28322605 GTGGGGGGCTGGGGGAGGGAGGG - Intronic
1022410311 7:30134909-30134931 CAAGGGGGCGGGGGGAGGCGGGG + Exonic
1022434833 7:30373016-30373038 GTTGGTGGGGGGGGGAGGGGTGG - Intronic
1022509068 7:30923654-30923676 GTAGGGGGCAGGGGCAGGGGCGG + Exonic
1022518302 7:30989281-30989303 CTAAGGGGTTGGGGGAGTGGGGG - Intronic
1022652540 7:32290297-32290319 ATAAGTGGCTGGTGGAGGGTTGG + Intronic
1022960723 7:35423897-35423919 CCATGTGGCTGGGGGAGGATAGG - Intergenic
1022988810 7:35686799-35686821 TTGGGAGGCTGGGGGGGGGGGGG + Intronic
1023862449 7:44224685-44224707 AGAGGTGGCTGCGGGAGGGAGGG + Intronic
1023981616 7:45073815-45073837 CTTGGGTCCTGGGGGAGGGGAGG + Intronic
1023993488 7:45144777-45144799 GTAGGGAGATGGGGGAGGGGAGG + Intergenic
1024096498 7:45986890-45986912 CCAGGTGGCAGGGGCAGGGCAGG - Intergenic
1024425088 7:49216093-49216115 CAAGGGGGCTGGGTGAGGGAAGG - Intergenic
1024576759 7:50770669-50770691 GCAGGTGGCAGGGGGATGGGGGG + Intronic
1025201836 7:56966915-56966937 CCATGTGGCTGGGGTTGGGGAGG + Intergenic
1025306883 7:57868756-57868778 CTCGGCGGCGGGGGGTGGGGGGG + Intergenic
1025670110 7:63610013-63610035 CCATGTGGCTGGGGTTGGGGAGG - Intergenic
1026172218 7:67963902-67963924 CTGGGTGGGTAGGGGAGTGGGGG + Intergenic
1026367295 7:69661392-69661414 CAAGGTGGTTGGGGGAGGTGGGG + Intronic
1026487563 7:70834696-70834718 CCAGGGGACAGGGGGAGGGGAGG - Intergenic
1026672047 7:72399202-72399224 CTGGCTGGCTGTGGGAAGGGTGG + Intronic
1026800652 7:73397875-73397897 GGAGGAGGCGGGGGGAGGGGAGG + Intergenic
1026847828 7:73707484-73707506 CTGGGAGGCGAGGGGAGGGGCGG + Intronic
1026850027 7:73718616-73718638 CTGGGTGTGTCGGGGAGGGGGGG - Intronic
1026909768 7:74084862-74084884 GTTGGTGGCAGGGGGAGGTGTGG - Intronic
1027126527 7:75560248-75560270 TTTGGCGGTTGGGGGAGGGGAGG + Intronic
1027232928 7:76282583-76282605 AAAGGGGGCTGGGGGCGGGGAGG - Intronic
1027252805 7:76409719-76409741 CTATGTGGTTGGGGGAGGCATGG + Intronic
1028002987 7:85524699-85524721 CTGTGGGGCTGGGGGAGTGGAGG + Intergenic
1028033658 7:85950650-85950672 CAGGGTAGATGGGGGAGGGGTGG + Intergenic
1028194961 7:87895539-87895561 CTTGGTGGTTGTGGGTGGGGTGG + Intronic
1028530263 7:91830963-91830985 ATAGGTAGCTGGGAGTGGGGTGG - Intronic
1028952869 7:96656409-96656431 CAAGGAGGCTGGGGTAGGGTGGG - Intronic
1029112890 7:98222619-98222641 ATAGGTGGCTGGGGGACAGCCGG + Intronic
1029402196 7:100353296-100353318 TGAGGTGGCAGGGGTAGGGGGGG + Intronic
1029424875 7:100489043-100489065 CAAGGCGGCCGGGGCAGGGGGGG - Exonic
1029502431 7:100940745-100940767 CTGGCGGGCTGGGGGAGGGATGG - Intergenic
1029652584 7:101903626-101903648 CTCTGTGGCAGGGAGAGGGGAGG - Intronic
1029848701 7:103440720-103440742 CTAGGTGGCTGGAGAGGTGGGGG + Intronic
1030060677 7:105618558-105618580 GTAGCTGCCTGGGGGAGAGGAGG + Intronic
1030065152 7:105653747-105653769 GAAGGTGGCTGGGGCAGGAGGGG - Intronic
1030586643 7:111428992-111429014 CTAGGTGGATGGGAGGTGGGTGG + Intronic
1030817089 7:114051521-114051543 GAAGGTGGGTGGGGGCGGGGGGG + Intronic
1032181024 7:129677978-129678000 ATGGGTGGCCGGGGGAAGGGGGG + Intronic
1032218715 7:129977820-129977842 CTTGGGGCCTGGGGGAGGGGTGG + Intergenic
1032533670 7:132643023-132643045 TTAGGTGGCTGGGGATGGGGTGG + Intronic
1032703067 7:134398936-134398958 CTTGGTGGCTGGGGGGTGGGGGG - Intergenic
1032914894 7:136478745-136478767 CCACGTGCCGGGGGGAGGGGGGG + Intergenic
1033097324 7:138442572-138442594 CTGGGGGGCTGGGGGCAGGGAGG - Intergenic
1034434819 7:151058399-151058421 CTAGGTGGCTTGGGGAGAGGTGG - Exonic
1034437400 7:151069738-151069760 CTGGGGGTCTGGGGGAGGGGAGG + Intronic
1034457036 7:151176158-151176180 CGCGGTGGCAGGGGGAGGCGGGG + Exonic
1035332618 7:158106206-158106228 CTAGGTGGATGGGGCTGGGATGG - Intronic
1035346958 7:158206551-158206573 CCAGGAAGCTCGGGGAGGGGGGG + Intronic
1035549073 8:506308-506330 CTCGGCAGCGGGGGGAGGGGAGG + Intronic
1035650041 8:1257259-1257281 CTTGGTGGCTGGGCGGGGCGGGG - Intergenic
1036773227 8:11592839-11592861 CCAGGTGGCTGGGGTGAGGGAGG + Intergenic
1036795497 8:11753587-11753609 CTAGGGGGATGGGGTGGGGGAGG + Intronic
1036940856 8:13050365-13050387 TTATGTGACTGGGGGAGGGGTGG - Intergenic
1037170660 8:15887552-15887574 CGAAGCTGCTGGGGGAGGGGAGG - Intergenic
1037705895 8:21314713-21314735 GCAGGAGGCTGGGGGCGGGGAGG + Intergenic
1037816567 8:22115670-22115692 CTAGGTGTCTGGGATCGGGGTGG - Exonic
1037837359 8:22221997-22222019 GGAGGCGGCTGGGGGAGGGCTGG - Intronic
1037839272 8:22232365-22232387 TTAGGATGCTGGGAGAGGGGTGG + Intergenic
1037908287 8:22728162-22728184 CTGGGAGGATGGGGGAGAGGTGG + Intronic
1038449903 8:27633532-27633554 CCAAGTGGCTGGGGCAGGGGTGG - Intergenic
1038491655 8:27976136-27976158 AGAGGAAGCTGGGGGAGGGGAGG + Intronic
1038671574 8:29587459-29587481 CTAGGTTTCTGGAGTAGGGGAGG - Intergenic
1038682416 8:29681303-29681325 CCAGGTGGTTGGGGGCAGGGTGG - Intergenic
1038724498 8:30068565-30068587 CTAGGGGGGTTGGGGTGGGGTGG - Intronic
1038752848 8:30313015-30313037 ATAAGAGGCTGGGTGAGGGGTGG + Intergenic
1038767295 8:30440961-30440983 CTAGCTGGAGGGGGGCGGGGCGG - Intronic
1039366595 8:36934476-36934498 AGAGGTGTTTGGGGGAGGGGTGG - Intronic
1039385506 8:37132074-37132096 GCAGGTGGCGGGGGGTGGGGGGG - Intergenic
1039444541 8:37620694-37620716 CTTGATGGCTGGGGGTGGGGAGG - Intergenic
1039469018 8:37802288-37802310 CAAGGATGCTGGTGGAGGGGCGG + Intronic
1040445677 8:47490845-47490867 CTAGGGTGCGGGGAGAGGGGAGG + Intronic
1040821166 8:51559331-51559353 GAAGGTGGCGGGGGGGGGGGGGG - Intronic
1042695859 8:71554696-71554718 ATAGGAGACTGGGGGAGGCGGGG + Intronic
1044451667 8:92342784-92342806 CTAAGTGGCTGGGGGAAGCTGGG - Intergenic
1044453906 8:92369765-92369787 CAGCGAGGCTGGGGGAGGGGCGG - Intergenic
1044589837 8:93903539-93903561 GTATGTGTCTGGGGGAGTGGGGG - Intronic
1044847868 8:96399456-96399478 CTTGGTGACTGGGGCAAGGGGGG - Intergenic
1045485923 8:102631144-102631166 CTGTGAGGATGGGGGAGGGGTGG + Intergenic
1045776963 8:105815980-105816002 GTGGGTGGCTGGGGGTGGGGTGG - Intergenic
1047315547 8:123730018-123730040 CTAAGTGGATGTGGGAGGTGAGG - Intronic
1047387729 8:124425527-124425549 CATGGTGGGTGGGGGAGTGGGGG - Intergenic
1048329960 8:133464657-133464679 GGAGGAGGCTGGGGGAGGGGAGG + Intronic
1048548049 8:135405142-135405164 CAAGCTTGCTGGGGGAGGTGGGG + Intergenic
1048862069 8:138730877-138730899 CTAGATGGGAGGGGGAGGGGAGG + Intronic
1048965080 8:139609244-139609266 CTAGGTAGGTGGGGGGGGGGTGG - Intronic
1049194061 8:141306008-141306030 GGAGGGGGGTGGGGGAGGGGCGG - Intronic
1049199749 8:141334310-141334332 CTAGGAGGCTGGGAAAGCGGTGG - Intergenic
1049217362 8:141414404-141414426 GAAGGTGGCTGGGGCAGGGGAGG + Intronic
1049624423 8:143613670-143613692 CTGGGAGGCTGGCTGAGGGGTGG - Intronic
1049761222 8:144332775-144332797 CTAGAAGGCTTGGGAAGGGGTGG + Exonic
1049803883 8:144530289-144530311 CCAGGGGCCTGGGGGAGTGGAGG + Exonic
1049990912 9:990664-990686 CGGGGTGGCTGGGGGAAAGGGGG - Exonic
1050399040 9:5231322-5231344 GTAGGTGGGTGGGAAAGGGGTGG + Intergenic
1050463016 9:5893290-5893312 CTGGGTGGCAGGGGCAGGGGAGG + Intronic
1050544898 9:6701427-6701449 CTGGGAGGCTGGGGCAGGGAGGG + Intergenic
1050630076 9:7549486-7549508 CTCCCTGGCTGGGGGAAGGGTGG + Intergenic
1051395142 9:16612366-16612388 GAAAGTGGCTGGGGAAGGGGTGG - Intronic
1052835842 9:33249370-33249392 CTGGGTGGCTAGGGTATGGGGGG - Intronic
1052840620 9:33289109-33289131 CCAGGAGGCAGGGGGAGAGGAGG - Intergenic
1053157738 9:35792147-35792169 CGGGGTGGCAGGGGGAGGGAGGG - Exonic
1053266122 9:36714756-36714778 CCCGGTGCCTGGTGGAGGGGAGG - Intergenic
1053742768 9:41158001-41158023 CTCAGTAGCGGGGGGAGGGGTGG - Intronic
1054445774 9:65314187-65314209 CTCAGTAGCGGGGGGAGGGGTGG - Intergenic
1054484495 9:65707318-65707340 CTCAGTAGCGGGGGGAGGGGTGG + Intronic
1054685573 9:68273297-68273319 CTCAGTAGCGGGGGGAGGGGTGG + Intronic
1054772713 9:69097895-69097917 TTAGGTGGCTGTGGCAGGGTAGG - Intronic
1054894481 9:70293326-70293348 GTAGGGGGGTGGGGGAGAGGGGG - Intronic
1054927119 9:70600603-70600625 TCAGGAGGCTGGGGGTGGGGTGG + Intronic
1055051406 9:71984928-71984950 GGAGGTGGCTGGAGGAGGGGAGG + Intronic
1055921387 9:81464720-81464742 CAAGGTTCCTGGGAGAGGGGTGG - Intergenic
1057253651 9:93525347-93525369 CTAGGATGGTGGGGCAGGGGAGG - Intronic
1058437302 9:104974868-104974890 GTCGGGGGCTGGGGGCGGGGAGG + Intergenic
1058504277 9:105653081-105653103 CTGGGTGCCTGGTGGAAGGGTGG - Intergenic
1059411612 9:114136118-114136140 CAAGATGGCTGGGGATGGGGTGG - Intergenic
1059791522 9:117645939-117645961 CTGTGTGGCTGGGGGTGGTGGGG + Intergenic
1060355828 9:122905875-122905897 CAAAGTGGGGGGGGGAGGGGGGG + Intergenic
1060402730 9:123357620-123357642 CATGGTGGCGGGGGGCGGGGTGG + Intronic
1060668094 9:125445130-125445152 CTGGGAGGATGGGGGCGGGGGGG + Intronic
1060969576 9:127730472-127730494 CTGGGTCGCTGGGGGCTGGGCGG + Intronic
1060982685 9:127802856-127802878 CTGATTGGCTGGGGGCGGGGCGG + Exonic
1061046106 9:128166022-128166044 CTGGGTGGATAGGGGAAGGGGGG - Intergenic
1061053391 9:128209025-128209047 CTAGGAGGGTTGGGGAGGCGGGG + Intronic
1061316066 9:129796505-129796527 CTAGGAGGCTGGTGGCAGGGAGG + Intergenic
1061335041 9:129927758-129927780 TGTGGTGGCGGGGGGAGGGGGGG - Intronic
1061719447 9:132542731-132542753 TCAGGAGACTGGGGGAGGGGGGG - Intronic
1061804731 9:133131585-133131607 ATGGGTGGCTGGGGCAGGGATGG - Intronic
1061809698 9:133155151-133155173 GTAGTGGGCTGGGGAAGGGGAGG - Intronic
1061918665 9:133770230-133770252 TGCGATGGCTGGGGGAGGGGCGG + Intronic
1061929791 9:133826635-133826657 CTAGGTGGCTGGGGGAGGGGTGG - Intronic
1061937508 9:133866302-133866324 CTACGTGTTGGGGGGAGGGGAGG + Intronic
1061944658 9:133901875-133901897 GGAGGGGGCTGGGGGTGGGGAGG + Intronic
1062008829 9:134256222-134256244 GTTGCTGGTTGGGGGAGGGGAGG + Intergenic
1062030897 9:134361470-134361492 CTGGGTGGCTGGGACAGGGATGG + Intronic
1062054460 9:134463722-134463744 CAAGGGGGCAGGGGGATGGGGGG - Intergenic
1062112135 9:134787979-134788001 ATAGGTGGCTGGGTGAGTGGAGG + Intronic
1062436185 9:136547554-136547576 CCTGGTGGGTGGGGGTGGGGTGG + Intergenic
1062543641 9:137052437-137052459 CTGGGTGGGGGGGGGAGCGGTGG - Intronic
1062646944 9:137552492-137552514 CTAGCTGGGCGGGGGAGGGGCGG + Exonic
1062708809 9:137960398-137960420 CTGGGGGGGAGGGGGAGGGGAGG + Intronic
1185503974 X:618952-618974 CTGCGTGGCTGGGGGCGTGGGGG + Intergenic
1185504179 X:619590-619612 CCAGGAGCCTGGGGCAGGGGTGG + Intergenic
1185533292 X:839029-839051 CTGGGGGGGTGGGGGTGGGGGGG + Intergenic
1185869131 X:3649580-3649602 CAGGGTTGCTAGGGGAGGGGAGG + Intronic
1186465379 X:9780732-9780754 CTTGTTGGGTGGGGGGGGGGGGG - Intronic
1186638958 X:11434657-11434679 TTAGTTGGCGGGGGGAGGGGAGG - Intronic
1186816879 X:13246638-13246660 AGAGGAGGCTAGGGGAGGGGAGG + Intergenic
1187181279 X:16946329-16946351 CTAGAAGGCTGGGGCAGGTGTGG - Intergenic
1188078648 X:25808629-25808651 CCATGGGGCTGGGGGAGGGGTGG + Intergenic
1188149058 X:26649844-26649866 TTGGGAGGCTGGGGGAGGGGGGG + Intergenic
1188328503 X:28837808-28837830 CTATGTGGGTGAGGGAAGGGTGG - Intronic
1188344929 X:29052561-29052583 TGAGGTGGGTGGGGGAGGGTAGG - Intronic
1189207837 X:39257033-39257055 CCAGGTGGCTGGGGGAGGGGTGG - Intergenic
1189317088 X:40064021-40064043 CTAATGGGGTGGGGGAGGGGGGG + Intronic
1189325269 X:40107763-40107785 CCAGGGGGCTGTGAGAGGGGAGG - Intronic
1189683960 X:43544500-43544522 CGGGGTGGTGGGGGGAGGGGGGG + Intergenic
1189718623 X:43891356-43891378 TTAGGTAGTTGGGGGTGGGGCGG + Intergenic
1190052157 X:47158361-47158383 CTGGGTGGCCAGGGGTGGGGGGG - Intronic
1190127657 X:47721396-47721418 CTAGGTGGGTGGGTCAGGGCCGG + Intergenic
1190225128 X:48539509-48539531 CCACGGGGCTGGGGGAGGCGGGG + Exonic
1190234348 X:48604415-48604437 CTGGGTGGCTGGGGAGGGGCAGG + Intronic
1190304460 X:49074111-49074133 CTAGGTGGATTGCGCAGGGGCGG + Intronic
1190304613 X:49074905-49074927 GCAGATGGCTGGGGGAGGGGGGG + Exonic
1190441101 X:50475063-50475085 CTGGGGGGCTGGGGGTGGGTGGG + Intergenic
1190546888 X:51537151-51537173 CAGCGCGGCTGGGGGAGGGGTGG - Intergenic
1190549359 X:51563185-51563207 CAAGGTGGTTCGTGGAGGGGAGG + Intergenic
1190803458 X:53813668-53813690 CGGAGTGCCTGGGGGAGGGGAGG - Intergenic
1190888865 X:54551958-54551980 CTAGCTGACTGGGTGAGGTGAGG + Exonic
1190894038 X:54597914-54597936 CTGGGGGGATGGTGGAGGGGTGG + Intergenic
1190937456 X:55009346-55009368 GAAGGTGGTAGGGGGAGGGGAGG + Intronic
1191717001 X:64200604-64200626 CTGAGAGGCTGGGGGAGGAGTGG + Intronic
1191996897 X:67105346-67105368 CTAGGAAGCTGGGGCAGGGAGGG + Intergenic
1192016543 X:67337753-67337775 CTTGGGGGGTGGGGGCGGGGTGG - Intergenic
1192196003 X:69028649-69028671 CTAGGTAACTGGGGGAAGGGGGG - Intergenic
1192548075 X:72029734-72029756 AAGGGTGGCTGGTGGAGGGGAGG + Intergenic
1192926596 X:75760347-75760369 CTAGGCAGCTGGGGGTGGTGGGG - Intergenic
1193446310 X:81608418-81608440 GTAGGGTGCTGGGGGAGAGGTGG - Intergenic
1193533611 X:82686459-82686481 CTGAGTCCCTGGGGGAGGGGTGG - Intergenic
1193685102 X:84568160-84568182 CTACGTGTGTGTGGGAGGGGTGG - Intergenic
1193782605 X:85722220-85722242 TTAGGTGGCCGGGGGCGGGGGGG - Intergenic
1194537123 X:95119285-95119307 CAAAGTGTCTGGGGGAAGGGTGG - Intergenic
1195065152 X:101233401-101233423 CAGGGTGGCTGGGGGATGGCAGG - Intronic
1195272890 X:103250670-103250692 CAAGGTGGGTGGGAGAGGGATGG + Intergenic
1195306069 X:103585459-103585481 CTAGGAGGCGGGGCGTGGGGCGG + Intronic
1195311220 X:103633633-103633655 CAAGGTGGGTGGGAGAGGGATGG - Intergenic
1195988889 X:110662892-110662914 GTGGGGGGCTGGGGGAGGGATGG + Intergenic
1196003548 X:110811612-110811634 GTAGATGGTTGGGGGAGGGGAGG + Intergenic
1196099349 X:111831398-111831420 CTAGATGACTGGGGGTGGGTGGG + Intronic
1196124306 X:112082890-112082912 CCCGGGGGCTGGGGGAGGTGAGG - Intergenic
1196176714 X:112646340-112646362 CTGGTTTGCGGGGGGAGGGGGGG + Intronic
1196231738 X:113232158-113232180 CTAGGGGGCTGGGGGAGAAGTGG - Intergenic
1196746966 X:119079739-119079761 CTCCGTGGCTGGGGGATGAGTGG + Exonic
1196764935 X:119235236-119235258 TCTGGTGGCGGGGGGAGGGGAGG - Intergenic
1197124184 X:122924968-122924990 CAAGTTTCCTGGGGGAGGGGTGG - Intergenic
1197202550 X:123760596-123760618 CTGAGTGGCTGGGGGAGGCCTGG + Intergenic
1197753254 X:129979919-129979941 GTGGGGGGCCGGGGGAGGGGCGG + Intergenic
1197838243 X:130718111-130718133 CTAGCTGAGTGGAGGAGGGGTGG - Intronic
1197984127 X:132249730-132249752 CAATGAGGCTGGGGGAGGGGCGG - Intergenic
1198001541 X:132443989-132444011 GTAGGTGGGGGGGGGGGGGGGGG - Intronic
1199526067 X:148793248-148793270 CAGGGTGGGTGGGGGAGGGCAGG + Intronic
1199794171 X:151179047-151179069 CGAGGTGGGCGGGGGTGGGGGGG - Intronic
1199852879 X:151737904-151737926 CTGGGTGGCTTGGGGAGGTGTGG - Intergenic
1200135304 X:153871863-153871885 GAAGGTGGCGGGGGGAGGGGGGG - Intronic
1200243198 X:154508348-154508370 CTAGTTGGGGGGGGGTGGGGGGG + Intronic
1200318767 X:155162889-155162911 CAGCGAGGCTGGGGGAGGGGTGG - Intergenic
1201389299 Y:13479990-13480012 CTAAGTGGTTGGGAGCGGGGAGG - Exonic
1202055582 Y:20826577-20826599 CAGCGAGGCTGGGGGAGGGGCGG - Intergenic