ID: 1061930277

View in Genome Browser
Species Human (GRCh38)
Location 9:133828822-133828844
Sequence GTGTGGAAGGCGAGGCTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 505
Summary {0: 1, 1: 0, 2: 4, 3: 53, 4: 447}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061930277_1061930288 12 Left 1061930277 9:133828822-133828844 CCCTCCAGCCTCGCCTTCCACAC 0: 1
1: 0
2: 4
3: 53
4: 447
Right 1061930288 9:133828857-133828879 CTCCTGCTGGGATAGTGCCCCGG No data
1061930277_1061930286 0 Left 1061930277 9:133828822-133828844 CCCTCCAGCCTCGCCTTCCACAC 0: 1
1: 0
2: 4
3: 53
4: 447
Right 1061930286 9:133828845-133828867 CCTGCACAACTCCTCCTGCTGGG No data
1061930277_1061930284 -1 Left 1061930277 9:133828822-133828844 CCCTCCAGCCTCGCCTTCCACAC 0: 1
1: 0
2: 4
3: 53
4: 447
Right 1061930284 9:133828844-133828866 CCCTGCACAACTCCTCCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061930277 Original CRISPR GTGTGGAAGGCGAGGCTGGA GGG (reversed) Intronic
900808098 1:4781150-4781172 GAGTGGACAGCGAGGCTGGCAGG - Intronic
901868996 1:12126558-12126580 GAGAGGAAGGCAAGGCTGGCAGG - Intronic
902231704 1:15031494-15031516 GTGGGGAAGGAGAGTCTGGAGGG + Intronic
902538974 1:17138925-17138947 GAGTGGATGGAGAGGGTGGAAGG + Intergenic
902783932 1:18721100-18721122 GAGTGGGAGAAGAGGCTGGAGGG - Intronic
904051226 1:27640216-27640238 CTGTGGAAGGAAAAGCTGGATGG - Intergenic
904200929 1:28818598-28818620 GTGAGGATGGAGAGGCTGCAGGG + Intronic
904410609 1:30322581-30322603 GTGTGGAGGGCCTGGCTGGTAGG - Intergenic
904483140 1:30806611-30806633 GTGGGGCAGCTGAGGCTGGACGG - Intergenic
904498084 1:30898688-30898710 GTGGGGAAGGGCAGGCAGGACGG - Intronic
904995412 1:34627706-34627728 GTGGGGAAGGGGAGGTAGGAAGG + Intergenic
905092728 1:35442364-35442386 CTGTGGAGGGAGAGGCTGGGAGG + Intronic
905872792 1:41414795-41414817 GTGTGGCAGTCGGGGCTGGGTGG - Intergenic
906197381 1:43937280-43937302 GTTGGGAAGAAGAGGCTGGATGG + Intergenic
906422989 1:45686608-45686630 GTGTGTAAGGCGGGGTCGGACGG - Exonic
906818013 1:48899088-48899110 GTGCGGAAGGCCAGCCTGCAGGG - Intronic
907238177 1:53065470-53065492 GAGTGGCTGGCGAAGCTGGAGGG + Intronic
912631505 1:111250164-111250186 GTGTGGAATGTGAGGGTGGAGGG + Intergenic
913160918 1:116145959-116145981 GTGTGGAAGGGGACCCTGGGGGG + Intergenic
914752574 1:150545615-150545637 GTGTGGGAGGGGAGCCTGGGAGG - Intergenic
914992493 1:152510977-152510999 TTCTGGAAGGGGAGGGTGGAAGG + Exonic
915106390 1:153537264-153537286 GGGTGGAGGGTGAGGGTGGAGGG + Exonic
915413908 1:155725325-155725347 GTGTGGAAGGAGTGGGTGGGGGG - Intronic
915562283 1:156694242-156694264 GGGTGGGAGGGGAAGCTGGAGGG + Intergenic
915594454 1:156888192-156888214 GAGGGGGAGGCCAGGCTGGAAGG + Intergenic
916480843 1:165213026-165213048 GTGAGCAAGGCAAGGCTGGTGGG - Intronic
916604363 1:166326400-166326422 ATGGGGAAGGTGAGGCTTGAGGG - Intergenic
917284472 1:173410019-173410041 ATTTGGAAGGCCAGGGTGGATGG + Intergenic
919419802 1:197355743-197355765 GTGTGGGAACCGAGGCTGCACGG - Intronic
919654086 1:200180686-200180708 GGCTGGAAGGGGAGGCTGGGAGG - Intergenic
919777163 1:201201824-201201846 CTGTATAAGGTGAGGCTGGAGGG + Exonic
920655003 1:207868512-207868534 GTGTGGAGGAGGAGGCGGGAAGG - Intergenic
920840562 1:209550365-209550387 GTGGGGAAGAGGGGGCTGGAAGG - Intergenic
921308110 1:213817195-213817217 GTTTGGAAGACTAAGCTGGAGGG - Intergenic
922538440 1:226400971-226400993 GGGAGGAAGGGGAGGCAGGAGGG - Intronic
922544019 1:226441734-226441756 ATGGAGAAGGCGAGGCAGGAAGG + Intergenic
922784881 1:228277873-228277895 GAGGGGAGGGCGGGGCTGGACGG + Intronic
923011523 1:230091787-230091809 GTGTGGACGATGAGGCTGGCTGG - Intronic
924268612 1:242308934-242308956 GTGTGGGAGGGGAGGATGGAAGG + Intronic
924474864 1:244374182-244374204 CTGAGGGAGGCCAGGCTGGAGGG - Intronic
1062796489 10:348425-348447 GTGTGGAGGCAGAGGCTGGATGG - Intronic
1063136629 10:3222651-3222673 GTGATGTAGGCGAGGCTGGCTGG + Intergenic
1063412777 10:5849472-5849494 GCTAGAAAGGCGAGGCTGGAAGG - Intergenic
1063436218 10:6034384-6034406 GTGTGGAAAGGTACGCTGGAGGG + Intronic
1063506857 10:6607435-6607457 GTGTGGTATGTGAGGCTGGTGGG - Intergenic
1063813454 10:9742055-9742077 TGGTGGAAGGGGAGGCAGGAAGG - Intergenic
1066716293 10:38289834-38289856 GTGTGGGAGGGGAGGATGGAAGG - Intergenic
1067659406 10:48223291-48223313 GTGTGGAAGGAGAAGCAGTAGGG + Intronic
1069266045 10:66459026-66459048 AAGTGGAAGGGGAGGCAGGAGGG - Intronic
1069358796 10:67618309-67618331 AAGTGGAATGCGGGGCTGGACGG - Intronic
1069895605 10:71678534-71678556 GGGATGAAGGCAAGGCTGGAAGG + Intronic
1069995350 10:72338598-72338620 GAATGGAAGGCAGGGCTGGAAGG + Intronic
1070039707 10:72763907-72763929 GTGTGGAAGGGGAGTGTGAAGGG - Intronic
1070800671 10:79243000-79243022 GTGCGGACGGCGAGGCTCGCGGG + Intronic
1070814938 10:79317107-79317129 GTGTTGGTGCCGAGGCTGGAAGG - Intergenic
1070922126 10:80194628-80194650 GTGAGGTAGACGAGGCTGGGAGG - Intronic
1071431471 10:85610375-85610397 GTGAGGAAGGAGATGCTGGCAGG - Intronic
1071671548 10:87613622-87613644 GTTGGGAAGCTGAGGCTGGAGGG + Intergenic
1072251563 10:93586013-93586035 GTGTGGCAGGCCAGGCAGAAGGG - Intronic
1073104955 10:101027257-101027279 GTGAGGGAGGGGAGGGTGGAGGG - Intronic
1073177126 10:101563382-101563404 GGGTGGAAGCCCAGGCTGGAAGG + Intergenic
1074198494 10:111209751-111209773 GAGTAGAAGGCTATGCTGGAAGG + Intergenic
1075672175 10:124270303-124270325 TTGGGGAAGGTGAGGCTGGAGGG - Intergenic
1076114430 10:127885522-127885544 GTGTAGGAGGCCAGGCTGGCAGG - Intronic
1076237829 10:128879536-128879558 AAGAGGAAGGTGAGGCTGGAAGG + Intergenic
1077121378 11:910520-910542 GGGTGGAGGGCGAGTGTGGACGG - Intronic
1077145552 11:1042707-1042729 GTGTCGGAGACCAGGCTGGAAGG + Intergenic
1077159220 11:1105072-1105094 GTGGGGAAGGCCAGGCTGGAGGG + Intergenic
1077212089 11:1375766-1375788 GTGTGGGAGAAGAGGCTTGAGGG - Intergenic
1077431035 11:2516066-2516088 CTGTGGAAGGCCAGGCTGCCTGG + Intronic
1077439320 11:2560631-2560653 GTGTGGAAGGGGAGGCTGAGGGG - Intronic
1077873724 11:6284813-6284835 GTGGGGAAGGCGAGGCTCTCAGG - Intergenic
1078116099 11:8452537-8452559 TTGGGAAAGGAGAGGCTGGAGGG + Intronic
1078479355 11:11662585-11662607 AAGAGGAAGGCGAGGCTAGAGGG - Intergenic
1079170160 11:18086158-18086180 CTCTGGAAGGCAAGGCAGGAAGG + Intronic
1080834663 11:35929221-35929243 ATGTGAAAGTCCAGGCTGGATGG + Intergenic
1080913144 11:36625999-36626021 GTGTGGAAGCTGAGGTTAGAGGG + Intronic
1081372845 11:42325190-42325212 ATGTGGAATATGAGGCTGGATGG + Intergenic
1082160670 11:48884984-48885006 GTGTGGATGGCAGGGCTGCAGGG - Intergenic
1082161696 11:48895422-48895444 GTGTGGATGGCAGGGCTGCAGGG + Intergenic
1082167277 11:48963850-48963872 GTGTGGATGGCAGGGCTGCAGGG + Intergenic
1082236297 11:49822848-49822870 GTGTGGATGGCAGGGCTGCAGGG - Intergenic
1082239749 11:49857356-49857378 GTGTGGATGGCAGGGCTGCAGGG - Intergenic
1082242405 11:49886995-49887017 GTGTGGATGGCAGGGCTGCAGGG + Intergenic
1082609790 11:55282724-55282746 GTGTGGATGGCAGGGCTGCAGGG - Intergenic
1082656892 11:55867800-55867822 GTGTGGACGGCAGGGCTGCAGGG + Intergenic
1082814554 11:57499554-57499576 GTGGGTAAGGCGAGGCCGGCCGG + Intronic
1083111258 11:60410100-60410122 GTTTGGAAGGCCAAGGTGGAAGG - Intronic
1083310731 11:61782310-61782332 GGGTTGAAGGGGAGGCTGGGAGG + Intronic
1083315580 11:61813164-61813186 GGGTGGAAGGAGAGTCTAGATGG - Intronic
1083617614 11:64034494-64034516 GTGAGGAGGGAGAGGCAGGAAGG + Intronic
1083741101 11:64712215-64712237 GTGTGGAAGGCCAGTGTGGGCGG - Intronic
1083864204 11:65444863-65444885 GAATGGAAGGCGAGGCAGGCGGG + Intergenic
1084122602 11:67078141-67078163 GTGTGGCGGGCTAGGCAGGATGG - Intergenic
1084948047 11:72649547-72649569 GTCTGGAAGGTGGGGCTGGTGGG + Intronic
1085306306 11:75488020-75488042 GAATGGAAGGGGAGGCTGGATGG - Intronic
1089167491 11:116488357-116488379 GAACGGAAGGCGGGGCTGGAAGG + Intergenic
1089335998 11:117724402-117724424 CTGTGGAAGGTGAGGGTGGGAGG + Intronic
1089533839 11:119149190-119149212 GCGGGGCAGGCGAGGCAGGAGGG - Exonic
1089964787 11:122647050-122647072 GTGTGCAAGGTGAGCCTGGACGG - Intergenic
1090137330 11:124210861-124210883 TTGTGGCAGGAGAGGCTGCAGGG - Intergenic
1090424360 11:126596811-126596833 TTCTGGAAGACCAGGCTGGATGG - Intronic
1091087161 11:132732634-132732656 GTGTGTAAGGGGAGGCTTCAGGG + Intronic
1091846536 12:3660338-3660360 GTGAGACAGGCGAGGCTGGTTGG + Intronic
1092812794 12:12287366-12287388 GGGAGGAAGGCAAGGCAGGAAGG - Intergenic
1096240989 12:49960310-49960332 ATGTGGAGAACGAGGCTGGAGGG - Intergenic
1096370302 12:51063843-51063865 GTGCGGAAGGGGAGGCTTGAGGG + Exonic
1096973950 12:55687957-55687979 CTGTGGAAGGTGAGGCTTGGAGG - Exonic
1097573978 12:61367995-61368017 CTTTGGGAGGCGAGGCTGGCAGG - Intergenic
1099225994 12:79969842-79969864 TTGTGGAAGTTGAGACTGGAAGG + Intergenic
1099413357 12:82358832-82358854 GTGGGGTAGGCGGGGCGGGAAGG + Intronic
1101654568 12:106708574-106708596 TGGTGGAAGGCAAGGATGGATGG + Intronic
1102037930 12:109782839-109782861 GTGGGGAAGGTGGGGGTGGAGGG - Intergenic
1102524203 12:113499690-113499712 GGTTGCAAGGCGAAGCTGGAGGG + Intergenic
1103485868 12:121282252-121282274 GTGGGGAAGGAGGGGCTGGAAGG + Intronic
1103698962 12:122838065-122838087 GGGAGGAAAGCGAGGCTGGCAGG - Intronic
1103912586 12:124360558-124360580 GTGTGGCAGGGGCTGCTGGAGGG - Intronic
1105885548 13:24638267-24638289 GAGAGAAAGGCGAGGCTGGCGGG - Intergenic
1106046501 13:26146838-26146860 GTGTTGGAGGAGAGGCTTGATGG + Intronic
1106401669 13:29437020-29437042 GTGGGGAAGGAGTGGCTGGAAGG - Intronic
1106508880 13:30395741-30395763 CTCTGGAAGACGAGGCTGTACGG - Intergenic
1110333566 13:74300481-74300503 GTGTGGTAGGGGTGGGTGGATGG + Intergenic
1111618618 13:90694493-90694515 GTGTGGAAGGTGGGCCTGGTGGG - Intergenic
1112464929 13:99635474-99635496 ATGTGGAAGGGGAGGCTGAATGG - Intronic
1112760396 13:102688515-102688537 GTGTGGAAGGCCAGGGCGGTGGG + Intronic
1113073145 13:106441149-106441171 GTGTGGGGGTGGAGGCTGGAAGG + Intergenic
1113591919 13:111507359-111507381 GGGTGGAGGCTGAGGCTGGAGGG - Intergenic
1113708755 13:112450599-112450621 CTGTGGAAGGCTAGGCAGGCTGG - Intergenic
1113759890 13:112840105-112840127 GTGGGGAGGCTGAGGCTGGAGGG - Intronic
1113759900 13:112840137-112840159 GTGGGGAGGCTGAGGCTGGAGGG - Intronic
1113759923 13:112840201-112840223 GTGGGGAGGCTGAGGCTGGACGG - Intronic
1113759932 13:112840233-112840255 GTGGGGAGGCTGAGGCTGGAGGG - Intronic
1113759942 13:112840265-112840287 GTGGGGAGGCTGAGGCTGGAGGG - Intronic
1113759952 13:112840297-112840319 GTGGGGAGGCTGAGGCTGGAGGG - Intronic
1113760009 13:112840489-112840511 GTGGGGAGGCTGAGGCTGGAGGG - Intronic
1114620647 14:24094331-24094353 GTATGGAAGGCGGGGAAGGAGGG - Exonic
1117490260 14:56240212-56240234 GTGTGGAGGGGAAGACTGGAGGG + Intronic
1117559582 14:56923067-56923089 GTGTGCAATGCCAGGCTGGGAGG + Intergenic
1117831136 14:59752070-59752092 GTGTGGATGTGGAGGTTGGAAGG - Intronic
1118761851 14:68885012-68885034 GGGTGGAAGGAGTGCCTGGAAGG - Intronic
1119666488 14:76488766-76488788 TTGTGGAAGGGGAGCCTTGAGGG - Intronic
1119897829 14:78235235-78235257 GTGTGCCAGGTGAGGCTGAAGGG - Intergenic
1120601637 14:86517473-86517495 GTTGGGAGGCCGAGGCTGGAGGG + Intergenic
1121173616 14:91874211-91874233 GTGTGGGAGGTGGGGCTGGATGG - Intronic
1121450534 14:94004387-94004409 GTTTGGAAGACGAGGCTTGGGGG + Intergenic
1122060121 14:99131716-99131738 GTGTGCAGGCAGAGGCTGGAGGG + Intergenic
1122486870 14:102087476-102087498 GGGTGGGAGGCGCGCCTGGAGGG + Intronic
1122855529 14:104558294-104558316 GTGCGGAAGGCCAGGCTGATGGG - Intronic
1122943344 14:104993367-104993389 GTGTGGATGACGAGGCTGGAAGG + Intronic
1122961316 14:105094723-105094745 GCATGGAAGATGAGGCTGGAGGG + Intergenic
1202898441 14_GL000194v1_random:22934-22956 GAGTGGAAGGTGAGGTTTGAGGG - Intergenic
1123827916 15:24101669-24101691 GGGTGGAGGGCGAGGCTGACAGG + Intergenic
1123842375 15:24261080-24261102 GGGTGGAGGGCGAGGCTGACAGG + Intergenic
1123862035 15:24477671-24477693 GGGTGGAGGGCGAGGCTGACAGG + Intergenic
1124214120 15:27792525-27792547 GTGTGGGAGGTGAGGCTGCTTGG - Intronic
1125423480 15:39527421-39527443 AAGTGGAAGGGGAGGCAGGAGGG - Intergenic
1125973833 15:43933990-43934012 GTCTAGGAGGCGGGGCTGGAAGG + Intronic
1126436902 15:48645864-48645886 GAGTGGAAAGGGAGGATGGATGG - Intergenic
1126739393 15:51762211-51762233 CTGTGGTAGGCCAGGCTGGGAGG + Intronic
1127760614 15:62135919-62135941 GTGTGGGAGGAGACGCTGGAGGG + Intergenic
1128582281 15:68818539-68818561 GTGTGGGCCGCGAGGCTGGGAGG + Intronic
1128709532 15:69861317-69861339 GTGGGGAAACTGAGGCTGGAAGG + Intergenic
1129997116 15:80016514-80016536 GTGTGGAAGGAGAGGCAGGGGGG + Intergenic
1130100030 15:80886296-80886318 GGGTGAGAGGTGAGGCTGGAGGG + Intronic
1131177580 15:90219712-90219734 GTGTGGAAGGGGGGGCTCGGCGG + Intronic
1131314154 15:91318038-91318060 CTGTGGAAGCAGAGGCTGGAGGG - Intergenic
1131431458 15:92392535-92392557 GTGTGTAAGGAGGGGCAGGAGGG - Intergenic
1132004807 15:98217511-98217533 GTGTGGAAGCCTGGGCTGAAGGG - Intergenic
1132549318 16:547844-547866 GTGGTGAAGTCGGGGCTGGAGGG - Exonic
1132567953 16:631753-631775 GGGTGGGAGGAGAGGATGGAAGG - Intronic
1132568047 16:632122-632144 GGGTGGGAGGAGAGGATGGAAGG - Intronic
1132568055 16:632148-632170 GGGTGGGAGGAGAGGATGGAAGG - Intronic
1132642596 16:984627-984649 GTGGGGCCGGCCAGGCTGGAAGG - Intronic
1132714005 16:1281734-1281756 GTGGGGAAACTGAGGCTGGAGGG - Intergenic
1132748869 16:1448173-1448195 GTGTGGACGCTGAGGCTGGTGGG - Intronic
1132981464 16:2740438-2740460 GTGAGGAAGGTGAGGCTGGAGGG - Intergenic
1133014757 16:2934189-2934211 GTGGGGCAGGTCAGGCTGGAAGG - Intronic
1133276458 16:4641006-4641028 GTGTGGAGGGAGAGCCTGGTGGG + Intronic
1135166825 16:20146486-20146508 GTATGGAAGGGGAGGAAGGAGGG + Intergenic
1135743942 16:24999661-24999683 GTTAGGGAGGCGAGGCAGGAGGG - Intronic
1135930539 16:26732589-26732611 GTGTTGGAGGTGAGGCTGGGTGG + Intergenic
1136144951 16:28311078-28311100 GTGTGGAAGGAGAAGAAGGAGGG + Intronic
1136522019 16:30802942-30802964 GTATGAAAGGGGAGGCCGGATGG + Intergenic
1138423169 16:56912986-56913008 GTGAGCAAGGCGAGGGTGGGAGG + Intronic
1138645704 16:58422954-58422976 GTGTGGGAGGCGATGGTGAAGGG - Intergenic
1141860148 16:86710872-86710894 GTGGGGCAGAGGAGGCTGGAGGG + Intergenic
1141862853 16:86729760-86729782 TTTTGAAAGGCGAGGCTCGAAGG + Intergenic
1142020772 16:87780863-87780885 GGGAGGAAGGCGTGGGTGGAGGG - Intergenic
1142234538 16:88915520-88915542 GTGTGGAGGGGGAGCGTGGAGGG + Intronic
1142289641 16:89187693-89187715 GGGTGGAAGCCCAAGCTGGAGGG + Intronic
1142967003 17:3588042-3588064 GTGGGGAACGTGAGGCTGCAGGG + Intronic
1143451911 17:7041762-7041784 CTGGGGGAGGCGTGGCTGGAGGG + Exonic
1144658837 17:17055495-17055517 GGGTGGACAGAGAGGCTGGAAGG - Intronic
1144825060 17:18101116-18101138 GTGTGCAAGCAGAGGCAGGATGG + Intronic
1144938481 17:18919120-18919142 CTGTGGAAGGCTAAGGTGGAAGG + Intronic
1144996921 17:19276104-19276126 GTGGGGAAGGTGTGGCTGGTGGG + Intronic
1145901903 17:28495133-28495155 GTCTGGAATGCCAGGCTGTAAGG - Intronic
1146953374 17:36921649-36921671 CTGTGGAAGGTGAGGCTTGGCGG - Intergenic
1147136093 17:38434908-38434930 GGCTGGAAGGAGAGGCTGGAGGG + Intronic
1147387387 17:40090442-40090464 GTGTGGAAGGAGGAGGTGGATGG - Intronic
1148350343 17:46937126-46937148 GTAGGGAAGGACAGGCTGGATGG + Intronic
1149517185 17:57289550-57289572 GTCTGTAAGACGAGCCTGGAAGG + Intronic
1149649810 17:58269635-58269657 GGGTGGAAGGTGAGGGAGGAGGG + Intergenic
1149740806 17:59044050-59044072 TTTGGGAAGCCGAGGCTGGAGGG + Intronic
1149990058 17:61378140-61378162 GGGTGGGAGGTCAGGCTGGAAGG - Intronic
1151288993 17:73134942-73134964 GTGTGGAAGGGGAAGATGGCTGG + Intergenic
1151487055 17:74407635-74407657 GGGAGGGAGGCCAGGCTGGATGG + Intergenic
1152289906 17:79434155-79434177 GTGTGAGAGCTGAGGCTGGAAGG + Intronic
1152336828 17:79703479-79703501 GTCTGGAAGGCCAGGAGGGAGGG - Intergenic
1152720220 17:81919958-81919980 GTGTGGAAGAGGAGGGTGTAAGG - Exonic
1152825758 17:82463715-82463737 GTCAGGAAGGAGAGGGTGGAGGG + Intronic
1153463974 18:5368215-5368237 GTGTGAAAGGAGAGGGAGGAAGG - Intergenic
1153500181 18:5741074-5741096 GTGAGGAAAAGGAGGCTGGAAGG + Intergenic
1154128792 18:11717272-11717294 GTGTGGAGGGAGAGGCGGGGAGG - Intronic
1155308862 18:24504682-24504704 GTGTGGAGGGCGGGGAGGGAAGG + Intergenic
1156022257 18:32613228-32613250 GTGAGGAAGGGCAGTCTGGAAGG - Intergenic
1157260393 18:46171724-46171746 CAGTGGAAGGCCAGGATGGAGGG + Intergenic
1157421934 18:47554989-47555011 GTGTGGAAGGTGAGGGAAGAGGG - Intergenic
1157640840 18:49212738-49212760 CTTTGGAAGGCCAGGGTGGATGG - Intronic
1158911947 18:62073199-62073221 GTGTGTAAGGGGGGGATGGAGGG + Intronic
1160216780 18:76939514-76939536 GTGGGCAGGGGGAGGCTGGATGG + Intronic
1160239026 18:77109401-77109423 GTGTGGAAGGTGAGGAAAGAGGG + Intronic
1160429853 18:78803921-78803943 TGGTGGAGGGAGAGGCTGGAAGG - Intergenic
1161000292 19:1907433-1907455 GGGTGGAAGCCGAGGCTTGGAGG + Intronic
1161004828 19:1929982-1930004 GGGTGGAGGGGGAGCCTGGAGGG - Intergenic
1161274908 19:3410522-3410544 GTGAGGAAGGGGAGACAGGAAGG + Intronic
1161657652 19:5525793-5525815 GTGAGGGAGGGGAGGATGGATGG - Intergenic
1161894248 19:7068759-7068781 GTGTGGGAGGCCCGGGTGGAAGG + Intergenic
1162025295 19:7890321-7890343 TTGTGGCAGGCCAGGCTGGAAGG - Intronic
1162992847 19:14314596-14314618 GTGCAGAAGGGGAGGCTGGGTGG + Intergenic
1163015420 19:14451404-14451426 CTGTGGAAGGTGGGGCTGGCTGG - Intronic
1163816045 19:19465144-19465166 TTGAGGAAGGCTAGGCAGGAGGG - Intronic
1164455612 19:28404138-28404160 GTGTACATGGGGAGGCTGGATGG + Intergenic
1164514344 19:28921442-28921464 CTGTGGAGTGAGAGGCTGGAGGG + Intergenic
1164990026 19:32676276-32676298 GAGTGCAAGGCGCTGCTGGACGG + Exonic
1165246418 19:34500697-34500719 GTCTGGAAGGCGGGGCTGGCGGG + Exonic
1165856755 19:38883613-38883635 GGATGAAAGGTGAGGCTGGAGGG - Exonic
1166092021 19:40515474-40515496 GTGTGGAAGGGAAGGATGGGAGG - Intronic
1166389170 19:42399501-42399523 CAGTGGAAGGCAAGGCTGGCGGG - Intergenic
1167307174 19:48715834-48715856 GTGTGGAAAGCGGGGCTCCAGGG + Intronic
1167369011 19:49069984-49070006 GGGTGGAGGGCAAGGCTGGGGGG - Exonic
1167557083 19:50203397-50203419 GGGTGGAAGCCGAGGCCTGATGG - Intronic
1168649939 19:58086432-58086454 AAGAAGAAGGCGAGGCTGGAAGG + Intronic
925038970 2:715430-715452 ATCTGGAAGGCGAGGGTGCATGG - Intergenic
925283439 2:2700941-2700963 GAGGGGAAGGGGAGGATGGAGGG - Intergenic
926001867 2:9339811-9339833 GAGAGGCAGGTGAGGCTGGAAGG - Intronic
926215131 2:10901692-10901714 GGGTGGGAGGCGGTGCTGGATGG - Intergenic
926272318 2:11375978-11376000 GTATGGGTGGGGAGGCTGGAAGG - Intergenic
926726803 2:16004910-16004932 ATGGGGAAACCGAGGCTGGAAGG + Intergenic
926831767 2:16971032-16971054 GTGTTGAAGGCGGGTCTTGAAGG + Intergenic
928265851 2:29811171-29811193 AGGTCGAAGGCCAGGCTGGAGGG + Intronic
929893525 2:45938260-45938282 GTGTAGATGGCTTGGCTGGAGGG + Intronic
930065297 2:47323335-47323357 GTGTGGAATGCAGGGCTGGGTGG - Intergenic
930078568 2:47428089-47428111 CTTTGGGAGGCGAGGCTGGCAGG + Intronic
932416904 2:71579072-71579094 GGGTGGAGAGGGAGGCTGGATGG - Intronic
932564162 2:72895122-72895144 GTGAGGTAGGAGAGGCTGGCTGG - Intergenic
932574215 2:72954054-72954076 ATGTGGTAGACGAGGCAGGAAGG - Intronic
932873677 2:75428982-75429004 CTGTGGAAGAGGAGGCTGGCTGG + Intergenic
933307875 2:80624677-80624699 GTTTGGAAGTCGAGGATTGATGG + Intronic
934589158 2:95530746-95530768 GTGTGGATGGTGGGGCTGCAGGG - Intergenic
934859477 2:97751930-97751952 GTGTGGAAGGTGGGGCTTGGTGG - Intergenic
934909155 2:98234792-98234814 CTGTGGAAAGGGAGGCTGGTTGG - Intronic
935388242 2:102523712-102523734 GTGTGAGAGGTGAGACTGGAGGG - Intronic
935553592 2:104483380-104483402 GTGGGGAAGGTGGGGCTGGGTGG + Intergenic
935581081 2:104756347-104756369 GTGAGGAAGCTGAGACTGGAAGG + Intergenic
936053933 2:109246597-109246619 GTGTGGAAAGGAAGGCTGGAGGG - Intronic
936586647 2:113764028-113764050 GTGTTGGAGGAGAGGCTGGGTGG - Intergenic
937117646 2:119420105-119420127 GTGTTGAAGGTGGGGCTGGTGGG - Intergenic
937227577 2:120378571-120378593 AAGTGGGAGGCGAGGCTGGCAGG + Intergenic
937309488 2:120893327-120893349 GTGGGGGAGGGGAGGCTGGGGGG - Intronic
938308228 2:130268676-130268698 GTGTGGAGGGAAAGGCTGGAGGG + Intergenic
938447101 2:131388160-131388182 GTGTGGAGGGAAAGGCTGGAGGG - Intergenic
938452242 2:131431659-131431681 CTGTGGAAGGTGAGGGAGGAAGG + Intergenic
939163104 2:138612170-138612192 CTGGGGAAGTCAAGGCTGGATGG + Intergenic
940311587 2:152284961-152284983 GGGAGGAAGGGGAGGCTAGAAGG - Intergenic
941178852 2:162234851-162234873 GTGTGGAGGGAGAGGCAGGGAGG + Intronic
945158677 2:206865651-206865673 GTTTGGAAAAGGAGGCTGGAAGG - Intergenic
945289035 2:208109841-208109863 CTTTGGAAGGCCAGGGTGGAAGG + Intergenic
946431447 2:219628947-219628969 GAGTGGGAGGAGAGGGTGGATGG - Intronic
946440297 2:219689396-219689418 TTGTGGAAGGAGAGGGAGGACGG - Intergenic
946559508 2:220896961-220896983 GTCTGGAAGGAGAGGCCAGAAGG - Intergenic
947525047 2:230872577-230872599 GTCCGGAAGGCCAGGCTAGAAGG - Intronic
947587031 2:231362629-231362651 GTGAGGAAGAAGAGGATGGAAGG + Intronic
947935960 2:234003821-234003843 GTGTGGGAGGAGGGGCTGCATGG + Intronic
948088118 2:235267500-235267522 CTGTGGCAGGAGAGGTTGGAAGG - Intergenic
948210541 2:236189956-236189978 GGGTGGAAGGGGTGGCTGGAGGG + Intergenic
948726084 2:239934952-239934974 GTGGGGAGGGCCAGGCTGGTGGG - Intronic
948888675 2:240896528-240896550 GTGAGGAAGGGGAGGCAGGGCGG + Intronic
1169497559 20:6129824-6129846 CTGGGGAATGGGAGGCTGGATGG + Intergenic
1169912874 20:10661556-10661578 GTGTGTAAGACAAGGCTGGCAGG + Intronic
1171091498 20:22289819-22289841 GTGTGGCAGGAGAGGCTCCAGGG - Intergenic
1171461500 20:25300627-25300649 GTGTGGAAAGCGTGGGTGGCAGG - Intronic
1171937326 20:31287304-31287326 GTGTGGAATGAGGGGATGGATGG - Intergenic
1172107084 20:32523206-32523228 GGGTGGAAGGGGAGGATAGAAGG + Intronic
1172463547 20:35137938-35137960 GGGTGGAAGTAGAGGCTGGATGG - Exonic
1172847384 20:37938063-37938085 TTGTGGAAGAAGAGGCTGGAAGG + Intronic
1173750044 20:45469661-45469683 GCGGGGAAGGGGAGGGTGGAGGG - Intergenic
1173851144 20:46219032-46219054 GAATGGAAGGAGAGGCTGTAGGG + Intronic
1174151562 20:48489695-48489717 GTGGAGAAGGCGAGGCTGATGGG + Intergenic
1174395475 20:50244307-50244329 ATGAGGAAGGCGAGGCAGCATGG + Intergenic
1174466852 20:50724502-50724524 GGGTGGAAGGAGAGGCTGGGTGG - Intergenic
1175160765 20:57005911-57005933 GACTGGAAAGAGAGGCTGGAAGG - Intergenic
1175429626 20:58891997-58892019 CTGTGGGGGGCGAGGCCGGAAGG + Intronic
1175933330 20:62503624-62503646 GAGGGGAAGGGGAGGCTGGTGGG + Intergenic
1176457765 21:6928609-6928631 GGGTGGCAGGGGAGACTGGAAGG - Intergenic
1176613796 21:9011034-9011056 CTGTGGAAGGGGAGGTGGGAAGG + Intergenic
1176618123 21:9038924-9038946 GAGTGGAAGGTGAGGTTTGAGGG - Intergenic
1176835937 21:13793693-13793715 GGGTGGCAGGGGAGACTGGAAGG - Intergenic
1178950453 21:36981064-36981086 GTGTTGCAGGCGAGCGTGGAAGG - Intronic
1179185524 21:39082858-39082880 GTGTGGAAGGCGGGGCCGGAGGG - Intergenic
1179435246 21:41358268-41358290 GTGTGAAAAGCCAGGCTGAAGGG + Intergenic
1180002910 21:45003138-45003160 GCCTGGAAGGGGTGGCTGGAGGG - Intergenic
1180725799 22:17945721-17945743 ATGTGGGAGGCTAGACTGGAAGG - Intronic
1180802074 22:18636615-18636637 GTGTGGGGGGCGAGGGGGGACGG + Intergenic
1180853311 22:19032167-19032189 GTGTGGGGGGCGAGGGGGGACGG + Intergenic
1180931094 22:19592354-19592376 CTGTGGAAGCTGAGGCAGGAGGG - Intergenic
1181027145 22:20132749-20132771 GTGAAGAAGTTGAGGCTGGAGGG - Intronic
1181511824 22:23392765-23392787 GGGTGGAGGGCGAGGCTGCCAGG + Intergenic
1181602105 22:23958810-23958832 AGATGGAGGGCGAGGCTGGAGGG - Intronic
1181606405 22:23982497-23982519 AGATGGAGGGCGAGGCTGGAGGG + Intronic
1182253165 22:29018071-29018093 GTGTGGGAGGGGAGGGCGGACGG + Intronic
1182379903 22:29879556-29879578 GTAGGGAAGCCGAGGCAGGAGGG + Intergenic
1182572883 22:31251986-31252008 CTGAGGAAGGCCTGGCTGGATGG - Intronic
1182659516 22:31915398-31915420 GTGGGGAAGGGGATGCTGGAGGG + Intergenic
1182811194 22:33118237-33118259 GAGTGGAAGGCCAGAGTGGAAGG + Intergenic
1183002417 22:34872424-34872446 GTGTTCAAGGAGAGGCTGGATGG - Intergenic
1183650801 22:39152362-39152384 GTGCGGAAGGTGAGGCTGCCCGG - Exonic
949491212 3:4590874-4590896 TTGTGGAGGGGGAGGGTGGAAGG - Intronic
951330155 3:21357337-21357359 GTGAGCATGGCCAGGCTGGAGGG - Intergenic
952109143 3:30102551-30102573 GTGAGGAAGGCCAGGCTGCATGG + Intergenic
952494625 3:33904968-33904990 GACTGAAAGGAGAGGCTGGAGGG + Intergenic
952529079 3:34244545-34244567 CTGTGGAAGGCGAGGGTTGTGGG - Intergenic
953731551 3:45454010-45454032 GTGTGAAGGGCGAGGCAGGGAGG + Intronic
954082743 3:48222043-48222065 GGGTGGAAGGAGAGGCCAGAGGG + Intergenic
957506696 3:81130771-81130793 GTGTTGAAGGAGAGGCTTGGTGG + Intergenic
957856237 3:85882172-85882194 GTGTGGAGGGTGAGGCGGGAGGG - Intronic
957892177 3:86374448-86374470 GAGTTGAAGGCGAAGCTGAAAGG + Intergenic
959499801 3:107093014-107093036 GAGTGGAAGGACAGGCTGGTAGG + Intergenic
961260959 3:125601503-125601525 GTGTAGAAGGCCAGGCATGATGG + Intergenic
962893377 3:139692467-139692489 ATGGGAAAGGTGAGGCTGGAGGG + Intergenic
962963999 3:140336916-140336938 GTGGGGAAGGTGGGGCGGGATGG - Intronic
965252588 3:166361826-166361848 GTGTTGAAGGTGAGGCTTGGTGG + Intergenic
966629012 3:182051088-182051110 GTGTGGGAAGTGAGGCAGGAAGG - Intergenic
968008392 3:195257901-195257923 GTGAGGATGGAGAGGCTGGCTGG - Intronic
968470678 4:781119-781141 GCGAGGAAGGCAAGGCTGGTGGG + Intergenic
968549488 4:1214798-1214820 GTGGGGGAGGCTGGGCTGGAGGG - Intronic
968626044 4:1627129-1627151 GGGTGCAAGGCCAAGCTGGACGG - Intronic
968875600 4:3266036-3266058 CTGTCGGAGGCGAGGCTGGGAGG + Intronic
968959796 4:3737703-3737725 GTGTGAGAGGAGGGGCTGGAGGG - Intergenic
969442878 4:7227687-7227709 GGGTGAAAGGCGAGGAAGGAGGG - Intronic
970248869 4:14093239-14093261 GGGTGGAAGAGGAAGCTGGATGG + Intergenic
970572047 4:17392892-17392914 GGGTGGAAGGAGAGGGTGGAAGG + Intergenic
971214301 4:24649335-24649357 GTGTGGAAAGCCTGTCTGGATGG - Intergenic
972430893 4:38980801-38980823 GGGTGGCAGGAGAGGCGGGATGG + Intronic
972447636 4:39161041-39161063 CTGTGGGAGCTGAGGCTGGAAGG - Intergenic
972751110 4:41990389-41990411 GTGGGGAGGGCGTGGCTGCAGGG - Intergenic
973246664 4:48017034-48017056 GTGTTGAACGCCTGGCTGGACGG - Intronic
973816410 4:54623405-54623427 GTGAGGAAGGCGAGAGTGGAAGG - Intergenic
979158521 4:117429244-117429266 GTGGGGAAGGTGGGGCTGGCTGG + Intergenic
981344077 4:143655008-143655030 GTGTGGAAATGGAGGATGGAGGG - Intronic
981419766 4:144535878-144535900 CTCAGGAAGGAGAGGCTGGATGG - Intergenic
981773053 4:148332679-148332701 GTGTGGGAGGCAAGGCTCTAAGG - Intronic
982111555 4:152061046-152061068 AGGTGGAAGGGGAGGCAGGAGGG + Intergenic
982964046 4:161879564-161879586 GTGAGGAAGGAGAGACTGAATGG - Intronic
983251369 4:165350261-165350283 CTTTGGAAGGCCAGGATGGAAGG - Intergenic
984933437 4:184868563-184868585 GTGTGGGAAGCCAGGCAGGATGG + Intergenic
985478810 5:94469-94491 GAGTGGGTGGCGGGGCTGGAGGG + Intergenic
985478843 5:94582-94604 GAGTGGCTGGCGGGGCTGGAGGG + Intergenic
985629099 5:1005551-1005573 GAGCGAAAGGCGAGGCAGGACGG + Intergenic
985877952 5:2614518-2614540 GTATGGCAGGTGAGGCTGGGAGG - Intergenic
985884891 5:2670153-2670175 CAGTGGAAGGGGAGGCTGGAGGG - Intergenic
986034940 5:3928257-3928279 GTGTGTAGGGGGAGGCGGGAGGG - Intergenic
986125991 5:4882730-4882752 GGCTGGAGGGCCAGGCTGGAAGG + Intergenic
987321087 5:16770009-16770031 CTTTGGAAGGCCAAGCTGGAAGG - Intronic
990669963 5:58117127-58117149 GTGTGGATGAAGGGGCTGGATGG + Intergenic
991144398 5:63283832-63283854 GTGGGGACGGGGAGGGTGGAGGG + Intergenic
992560467 5:77947519-77947541 GTGTTAAAGGAAAGGCTGGAAGG - Intergenic
992890640 5:81200994-81201016 GTGTGAGAGAAGAGGCTGGAGGG + Intronic
993926339 5:93870733-93870755 GGGTGGAAGTGGAGGTTGGAGGG + Intronic
994626808 5:102230323-102230345 GTGTTGAAGGAGGGGCTTGATGG - Intergenic
995881402 5:116848232-116848254 AGGTTGAAGGAGAGGCTGGAAGG - Intergenic
997593798 5:135092695-135092717 GTGAGGAAGGAGAGGGTGTATGG - Intronic
997737495 5:136224783-136224805 CTGTGGAAGCAGAGGGTGGAGGG - Intronic
998500614 5:142629405-142629427 ATTTGGAAGGCCAGGGTGGAAGG - Intronic
999431468 5:151528671-151528693 GAGTGGAGGGAGAGACTGGAAGG + Intronic
1000085996 5:157887690-157887712 GTGTGGAAGGGGACCCTGGCAGG - Intergenic
1000752460 5:165113876-165113898 AGGTGGAAGGGGAGCCTGGAGGG - Intergenic
1001293890 5:170485426-170485448 GTGTGGACGGGGAGGGTGGCTGG + Intronic
1001773598 5:174312807-174312829 GGGTGAAGGGCGAGGCCGGAGGG - Intergenic
1002050514 5:176568098-176568120 GTGTCGGAGCAGAGGCTGGATGG + Intronic
1002173957 5:177391081-177391103 GTGGGGTAGGAGAGGCTGGAGGG - Intronic
1002185056 5:177450546-177450568 CTATGGAAGGAGATGCTGGAGGG - Intronic
1002435095 5:179226518-179226540 CTGTGGGAGGCCAGGGTGGATGG - Intronic
1003076633 6:2988646-2988668 GTAGGGGAGGCGGGGCTGGAGGG + Intronic
1003558119 6:7158547-7158569 GTATGGAGGTGGAGGCTGGAGGG - Intronic
1004845177 6:19633896-19633918 GTGTGGAAAGGGAGGTGGGATGG + Intergenic
1004903142 6:20212194-20212216 GTGCGGTAGGAAAGGCTGGACGG + Exonic
1005305056 6:24505531-24505553 GAGTGGAGGGCAAGGCTGGCGGG - Intronic
1005822227 6:29607416-29607438 GTGTGGAAGTAGAGGGTGGATGG - Intronic
1006228066 6:32557701-32557723 TTGTGGGAGGGGAGGCAGGAGGG - Intronic
1006230657 6:32583850-32583872 TTGTGGGAGGGGAGGCAGGAGGG - Intronic
1007181741 6:39933958-39933980 GGGTGCAAGGCAAGGCTGAAAGG + Intronic
1009437649 6:63636195-63636217 GTGTGGAAGGGGATGGGGGAGGG - Intronic
1013236944 6:108205519-108205541 AGGTGGAAGGGGAGGCAGGAGGG - Intergenic
1014290378 6:119551329-119551351 GTGAGCAAGGGGAGGATGGAAGG - Intergenic
1015982950 6:138857441-138857463 GTGTGGGAGGTGAGGATGGAGGG - Intronic
1017213359 6:151881035-151881057 GTGTGGGAGGCGGTGATGGAAGG + Intronic
1017491138 6:154946208-154946230 GTGGGGAAGGGGAGGGTGGAAGG - Intronic
1018228834 6:161656291-161656313 GTGTGAGAGGCGCGGATGGATGG - Intronic
1018583227 6:165326152-165326174 GTGTGGAAGGAAAGAATGGAAGG - Intergenic
1018800590 6:167219211-167219233 GTCTGGAAAGCAAGGCTGGCTGG + Intergenic
1018962259 6:168457347-168457369 GTGTTGAAGGTGGGGTTGGATGG - Intronic
1019057873 6:169236060-169236082 GTGTGGATGGTGAGTGTGGATGG - Intronic
1019057935 6:169236346-169236368 GTGTGGATGGGGAGTGTGGATGG - Intronic
1019057942 6:169236375-169236397 GTGTGGATGGGGAGTGTGGATGG - Intronic
1019057987 6:169236604-169236626 GTGTGGATGGCGAGTGTGGATGG - Intronic
1019057992 6:169236633-169236655 GTGTGGATGGCGAGTGTGGATGG - Intronic
1019517371 7:1445989-1446011 GTGTGGAAGGACAGTCGGGAGGG + Intronic
1019537909 7:1538476-1538498 GTGGGGAGGGCGGGGCGGGAGGG + Intronic
1019603698 7:1898067-1898089 GTGTGGAGGGCTGGGCGGGAAGG - Intronic
1019626154 7:2016592-2016614 GCGAGGAGGGCGAGGCTGCAGGG + Intronic
1019644561 7:2122014-2122036 GTGGGGAGGGGGAGACTGGAGGG + Intronic
1019700712 7:2474030-2474052 GTGTGGAACCTGAGGCTGGTTGG + Intergenic
1020384402 7:7582002-7582024 GTGTGGTTGGCGGGGCGGGAGGG + Intronic
1021710005 7:23406650-23406672 GTGTGGAAGGGGACCCTGGCGGG + Intronic
1022194731 7:28053849-28053871 GTGGGAAAGGTGAGGATGGAAGG - Intronic
1023986363 7:45099458-45099480 GTCTCTAAGGAGAGGCTGGAAGG + Intergenic
1025922656 7:65927934-65927956 GGGTGAAAGGGGAGGCAGGAAGG + Intronic
1028950205 7:96626147-96626169 GTTTGGAAGGGGAGGTGGGATGG - Intronic
1030024927 7:105314086-105314108 CTTTGGGAGGCGAGGCTGGCCGG + Intronic
1031979787 7:128117049-128117071 TTGTGGCTGGCGAGGCCGGACGG - Intergenic
1033700823 7:143836701-143836723 GTGTCGGAGGCGAGGCGGGGCGG + Intergenic
1033781808 7:144680139-144680161 GTGTGGCAGGTGAGGCTGTTGGG - Intronic
1034067160 7:148148053-148148075 GTGTGGAAGGAAAGGAAGGAAGG + Intronic
1034176531 7:149104405-149104427 GTGTGGCAGGCGAGCTTGGAAGG + Exonic
1034848202 7:154467330-154467352 GTGTTGAATGAGAGGCTGGTGGG + Intronic
1034888682 7:154819977-154819999 GAGTGGACGGTGGGGCTGGAAGG + Intronic
1035056268 7:156038832-156038854 GGGTGGAGGTGGAGGCTGGAGGG + Intergenic
1035287407 7:157815156-157815178 GTGAGGACGGTGAGGCTGAAGGG - Intronic
1035689617 8:1551457-1551479 GTGGAGAAGGCGCAGCTGGAGGG - Intronic
1035700764 8:1638037-1638059 GCCTGGAGGGAGAGGCTGGAAGG + Intronic
1036752135 8:11450017-11450039 GTGGAGAATGCGAGGCTGGAAGG - Intronic
1039778134 8:40757147-40757169 GTATGGAAGCCGAAGCAGGAAGG + Intronic
1040532971 8:48280867-48280889 GTGTGGAATGGGTGGGTGGATGG - Intergenic
1040984701 8:53280851-53280873 GGGTGGGAGATGAGGCTGGAGGG + Intergenic
1042871712 8:73405656-73405678 TTGGGGAAGGGGAAGCTGGAAGG - Intergenic
1042950839 8:74199292-74199314 GGGAGGAAGGGGAGGCAGGAAGG - Intergenic
1043400888 8:79883128-79883150 GTGTGGAAGGAGAGGCAAGGAGG - Intergenic
1043789644 8:84448183-84448205 GTGTGGAAGGGTGGGCTGGAGGG - Intronic
1043941478 8:86200603-86200625 GTGAGGCAGGCGAGGCAGGCAGG + Intergenic
1044035582 8:87299250-87299272 ATGTGGAAGGAGAGGAAGGAAGG - Intronic
1044906013 8:97003786-97003808 TTGTGGTAGGTGAGGCAGGATGG + Intronic
1047746998 8:127852748-127852770 GTGTGGATGGAGAGGGAGGAGGG - Intergenic
1048234455 8:132675832-132675854 GTCTGGAAGGCAAGCCTGGAAGG - Intergenic
1048565627 8:135593718-135593740 TTGTGGAAGCCGAGGCAGGAGGG - Intronic
1048799428 8:138182419-138182441 GTGTGGCAGGCGTGGATGGCAGG - Intronic
1049604494 8:143522984-143523006 ATGTGAAGGGCTAGGCTGGATGG - Intronic
1049687933 8:143946430-143946452 GGGAGGAAGGCGAGGCAGGAAGG + Intronic
1049844413 8:144793001-144793023 GTGGGGAGGGCCAAGCTGGAGGG + Intergenic
1050360620 9:4827363-4827385 CTGTGGTAGCTGAGGCTGGAGGG + Intronic
1050376226 9:4976158-4976180 TGGTGGATGGCTAGGCTGGAAGG + Intergenic
1051416850 9:16850624-16850646 CTGTGGAAGGTGAAGGTGGAAGG + Intronic
1051569549 9:18540479-18540501 GTTTGGAAGGTGAGGCATGAAGG + Intronic
1052985395 9:34483146-34483168 GTGTGGAAGGAGAGGCGTGGAGG - Intronic
1055849944 9:80614840-80614862 GTGTGGAGGGGGAGACAGGAAGG - Intergenic
1056532081 9:87497250-87497272 GTGTTGGAGCCGAGGCTTGAAGG - Intronic
1056667977 9:88597167-88597189 GGGAGGAAGGAAAGGCTGGAGGG - Intergenic
1057151094 9:92796668-92796690 GTGTGGAAGCAGAGGCTGTGTGG - Intergenic
1057220931 9:93257394-93257416 GTAGAGAAGGTGAGGCTGGAGGG - Intronic
1057865577 9:98677786-98677808 CTGTGAAGGTCGAGGCTGGAGGG - Intronic
1058962910 9:110008582-110008604 ATGGGGAAGGCGAGTCTAGAAGG + Intronic
1059116513 9:111604568-111604590 GGGTAGAAGGAGAGGCTGGAAGG - Intergenic
1060205435 9:121680163-121680185 GTGTAGGAGGTGAGGCTGGGAGG + Intronic
1060227630 9:121804086-121804108 GTGTTGAGGGTGAGGGTGGACGG - Intergenic
1060227804 9:121806080-121806102 GTGTTGAGGGTGAGGGTGGACGG + Intergenic
1060231091 9:121826007-121826029 GTGTGGAAAGAGATGATGGAGGG + Intronic
1060900570 9:127253871-127253893 GTGTGCAAGTAGAGACTGGATGG + Intronic
1060942154 9:127548984-127549006 GTGTGTAAGCAGAGGCTGGAGGG + Intronic
1061166493 9:128925734-128925756 GGGTGGAAGAGGAGGCAGGAGGG - Intronic
1061349670 9:130054221-130054243 GTGGGGAAGGCGGGTCTGGGCGG + Intronic
1061930277 9:133828822-133828844 GTGTGGAAGGCGAGGCTGGAGGG - Intronic
1061950900 9:133935365-133935387 GTGTGGAGGGCGGGGCTGATAGG - Intronic
1062683689 9:137799041-137799063 GTGTGGAAGAGGACGCTGGAGGG - Intronic
1062683708 9:137799121-137799143 GTGTGGAAGAGGACGCTGGAGGG - Intronic
1185672820 X:1825735-1825757 GTGTTGGTGGTGAGGCTGGATGG - Intergenic
1185673021 X:1826660-1826682 GTGTTGGTGGTGAGGCTGGATGG - Intergenic
1186514489 X:10156444-10156466 ATTTGAAAGGCGAGGGTGGAGGG + Intergenic
1186641781 X:11463247-11463269 GTGTGGAGAGGGAGGATGGAGGG + Intronic
1186780007 X:12903003-12903025 ATGTGTAAGACCAGGCTGGATGG + Intergenic
1187274349 X:17805213-17805235 GTGTTGAAGGAGAGGCTGTGGGG - Intronic
1187415840 X:19092647-19092669 GTGAGGAGGGTGAGGCTGGAGGG - Intronic
1187468679 X:19548872-19548894 TTGTGGAAGGTGAGCTTGGAGGG + Intronic
1187498142 X:19814143-19814165 GTGTGGCAGGAGAGGAAGGAGGG - Intronic
1187859384 X:23666892-23666914 GTAGGGAAGGCGAGGCGAGAGGG - Intronic
1188138247 X:26516343-26516365 AGGTGGAAGGGGAGGCAGGAGGG - Intergenic
1189174733 X:38944728-38944750 GTCAGGAAGGGGAGGCTGAATGG - Intergenic
1189391463 X:40580549-40580571 CTGTGAAAGGCGGGGCTGGTTGG - Intergenic
1192224329 X:69217860-69217882 GTTTGGAAGTAGAGGCTGGATGG + Intergenic
1195339373 X:103891259-103891281 GTGTGGTGGGGGAGGGTGGAGGG - Intergenic
1195598704 X:106722131-106722153 GTTTGGAAGAGGAGGGTGGAAGG + Intronic
1195679288 X:107531719-107531741 GTGTGGTAGCAGAGGGTGGAGGG - Intronic
1199594168 X:149493568-149493590 GAGTGGATGGAGAGGCTGCAGGG + Intronic
1200873665 Y:8128884-8128906 GTGTGGAGGGAGAGGCGGGGCGG - Intergenic
1201151513 Y:11097761-11097783 GAGTGGAAGGTGAGGTTTGAGGG - Intergenic
1201736177 Y:17264371-17264393 GTGGGGTGGGGGAGGCTGGAGGG + Intergenic