ID: 1061930676

View in Genome Browser
Species Human (GRCh38)
Location 9:133831565-133831587
Sequence CTGTAGTTCAGGAAGTGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061930673_1061930676 -7 Left 1061930673 9:133831549-133831571 CCTGGCCATGTGGGGGCTGTAGT 0: 1
1: 0
2: 0
3: 13
4: 192
Right 1061930676 9:133831565-133831587 CTGTAGTTCAGGAAGTGTCCTGG No data
1061930668_1061930676 7 Left 1061930668 9:133831535-133831557 CCAGCAGGGGCAGGCCTGGCCAT 0: 1
1: 0
2: 4
3: 32
4: 348
Right 1061930676 9:133831565-133831587 CTGTAGTTCAGGAAGTGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061930676 Original CRISPR CTGTAGTTCAGGAAGTGTCC TGG Intronic
No off target data available for this crispr