ID: 1061933501

View in Genome Browser
Species Human (GRCh38)
Location 9:133845297-133845319
Sequence CAGCCCGCATGGCACGCCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061933494_1061933501 22 Left 1061933494 9:133845252-133845274 CCACGGGCTGGATGGCAGGGGCT 0: 1
1: 0
2: 0
3: 48
4: 650
Right 1061933501 9:133845297-133845319 CAGCCCGCATGGCACGCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061933501 Original CRISPR CAGCCCGCATGGCACGCCCA AGG Intronic
No off target data available for this crispr