ID: 1061936507

View in Genome Browser
Species Human (GRCh38)
Location 9:133860638-133860660
Sequence CTGGAATGGCAGAGAGAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 426
Summary {0: 1, 1: 0, 2: 4, 3: 39, 4: 382}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061936507_1061936510 -1 Left 1061936507 9:133860638-133860660 CCAGGCTCTCTCTGCCATTCCAG 0: 1
1: 0
2: 4
3: 39
4: 382
Right 1061936510 9:133860660-133860682 GCCTCTCCTTCTCACCCTGCTGG No data
1061936507_1061936515 16 Left 1061936507 9:133860638-133860660 CCAGGCTCTCTCTGCCATTCCAG 0: 1
1: 0
2: 4
3: 39
4: 382
Right 1061936515 9:133860677-133860699 TGCTGGCCCCTGTCCTCCCAAGG No data
1061936507_1061936516 17 Left 1061936507 9:133860638-133860660 CCAGGCTCTCTCTGCCATTCCAG 0: 1
1: 0
2: 4
3: 39
4: 382
Right 1061936516 9:133860678-133860700 GCTGGCCCCTGTCCTCCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061936507 Original CRISPR CTGGAATGGCAGAGAGAGCC TGG (reversed) Intronic
900600424 1:3500408-3500430 CAGGAAAGGCAGAGGAAGCCAGG + Intronic
901217058 1:7560854-7560876 CTGGAAGGGCAGGGACAGGCAGG + Intronic
901637229 1:10676010-10676032 CAGGGATGGCAGAGACAGTCAGG + Intronic
901764960 1:11494056-11494078 CTGGTATGGCCAAAAGAGCCTGG + Intronic
901822151 1:11837146-11837168 CTGGAAAGGAGGTGAGAGCCTGG + Exonic
902318415 1:15641619-15641641 AGGGAATGGCAGTGTGAGCCAGG + Intronic
903028166 1:20444285-20444307 AGGGAATGTCAGAAAGAGCCAGG + Intergenic
903375585 1:22863753-22863775 TCTGAATGGCAGAAAGAGCCAGG - Intronic
903673519 1:25050515-25050537 TGGGAATGGCAGAGGGACCCGGG + Intergenic
903741572 1:25561664-25561686 CTGGAATGGCTGAGAGAGGAAGG + Intronic
903759584 1:25688631-25688653 CTGGAATGGTGGAAAGAACCCGG + Intronic
904108796 1:28108553-28108575 ATGGAATGGCAGAGGCAGGCAGG - Intergenic
906096559 1:43228167-43228189 CTGGAGAGGCAGGGAGAGGCTGG - Intronic
906184834 1:43853995-43854017 CTGGAAGGGCAGAGAGAGAGGGG - Intronic
906297679 1:44659158-44659180 CTGGAATGGGAGAGAGACTGGGG - Intronic
907301637 1:53490496-53490518 CTGAAATGGCAGAGACAGACTGG - Intergenic
907592539 1:55689481-55689503 CTGGTATAGAAGAGAGAGCATGG - Intergenic
907902207 1:58751236-58751258 TTGGAAGGGCACAGAGAGACTGG - Intergenic
908393284 1:63702799-63702821 CTGGAGTGGGAGAGGGAGGCAGG + Intergenic
909548495 1:76873076-76873098 CTGGAATTTAAGAGTGAGCCTGG - Intronic
910065760 1:83148697-83148719 CTGGAATTGCAGAGAGATCAAGG + Intergenic
911497764 1:98651291-98651313 TTGGAATGGCAGTGGGAGCGGGG + Intergenic
911760596 1:101610366-101610388 ATAGAATGGAATAGAGAGCCTGG + Intergenic
912469727 1:109898217-109898239 CTGGAAGGGGTGAGTGAGCCTGG - Intergenic
912664897 1:111570137-111570159 CTGGCATGGCAGTGAGAGCAGGG - Intronic
914980892 1:152413419-152413441 CTGGAAAGCCAGAGAGAGGATGG + Intronic
914985881 1:152456934-152456956 CTGGAAGTGGAGAGAGACCCAGG - Intergenic
917768597 1:178250550-178250572 CTGGAAAGGCAGCTAAAGCCAGG - Intronic
918615642 1:186540998-186541020 CTGGGATGGAAGAGCGAGCTAGG + Intergenic
918660893 1:187087519-187087541 GTGATATGGCAGAGAGAGACTGG + Intergenic
919466499 1:197926645-197926667 CTGGCCTGGCAGAGAGAGGGCGG - Intronic
920033077 1:203048867-203048889 CTGGAATGGGAGAGGAAGGCAGG + Intronic
920073322 1:203319175-203319197 TTGGAAAGACTGAGAGAGCCTGG - Intergenic
920234589 1:204494433-204494455 CTGGAGCCGCAGAGCGAGCCCGG - Intronic
920667349 1:207972676-207972698 CTAGAGTGGGAGAGAGAGCCAGG + Intergenic
921320051 1:213930000-213930022 TTGGGAGGGCAGAGAGAGGCAGG - Intergenic
922095704 1:222441222-222441244 CTGGAATGTCAATGAGAGACTGG + Intergenic
923450249 1:234110391-234110413 CTGGAATGGCAGAGCCAGGAAGG + Intronic
924623620 1:245683258-245683280 CTGGAATCGCAGACACAGCATGG + Intronic
924931961 1:248740024-248740046 CGGTAATGGTAGAGAGACCCTGG + Intronic
1064008099 10:11714069-11714091 CTGGCATGGCAGGGAGTGACGGG + Intergenic
1067469210 10:46523821-46523843 CTGGCATGGCAGAGCCAGCCTGG + Intergenic
1067682840 10:48451188-48451210 CATGACTGGCAGAGCGAGCCTGG - Intronic
1067717948 10:48704150-48704172 CAGGAAGGGCAGAGAGGGACTGG + Intronic
1068100045 10:52541417-52541439 CAGGAAAGGCACAGAGAGCAAGG + Intergenic
1068934820 10:62625318-62625340 CTGGAAAGGCAGCGAAACCCAGG - Intronic
1069373290 10:67769092-67769114 CTGAAAGGGCAGACAGAACCAGG + Intergenic
1071529839 10:86380736-86380758 CTGCAAAGGCAGAGAGGGCAGGG - Intergenic
1071564843 10:86666482-86666504 CTGCTATGGGAGAGAGAACCAGG + Intronic
1072661254 10:97364860-97364882 TTGGAAAGGCAGAGAGAGAGGGG + Intronic
1074412424 10:113239818-113239840 TCGGAATGGCAGAGACTGCCCGG + Intergenic
1074544709 10:114393604-114393626 GTGGAATGGGAGAGTGAGTCAGG + Intronic
1075723299 10:124599474-124599496 CGGGACTGGCAGAGGGGGCCTGG - Intronic
1075921280 10:126215352-126215374 ATGGAAGGGCAGCCAGAGCCAGG - Intronic
1076265823 10:129109316-129109338 CGGGAGTGGCGGAGAGATCCAGG - Intergenic
1076692478 10:132230829-132230851 CAGGAGGGGCAGAGGGAGCCTGG - Intronic
1077180933 11:1215685-1215707 ATGGACTGGAACAGAGAGCCAGG + Intergenic
1077434383 11:2531742-2531764 CTTGGAAGGCAGAGAGACCCTGG + Intronic
1077676216 11:4195182-4195204 TTGCAATGGCAGACAAAGCCTGG - Intergenic
1077835849 11:5927986-5928008 CTGGAGTGGAAGGGAGAGTCAGG + Intronic
1078464993 11:11543595-11543617 ATGGAACGGCAGAAAGGGCCTGG + Intronic
1079184259 11:18221780-18221802 CTGCAGAGCCAGAGAGAGCCAGG - Intronic
1081198197 11:40186770-40186792 CAGAAATGTCAGAGAGAGGCAGG - Intronic
1083266053 11:61547309-61547331 CTGGAGGGGCAGAGAGAGAGGGG + Intronic
1083763902 11:64833149-64833171 CTGGGATGGGAGAAACAGCCTGG + Intronic
1083994168 11:66264023-66264045 CTGGGATGGGAGAGGGAGCCAGG - Intronic
1084201009 11:67558337-67558359 TTGGCATGGCAGAGAGAGCAGGG - Intergenic
1085279624 11:75321306-75321328 CTATTATGGCAGAGTGAGCCTGG + Intronic
1085743048 11:79093288-79093310 CTGGACTGGCAGAGGGAGCTTGG + Intronic
1085916848 11:80900461-80900483 ATGGAGTTGCAGAGAGAGCAGGG + Intergenic
1087676690 11:101170872-101170894 CTGTGATGGCAGAGAGAGGAAGG + Intergenic
1088148185 11:106710874-106710896 CCAGAGTGGCAAAGAGAGCCTGG - Intronic
1088710286 11:112501777-112501799 ATGGAATGGAAGAGAGTGCAGGG - Intergenic
1088735207 11:112723072-112723094 CAGGCAAGGCAGAGAGAGGCAGG + Intergenic
1089141280 11:116286539-116286561 CTGGTATGGTAGAAAGAGCTTGG + Intergenic
1090058697 11:123445247-123445269 CAGGAATGTCAGTGAGTGCCAGG + Intergenic
1090347465 11:126082857-126082879 AGGGAATGGCAGACAGGGCCTGG + Intergenic
1090386954 11:126362972-126362994 CTGGAGAGGCAGAGAGAGAAGGG - Intronic
1090580508 11:128153813-128153835 CTGGAATGTCAAAGAGAGGAGGG + Intergenic
1091332956 11:134744785-134744807 AGGGAATGGGAGAGAGAGACAGG + Intergenic
1091443378 12:528645-528667 CTGAAGTGGCACAGAGAGTCAGG - Intronic
1091599876 12:1911697-1911719 GTGGAAGGGCACAGGGAGCCTGG + Intronic
1091719205 12:2800369-2800391 CTGGAATGGGAGAGAGGCTCAGG - Intronic
1092057292 12:5518695-5518717 CTGGAATTGCAGACACAGCAGGG + Intronic
1092259614 12:6946051-6946073 CTGGAAAGGCAGAGGGAATCAGG - Intergenic
1092309853 12:7340735-7340757 ATGGAAGGGCAGAGAGACCCAGG + Intergenic
1094493425 12:30975423-30975445 CTGGAAGGGGAGTGAGGGCCTGG - Intronic
1094531981 12:31284779-31284801 ATGGAATAGTATAGAGAGCCTGG - Intronic
1096334576 12:50743779-50743801 TTGGAATGTCTGAGATAGCCAGG - Intronic
1096780454 12:53988815-53988837 CTGGAATGGAACAGAGAGAAGGG + Intronic
1096974970 12:55694696-55694718 CTGGAATGGGAGAGAAGGCAAGG + Intronic
1097216513 12:57418035-57418057 CTGGAGTGCTAGAGAGAGGCAGG - Intronic
1098796458 12:74894315-74894337 CTGACATGGCTGAGATAGCCTGG - Intergenic
1100183004 12:92106009-92106031 GTGGATTGGCAGAGGGAGTCTGG + Intronic
1100540663 12:95554301-95554323 CTGGAAAGGCAGAGGGAGAGAGG + Intergenic
1102531038 12:113546998-113547020 CTAGAAGGGCAGAGAGGGCTGGG - Intergenic
1102952135 12:117038088-117038110 CAGGACTGCCAGAAAGAGCCAGG + Intergenic
1103246658 12:119463916-119463938 CTGGAAAGGTAGGGAGAACCAGG - Intronic
1104913608 12:132252263-132252285 CAGGAAGGGCAGAGAGTCCCAGG + Intronic
1105858896 13:24392697-24392719 CTGGCCTGGAACAGAGAGCCTGG + Intergenic
1106373840 13:29164249-29164271 CTGGAAAGGCAGAGCGAGAAGGG - Intronic
1106389830 13:29324246-29324268 TTGTTATGGCAGAGAGAGGCAGG + Intronic
1107840005 13:44447885-44447907 CTGCAATGGGAGAGAGAGATGGG + Intronic
1108127103 13:47256368-47256390 CTGGAAGGGCAGGGATAGCGGGG + Intergenic
1109573917 13:64228304-64228326 CTGTAATGGCAGATAAAGCATGG + Intergenic
1110074628 13:71224154-71224176 GTGGCATGAGAGAGAGAGCCGGG + Intergenic
1110773829 13:79382934-79382956 CTGAAATGTCAGAGAGAACTTGG + Intronic
1111194209 13:84851239-84851261 CTGGAAAAGCAAAGAGAGGCAGG - Intergenic
1111969051 13:94891590-94891612 GTGGAAAGGCAGAAAGAGCCTGG - Intergenic
1112037487 13:95510181-95510203 CTGGAATGATAGCGAGAGTCTGG + Intronic
1114572565 14:23683572-23683594 GTAGAATGGAATAGAGAGCCTGG + Intergenic
1116380282 14:44259152-44259174 CTGGAAGGGTATAGAGAACCTGG - Intergenic
1116646221 14:47532504-47532526 CTGAAATAGAAGAGAGAGCAGGG - Intronic
1117073930 14:52081923-52081945 CTGGAAGAGGAGAGAGACCCTGG + Intergenic
1117211920 14:53509542-53509564 CTGGAATAGCAGGGAGAGACGGG - Intergenic
1117308329 14:54497942-54497964 CAGGTATGGCACAGAGAGCAGGG - Intergenic
1117498642 14:56330639-56330661 CTGGATGGGCTGAGGGAGCCTGG - Intergenic
1118773611 14:68958920-68958942 CTGGAAAGGGAGAGTGGGCCAGG + Intronic
1119251229 14:73156522-73156544 CTGGAGTGGCAAAGTGAGCGGGG + Intronic
1119549247 14:75496505-75496527 GTGGTGTGGCAGAGAGAACCAGG - Intergenic
1121564130 14:94895977-94895999 ATGGAGTTGCAGAGAGAGGCAGG + Intergenic
1121802710 14:96788171-96788193 CAGGAGTGGCAGGGGGAGCCAGG + Intergenic
1121916192 14:97838614-97838636 CAGGCAGGGCAGGGAGAGCCAGG + Intergenic
1121952262 14:98181878-98181900 CTGGATTGACAGAGGGGGCCTGG - Intergenic
1122068754 14:99191656-99191678 CTGAAATGGCAGAGGGGGCAGGG + Intronic
1122905172 14:104798256-104798278 CTGGCGGGACAGAGAGAGCCTGG - Intergenic
1123108146 14:105852511-105852533 CTGGGGTGGCAGAGAGAGCGTGG + Intergenic
1124018055 15:25894805-25894827 TTGGAATGGCAGACAGGGCAGGG + Intergenic
1125110384 15:36025607-36025629 CGGGGATGGCAGAGAGGACCAGG - Intergenic
1125687576 15:41572617-41572639 CTGGAAAGGCATAGAGACCCTGG + Intronic
1125721985 15:41849581-41849603 CAGGAAGGGCACAGGGAGCCTGG + Intronic
1127553988 15:60069297-60069319 CTTGCACGGCAGATAGAGCCAGG + Intergenic
1127663989 15:61126802-61126824 ATGGAATGGTGGAGAGAGCGTGG - Intronic
1128064558 15:64756218-64756240 CATAAATGGCAGAGAGGGCCGGG + Intronic
1128219617 15:65958947-65958969 CTGGGCTGGCAGGGAGAACCTGG + Intronic
1129054267 15:72807796-72807818 CTGGGATTGCAGACAGAGTCTGG - Intergenic
1129256968 15:74339160-74339182 CTGGAATTGCAGACAGAGGGTGG - Intronic
1130052913 15:80498632-80498654 CAGGAATGGCTGAGAGAGGCTGG + Intronic
1130843771 15:87725525-87725547 CAGGACTGGGAGAGAGAGCTGGG - Intergenic
1131215578 15:90532775-90532797 CTGGAATGGTAAAGAGAGGGAGG + Intronic
1133239496 16:4405813-4405835 CTGGGAGGGATGAGAGAGCCAGG - Intronic
1133346366 16:5073420-5073442 CTGTAATGACACAGAGAGCATGG - Intronic
1134228744 16:12412937-12412959 CAGGAAAGGGAGAGAGAGCCAGG - Intronic
1134301350 16:12994176-12994198 TTGGAAGGGCTGAGGGAGCCAGG + Intronic
1134422369 16:14106220-14106242 ATAGAATGGCAGTGAGTGCCAGG + Intronic
1134426622 16:14154839-14154861 CTGTCATGTCAGAGAGACCCAGG - Intronic
1134667735 16:16031373-16031395 CTGGGATGACAGACAAAGCCTGG - Intronic
1135644019 16:24145698-24145720 GTGCAAGGGCAGAGACAGCCAGG - Intronic
1136356057 16:29745452-29745474 CTGGAAAGGCCTGGAGAGCCAGG - Intronic
1137515396 16:49139044-49139066 CTGGAGTGGAGCAGAGAGCCAGG + Intergenic
1139475876 16:67202327-67202349 ACGGAAGGGCAGAGAGGGCCAGG + Intronic
1139884276 16:70197577-70197599 CTGCCAAGGCAGACAGAGCCTGG + Intergenic
1140368240 16:74397919-74397941 CTGCCAAGGCAGACAGAGCCTGG - Intergenic
1141046201 16:80718161-80718183 CTGGTATAGCAGAAAGAGCACGG - Intronic
1141262257 16:82464376-82464398 CTGTAATGACAGAGCGATCCAGG - Intergenic
1141500252 16:84439166-84439188 CTGGAATGGCCGCCACAGCCAGG - Exonic
1142676293 17:1515586-1515608 CTGGAATGGCAGAGGGTACAGGG + Intronic
1142875479 17:2849636-2849658 CTGGACTGGAAGAGAGACCTGGG + Intronic
1143068617 17:4270103-4270125 CGGGAGTGGAAGTGAGAGCCAGG - Exonic
1144107322 17:11997581-11997603 CTGCAACGCCAGAGAGAGGCGGG - Intergenic
1144402838 17:14922985-14923007 GTGGGATAGTAGAGAGAGCCCGG - Intergenic
1145006680 17:19342492-19342514 GTGGCAGGGCAGAGAGGGCCTGG + Intronic
1145242699 17:21249014-21249036 CAGGAGGGGCAGAGAGAGCATGG - Intronic
1145346277 17:22043621-22043643 CTGAAAGGCCAGTGAGAGCCTGG - Intergenic
1145989419 17:29069929-29069951 CTGGACTGGCAGAGCGGGCTAGG + Intergenic
1148027836 17:44600636-44600658 CTTGGATGGCAGACAGACCCGGG + Intergenic
1149610107 17:57953769-57953791 CTTGAATAGAAGAGAGACCCTGG - Intronic
1150548510 17:66187751-66187773 CTGGAGTTGCAAAGAGAGGCTGG - Intronic
1151473630 17:74332830-74332852 ATGGCAGGGCTGAGAGAGCCTGG - Intronic
1152084835 17:78211645-78211667 CAGGAATGGCTGAGAAAGACGGG - Intergenic
1152256535 17:79243276-79243298 CTGGAGTGTCAGAGTGAGCAGGG + Intronic
1152310885 17:79549119-79549141 CTGGAAGGGCAGACAAAGCCTGG - Intergenic
1152473379 17:80502783-80502805 CTGGAAGGGCAGAGCGTGCTGGG + Intergenic
1152624430 17:81381787-81381809 CAGGGGTGGCCGAGAGAGCCGGG + Intergenic
1152717563 17:81907258-81907280 CTACAATGGGAGAGAGGGCCAGG + Intronic
1153650796 18:7238084-7238106 CTCCAGTGGCAGAGAGAGCCAGG - Intergenic
1154198302 18:12281866-12281888 TTGGAGTGGCAGGGAGAACCTGG - Intergenic
1156040147 18:32811269-32811291 ATGGAATTGCAGAAAGAGCAGGG - Intergenic
1156483932 18:37452986-37453008 CTGGAATGGCTGGCAAAGCCAGG - Intronic
1158124738 18:54088577-54088599 CTGGAATGGCTGGGACAGCCTGG + Intergenic
1158381947 18:56941467-56941489 CTTGAATTGCAGAGGGAACCAGG + Intronic
1158557922 18:58490496-58490518 CAAGAAAGGCAGAGAGTGCCAGG - Intronic
1159990299 18:74899314-74899336 ATGGAAGGGCAGAGAGTGGCAGG + Intronic
1161721848 19:5907188-5907210 CTCACAGGGCAGAGAGAGCCAGG + Intronic
1161869804 19:6861554-6861576 CTGGGGTTGCAGAGAGAGCTAGG - Intergenic
1162318975 19:9959794-9959816 CTGGCATGGCAAGGTGAGCCTGG + Exonic
1162913095 19:13860542-13860564 CTGGAATTACAGATGGAGCCCGG - Intergenic
1163813313 19:19448118-19448140 CTGGGAGGGGACAGAGAGCCAGG + Intronic
1164544716 19:29150659-29150681 ATAGAATGGCATAGAGAGACAGG - Intergenic
1164742275 19:30584584-30584606 ATGGATTGGCAGAGAGAAGCTGG - Intronic
1165188250 19:34040222-34040244 CTGGGCTGTCAGAGATAGCCAGG - Intergenic
1165313230 19:35040773-35040795 ATGGAAAGGCAGAGGAAGCCAGG + Intronic
1166142962 19:40815195-40815217 CAGGGATGGCAAAGAGATCCTGG - Intronic
1166184597 19:41131626-41131648 CAGGGATGGCAGAGAAATCCTGG + Intergenic
1166503358 19:43356549-43356571 CTGCCATGGAAGAGAGTGCCAGG + Intronic
1166507096 19:43378212-43378234 CTGCCATGGAAGAGAGTGCCAGG - Intergenic
1166868134 19:45853543-45853565 CAGGAGTTGCAGTGAGAGCCAGG + Intronic
1167103210 19:47416703-47416725 CTGGGAGGGAAGAGAGAGGCCGG + Intronic
1167112101 19:47468612-47468634 CTGAAAGGGCAGAGAGAGCAAGG - Intronic
1167603331 19:50467033-50467055 CTGGAATGGCAGGGGAAGCCAGG + Intronic
925668827 2:6290371-6290393 CTGGCATGGCAGGCAGAGGCTGG - Intergenic
925733628 2:6941927-6941949 CTGCAATGGCAGGCACAGCCAGG - Intronic
925736539 2:6968884-6968906 CTGCAGTGGCAGTGAGAGGCTGG + Intronic
925764299 2:7215767-7215789 CTGTCATTGCAGAGAGGGCCTGG + Intergenic
925853991 2:8111777-8111799 CTCACATGGCAGAGAGAGACAGG + Intergenic
926226149 2:10968271-10968293 CGGCAATGCCAGACAGAGCCAGG + Intergenic
926247498 2:11131948-11131970 CTTGGATGCAAGAGAGAGCCTGG - Intergenic
926391384 2:12397067-12397089 CTGAAATGAAAGAGAGAGACAGG + Intergenic
926891270 2:17640985-17641007 CAGCAATGGCAGCCAGAGCCAGG - Intronic
926916977 2:17901570-17901592 CTGGAATGCAAGAGGGAGACTGG + Intronic
927493777 2:23538505-23538527 CCTGTATGGCAGAGAGAGGCTGG - Intronic
927784720 2:25965766-25965788 CTGGAATGGCTGAGAGCTTCAGG - Intronic
927962902 2:27251634-27251656 CTGGAGTGGGAATGAGAGCCTGG + Intergenic
929802286 2:45114404-45114426 CTGGAATGGAAGAGGAAGGCGGG + Intergenic
930332438 2:50002695-50002717 CGGGAATGGCGGACAGAGCAGGG - Intronic
931082096 2:58785172-58785194 CTGAAATGAGAGAGAGAGACAGG + Intergenic
932038751 2:68276217-68276239 CTGAAGTGGCAGAGAGAGAATGG + Intergenic
932299535 2:70656427-70656449 CTGGAATGGAAGAGGGTGTCAGG - Intronic
932557104 2:72834138-72834160 CTGGAATAGCTCAGGGAGCCAGG - Intergenic
932884927 2:75541082-75541104 CTGGAAGTGCAGAGAGGGCCAGG + Intronic
933005024 2:76981401-76981423 CTGCCATGGCAGAGACAGCTGGG + Intronic
933515931 2:83301774-83301796 CTGGAAGGGGAGAGAGAGTAGGG - Intergenic
933805794 2:85997398-85997420 ATGGAATGGCAGAGAGATGCGGG - Intergenic
933941588 2:87249510-87249532 AATGAAGGGCAGAGAGAGCCAGG + Intergenic
935109152 2:100075970-100075992 CTGGAATGGCAGAGAGACACTGG - Intronic
935627707 2:105185062-105185084 ATAGAAGGACAGAGAGAGCCTGG + Intergenic
936080375 2:109428901-109428923 CTGGCATGGCAGGGAGAACCGGG - Intronic
936338636 2:111612081-111612103 AATGAAGGGCAGAGAGAGCCAGG - Intergenic
936385361 2:112023925-112023947 CTCACATGGGAGAGAGAGCCTGG + Intronic
936892211 2:117384853-117384875 ATGGAATGGAATAGAGAACCCGG - Intergenic
936971554 2:118181305-118181327 ATGGCATGGCAGAGAGAGCTTGG - Intergenic
937917422 2:127106039-127106061 CTGGAATGGGGGATGGAGCCGGG - Intronic
938366811 2:130741047-130741069 CGGGCATGCCACAGAGAGCCTGG - Intergenic
939495637 2:142924710-142924732 CTGGAAAGGAAAAGAGAGCATGG - Intronic
941830956 2:169959077-169959099 CTGGAATGGAAGAAATAGTCAGG - Intronic
941963497 2:171276950-171276972 CTGGAATGGTAGTCAGAGGCGGG + Intergenic
942452636 2:176117752-176117774 CAGGACTGGCGGAGAGGGCCAGG - Intronic
944073217 2:195696114-195696136 ATGGAATAGAAGAGAGAGCCTGG - Intronic
945120411 2:206451666-206451688 AGTAAATGGCAGAGAGAGCCAGG + Intronic
947060785 2:226162753-226162775 CTGGGATGGCAGTGATGGCCAGG - Intergenic
947106528 2:226673575-226673597 GTGGAATGGCAGAGAGATGGTGG + Intergenic
948011857 2:234655261-234655283 CTGCACTGGGAGAGAGAGCCCGG + Intergenic
948251471 2:236533477-236533499 ATGGAAGAGCAGAGACAGCCTGG + Intergenic
1168793482 20:595899-595921 CTGCAAGGGCAGAGAGAGGCAGG + Intergenic
1171340008 20:24420245-24420267 CAGGAGTGGCAGAGAGGGCCAGG + Intergenic
1172125396 20:32622537-32622559 CTGGCAGTGCAGACAGAGCCTGG + Intergenic
1172769915 20:37375913-37375935 CTCACATGGCAGAGAGAGACAGG + Intronic
1172951031 20:38723775-38723797 CTGGACGGGCGGAGAGAACCCGG + Intergenic
1174634214 20:51985158-51985180 CTGGATTGTCAGAAACAGCCAGG - Intergenic
1175253530 20:57624189-57624211 TTGAAATGGCAGAGATAGCTAGG - Intergenic
1175682272 20:60998072-60998094 CTGCAATGGCAGAAAGAGTGTGG - Intergenic
1176056528 20:63151834-63151856 CTGGAGAGCCAGAGGGAGCCGGG + Intergenic
1176668682 21:9711790-9711812 CTGGAATGGCTCACAGAACCAGG + Intergenic
1178426511 21:32483152-32483174 TAGGAATGGCAGGGAGGGCCGGG - Intronic
1178910501 21:36669609-36669631 CAGGAATGCCAGGGAGTGCCAGG - Intergenic
1179461476 21:41538336-41538358 CTGGAGTTGCAGAGAGGCCCGGG + Intergenic
1179509818 21:41865098-41865120 CAGGCATGGCAGAGAGGGCTGGG - Intronic
1179509841 21:41865187-41865209 CAGGCATGGCAGAGAGGGCTGGG - Intronic
1179593852 21:42429197-42429219 CTAGAATGTCAGAGGGAGCATGG + Intronic
1179615516 21:42580703-42580725 CTGGAATGCCTGAGAGGGTCGGG - Exonic
1180151441 21:45950307-45950329 TGGGAATGGCAGCGAGTGCCCGG + Intergenic
1180593163 22:16957557-16957579 ATGGAATGGAAGAGAGAGGAAGG + Intergenic
1181533888 22:23532016-23532038 CTGGAAATGCACAGAGAGCAGGG + Intergenic
1181534076 22:23532875-23532897 TTGGAGGGGCAGAGACAGCCTGG + Intergenic
1181822002 22:25483686-25483708 CTGCATTGGTAGAGAGAGACTGG + Intergenic
1181872323 22:25909841-25909863 CTGGGGTGGCAGAAAGAGCTGGG + Intronic
1182103560 22:27673580-27673602 CTGGAGTGACAGAGCGAGACTGG - Intergenic
1182401851 22:30084287-30084309 CTGGTAAGACAGAGAGAGCAAGG + Intronic
1182423849 22:30261714-30261736 CTGAAATGGCAAATAGAGCTGGG - Intergenic
1183686393 22:39363548-39363570 CTGGGGAGGCTGAGAGAGCCTGG + Intronic
1183850961 22:40587597-40587619 CTGGTAAGGCAGAGGCAGCCAGG + Intronic
1184001160 22:41674640-41674662 GTTGAAAGGCAGAAAGAGCCAGG - Exonic
1184768624 22:46585702-46585724 GTGGAAAGGTAAAGAGAGCCTGG + Intronic
1185295177 22:50049608-50049630 GTGGAATGGTGGAGACAGCCCGG + Intronic
1185405353 22:50645067-50645089 CAGGAGTGGGAGAGAGAGCTTGG - Intergenic
949509655 3:4757148-4757170 CTGGGTAGGCAGAGAGTGCCTGG - Intronic
951694192 3:25428503-25428525 CTGGATTGGCCGAGCAAGCCTGG + Exonic
952216943 3:31287475-31287497 GTGGTATGGCAGGGAGAGCAAGG + Intergenic
953043262 3:39273499-39273521 CATGAATGGCTGAGAGACCCTGG + Intronic
953229607 3:41052937-41052959 GAGGAAATGCAGAGAGAGCCTGG + Intergenic
953455353 3:43036304-43036326 TTGGCAAGGCAGAGAGAGGCAGG + Intronic
954952832 3:54490352-54490374 CTGGTATGGCCCGGAGAGCCAGG - Intronic
955317597 3:57951799-57951821 CTGGAGGGGCAGAGGCAGCCTGG - Intergenic
955685612 3:61545622-61545644 CTGGAATTGCAGAGAGAGCTGGG - Intergenic
956118904 3:65946154-65946176 CAGGAATGGCAGGAAGTGCCAGG - Intronic
960049778 3:113228563-113228585 CTGGAATGGCACATGGGGCCTGG - Intronic
961311630 3:126005683-126005705 GTGGCCTGGCAGAGAAAGCCAGG - Intergenic
961822864 3:129584234-129584256 CTGGAATGGATGGGGGAGCCAGG + Intronic
964096906 3:152942474-152942496 CTGGAAAGGCAGACAGGGCCAGG - Intergenic
964385857 3:156147076-156147098 CAGGAAGGGAACAGAGAGCCTGG + Intronic
964431391 3:156610315-156610337 CAGGAAAGGCAGAAAGAGTCTGG + Intergenic
965157475 3:165082660-165082682 CTGGAAATGCAGAGAGAGCCAGG + Intergenic
966134680 3:176684748-176684770 ATTGCATGCCAGAGAGAGCCTGG + Intergenic
966346754 3:178989379-178989401 CAGGAAAGACAGAGAGAGCAGGG + Intergenic
966649941 3:182289116-182289138 CTAGAAGGGCAGAAAGAGACAGG - Intergenic
966904763 3:184514026-184514048 CTGGAAGGGCGGAGAGAGTGAGG + Intronic
967616259 3:191571158-191571180 TTAGAATGGCAGAGATAACCAGG - Intergenic
969291151 4:6240812-6240834 CTGGAGAGGAAGAGAGATCCTGG + Intergenic
969446379 4:7246997-7247019 CTGTAAAGGCACAGAGGGCCAGG - Intronic
969446747 4:7249248-7249270 CTGGAATGGCTGGAAGAGCTTGG + Intronic
969966033 4:10996472-10996494 CTGGTACTGCAGAGAGAGCTGGG + Intergenic
970968912 4:21958928-21958950 CTGGAGTTCCAGAGAGAGACTGG + Intergenic
972290568 4:37686548-37686570 CGGGAATGGCAGGGAGAGGCGGG - Intergenic
972307803 4:37849330-37849352 CTGCATTTGCACAGAGAGCCAGG - Intronic
972873317 4:43327548-43327570 GAGGAAAGGCAGAGAGAGCAAGG - Intergenic
973878433 4:55244041-55244063 CTGGAATGAAAGAGTGAGCTGGG + Intergenic
974223010 4:59001398-59001420 AGGGAATGCCAGTGAGAGCCTGG - Intergenic
976933793 4:90603246-90603268 CTGGACGTGCAGACAGAGCCAGG + Intronic
977557084 4:98497360-98497382 CTGGCATGGCAGAGTGAGAGAGG - Intronic
980143851 4:128955927-128955949 CTGTAATGGCAGGGAAAGGCTGG + Intronic
982238633 4:153276139-153276161 CTGGGATGGCAGATACTGCCCGG + Intronic
982441977 4:155447198-155447220 CTTGAATGCCAGACAGAGCAGGG + Intergenic
983412461 4:167418068-167418090 CTGTAATGGCAGCCTGAGCCAGG - Intergenic
985259012 4:188097681-188097703 CTGGGAGGGCAGTGGGAGCCAGG + Intronic
985406100 4:189639735-189639757 CTGGAATGGCTCACAGAACCAGG - Intergenic
985425759 4:189828653-189828675 ATGGCAGGGCAGAGGGAGCCTGG - Intergenic
985629178 5:1005861-1005883 CTGGAATGGCTGAGGGGACCAGG + Intergenic
986094860 5:4544513-4544535 CTGGAATGCCGGGTAGAGCCCGG + Intergenic
986332599 5:6728387-6728409 CTGGCATGATGGAGAGAGCCTGG + Intronic
988801538 5:34700474-34700496 CTGGAACTGCAGGGAGAGCAAGG - Intronic
989158148 5:38364478-38364500 CTGGAATTGCTTAGAAAGCCTGG + Intronic
989507658 5:42246098-42246120 CTTGAATCGCAGAGAAAGGCAGG - Intergenic
990393746 5:55355219-55355241 CTGGCATAGTATAGAGAGCCTGG - Intronic
990493675 5:56325964-56325986 ATGGATTGGCGGATAGAGCCAGG + Intergenic
990696487 5:58423611-58423633 CTAGAATGAGAGATAGAGCCTGG + Intergenic
991037006 5:62137433-62137455 CTGGCTCCGCAGAGAGAGCCAGG - Intergenic
993086941 5:83374848-83374870 CTGGAGGGGAAGGGAGAGCCAGG - Intergenic
994761052 5:103854487-103854509 CTGTAGTGGAAGAGAGATCCTGG + Intergenic
997437005 5:133882801-133882823 CAGGAAGGGCAGAGAAAGGCCGG + Intergenic
997609913 5:135208712-135208734 CGGGAAGGGCAGGGTGAGCCAGG - Intronic
997841490 5:137244799-137244821 CTGGCATGGCAGAGAGCATCGGG - Intronic
998167743 5:139854141-139854163 CTGGGTGGGCAGAGAGAGACAGG - Intronic
1000642193 5:163716119-163716141 CTTGAATGGCGGAGAGAGGGAGG + Intergenic
1001478358 5:172067056-172067078 CTGAAATGTCAGGGATAGCCAGG + Intronic
1002716959 5:181233957-181233979 GTGGAGTGGCAGGAAGAGCCAGG + Intronic
1002860282 6:1074017-1074039 CTTGAATGACAGAAAGAGCATGG - Intergenic
1002994291 6:2268472-2268494 CTGGCATGGGACACAGAGCCAGG + Intergenic
1003224122 6:4189389-4189411 CTGGAAGGACAGAGAGAAACGGG + Intergenic
1003666979 6:8120635-8120657 CTGTAGTGGCAAACAGAGCCAGG + Intergenic
1004766064 6:18728406-18728428 CTGAAATGGCACAGAGTGGCAGG + Intergenic
1005355567 6:24980131-24980153 ATGGAATGGCAGAGAAAACTTGG - Intronic
1005381074 6:25234862-25234884 GTGGCATGGAAGAGAGAGTCTGG - Intergenic
1005693817 6:28333132-28333154 CTGGAATGAAACAGTGAGCCTGG - Intronic
1006453436 6:34118646-34118668 CTGCAATGGGACAGAGGGCCTGG - Intronic
1006611965 6:35299445-35299467 TGTGAAGGGCAGAGAGAGCCTGG - Intronic
1007047884 6:38796196-38796218 CTGGAAGGGCTGGGAAAGCCAGG - Intronic
1007782311 6:44261673-44261695 CTGGAAGGGCGGCCAGAGCCAGG - Exonic
1010138963 6:72590517-72590539 TTGGAATGGTAGGGAGGGCCAGG - Intergenic
1012058480 6:94446395-94446417 CTGGCATGGCAGATAGAGTGAGG - Intergenic
1014137213 6:117904284-117904306 CTTGAATGGGAGAGAAAGCCAGG - Intergenic
1015507381 6:134003255-134003277 CTAGAAAAGCAGAGAGAGACAGG - Intronic
1015571590 6:134626663-134626685 CTTGAATGCCAGAGAGAGCCAGG - Intergenic
1015763747 6:136693239-136693261 CTGGAATACAAGAGACAGCCTGG - Intronic
1016082436 6:139872250-139872272 AAGGAAAGGCAGAGAGAACCAGG - Intergenic
1016264565 6:142215868-142215890 CTACAGTGGCAAAGAGAGCCTGG - Intronic
1016451839 6:144190867-144190889 CTGGTGTGGCAGTCAGAGCCAGG - Intergenic
1016835926 6:148476877-148476899 ATGGAATAGAATAGAGAGCCCGG + Intronic
1017858997 6:158378023-158378045 CTGGAATGTCAGAGGCAGCTAGG + Intronic
1018338070 6:162817161-162817183 CTGGAATGACCGTGAGAGGCTGG - Intronic
1019540268 7:1548142-1548164 CTGGAGTGGCAGGGCGGGCCCGG - Intronic
1020363610 7:7356347-7356369 CTGGCATGGAATAGAGAGCTGGG + Intronic
1020957641 7:14761785-14761807 CTGTAATGGGAGAAAGAACCTGG + Intronic
1021579808 7:22140799-22140821 TTGGAATGGCAGGGGGAGCTCGG + Intronic
1021960575 7:25868937-25868959 CAGGGATGGCAGAGAGAAGCAGG + Intergenic
1022274867 7:28845434-28845456 CAGAAGTGGCAGAGAGAACCTGG - Intergenic
1022789018 7:33668292-33668314 CTGGAATGTCAGAGAATTCCCGG + Intergenic
1022883486 7:34616865-34616887 ATGGAATAGAAGATAGAGCCCGG + Intergenic
1023230242 7:38020236-38020258 CTGGGAAACCAGAGAGAGCCCGG - Intronic
1023465790 7:40453105-40453127 CTGTAATGTCAGAGAGAGTGTGG + Intronic
1023491839 7:40751285-40751307 CTGGAGAGGTAGGGAGAGCCTGG + Intronic
1024063778 7:45716813-45716835 TTGGAATGGCTGAGGGAGGCAGG + Exonic
1026330635 7:69349542-69349564 CTGGAAAGTCCTAGAGAGCCTGG + Intergenic
1027278347 7:76586054-76586076 CTGGAATTGCAGGGAGATCAAGG - Intergenic
1030051161 7:105538844-105538866 CTGAGGTGGCAGAGAGAACCTGG - Intronic
1030067779 7:105673647-105673669 CTGGAGTTGGAGAGAGAGGCAGG + Intronic
1032432368 7:131872346-131872368 CTTGACTGGCAGAGAGGGGCTGG + Intergenic
1032743373 7:134762248-134762270 CTGGAGTGGCAAGGAGAGCTGGG - Intronic
1034413578 7:150953790-150953812 CAGGGATGGCAGGGAGAGCTTGG - Intronic
1035791639 8:2311666-2311688 CTTGAATGCCTGGGAGAGCCCGG - Intergenic
1035801166 8:2410039-2410061 CTTGAATGCCTGGGAGAGCCCGG + Intergenic
1036473457 8:9071767-9071789 ATAGAATGACAGAGAGAGACTGG + Intronic
1037477334 8:19270496-19270518 GTGGATGAGCAGAGAGAGCCAGG + Intergenic
1037528200 8:19748523-19748545 CTGTTATGGCAGAGAGGGACGGG - Intronic
1037745976 8:21644407-21644429 CTGGGAAGGCAGAGAGAGGCTGG - Intergenic
1037878131 8:22558920-22558942 CTGGACGGGCAAGGAGAGCCTGG + Intronic
1037914443 8:22764333-22764355 CTGGACTTGAAGAGAGACCCTGG - Intronic
1038259869 8:25983602-25983624 CTGGAATGACAGGAAAAGCCAGG + Intronic
1038567823 8:28634548-28634570 CAGGATGGGCAGAAAGAGCCAGG - Intronic
1038711772 8:29953482-29953504 CTGCAATGGCAGAGAAGCCCAGG + Intergenic
1039619364 8:38982402-38982424 CTGTGATGGCAAAGAGATCCTGG + Intronic
1041333820 8:56757587-56757609 TTGGCAAGCCAGAGAGAGCCTGG + Intergenic
1042593769 8:70423874-70423896 CTGGATTGGCGGAGAGTGTCGGG - Intergenic
1043802954 8:84634410-84634432 TAGGAATGGCAGAGAGGGACAGG - Intronic
1045062897 8:98424255-98424277 CTTGAATGGCAGAGTGAACTTGG - Intronic
1045548346 8:103148305-103148327 CTGGAAGCTCAGAGAGAGGCAGG + Intronic
1046660316 8:116941412-116941434 CTGGCATGGGAAAGAGGGCCAGG + Intronic
1048035773 8:130675979-130676001 CAGGAATGGTAGAAAGAGCATGG - Intergenic
1049358845 8:142202299-142202321 ATGGGAGGGCAGGGAGAGCCGGG - Intergenic
1049558147 8:143293863-143293885 CTGCAAGGGCAGAGAGAGGTGGG + Intronic
1052069708 9:24067251-24067273 GTGCAAGGGCAGAAAGAGCCAGG + Intergenic
1052622424 9:30930625-30930647 CTGGAGTCTCACAGAGAGCCTGG + Intergenic
1053286027 9:36850069-36850091 CTTTGATGGCAGAGAGAGGCGGG + Intronic
1055490269 9:76797764-76797786 CTGGAATGGTAGAGAGGGGAAGG + Intronic
1056186275 9:84138064-84138086 CTGAAATGGCAGAGCAAGTCAGG - Intergenic
1056771495 9:89481050-89481072 CTGGGATGGCAGTGAGAGGTTGG - Intronic
1058425967 9:104875499-104875521 CAGGACTGGCAGAGAGATCCGGG - Intronic
1058508761 9:105693924-105693946 CTCGAATGGCAGACAAAGCCAGG - Intergenic
1058636714 9:107045040-107045062 CTAGAGGGGCAGAGAGAGCCAGG + Intergenic
1058703758 9:107622115-107622137 CTGGAAGGACAGAGAAGGCCCGG - Intergenic
1059258777 9:112955933-112955955 CTGGAGTCTCAGAGAGAGGCTGG - Intergenic
1060590064 9:124810922-124810944 CTAGGATGGCAGGCAGAGCCAGG - Exonic
1060785521 9:126449172-126449194 CTGGACTGGCAGAGAGCCCCGGG + Intronic
1061037589 9:128122233-128122255 CCGTGATGGCAGAGAGAGGCAGG + Intronic
1061246594 9:129403918-129403940 CTGGAAATGCACAGAGAGCAGGG - Intergenic
1061936507 9:133860638-133860660 CTGGAATGGCAGAGAGAGCCTGG - Intronic
1062183253 9:135202480-135202502 CTGGCATGGCTCAGAGGGCCTGG + Intergenic
1062200472 9:135300227-135300249 CTGGGTGGGGAGAGAGAGCCTGG - Intergenic
1203657185 Un_KI270753v1:9151-9173 CTGGAATGGCTCACAGAACCAGG - Intergenic
1186407697 X:9318143-9318165 CTGGAATGGAATAGAGTGCCAGG - Intergenic
1187419777 X:19123618-19123640 CTAAAATGGCAGAGTCAGCCAGG - Intergenic
1189989690 X:46582483-46582505 CTGTAGGGTCAGAGAGAGCCAGG - Intronic
1191807263 X:65148317-65148339 CTGTAATTGCAGAGCTAGCCTGG + Intergenic
1192139984 X:68638906-68638928 CTGGCAGGGCTGAGAGAGCAGGG - Intergenic
1192181760 X:68920602-68920624 CTGGAGTGGGATACAGAGCCCGG - Intergenic
1192212006 X:69133640-69133662 CAGGAGGGGCTGAGAGAGCCAGG - Intergenic
1197316101 X:124967736-124967758 ATGGAAAGGAAGAGAGAGACTGG - Intergenic