ID: 1061936986

View in Genome Browser
Species Human (GRCh38)
Location 9:133863413-133863435
Sequence CGGGTCGTACAGATGGAACC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061936977_1061936986 4 Left 1061936977 9:133863386-133863408 CCTGGAGTCAGCGCAAAGGCCCC 0: 1
1: 0
2: 1
3: 12
4: 114
Right 1061936986 9:133863413-133863435 CGGGTCGTACAGATGGAACCGGG No data
1061936975_1061936986 16 Left 1061936975 9:133863374-133863396 CCTGTTTGTCAACCTGGAGTCAG 0: 1
1: 0
2: 0
3: 9
4: 122
Right 1061936986 9:133863413-133863435 CGGGTCGTACAGATGGAACCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061936986 Original CRISPR CGGGTCGTACAGATGGAACC GGG Intronic
No off target data available for this crispr