ID: 1061937496

View in Genome Browser
Species Human (GRCh38)
Location 9:133866239-133866261
Sequence TACTAGGCTTAGAACTAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 108}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061937496_1061937499 14 Left 1061937496 9:133866239-133866261 CCTTTCTAGTTCTAAGCCTAGTA 0: 1
1: 0
2: 0
3: 8
4: 108
Right 1061937499 9:133866276-133866298 TGCATTATTTCATTTAAAGAGGG No data
1061937496_1061937501 29 Left 1061937496 9:133866239-133866261 CCTTTCTAGTTCTAAGCCTAGTA 0: 1
1: 0
2: 0
3: 8
4: 108
Right 1061937501 9:133866291-133866313 AAAGAGGGATTCTACGTGTTGGG No data
1061937496_1061937502 30 Left 1061937496 9:133866239-133866261 CCTTTCTAGTTCTAAGCCTAGTA 0: 1
1: 0
2: 0
3: 8
4: 108
Right 1061937502 9:133866292-133866314 AAGAGGGATTCTACGTGTTGGGG No data
1061937496_1061937500 28 Left 1061937496 9:133866239-133866261 CCTTTCTAGTTCTAAGCCTAGTA 0: 1
1: 0
2: 0
3: 8
4: 108
Right 1061937500 9:133866290-133866312 TAAAGAGGGATTCTACGTGTTGG No data
1061937496_1061937498 13 Left 1061937496 9:133866239-133866261 CCTTTCTAGTTCTAAGCCTAGTA 0: 1
1: 0
2: 0
3: 8
4: 108
Right 1061937498 9:133866275-133866297 TTGCATTATTTCATTTAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061937496 Original CRISPR TACTAGGCTTAGAACTAGAA AGG (reversed) Intronic
907364742 1:53948817-53948839 TTCAAGGCTAAGAACCAGAAAGG - Intronic
909773592 1:79457205-79457227 TACTAGGCTTTGAACTTGTATGG + Intergenic
912079835 1:105921373-105921395 GACTAGAGTTAGAACAAGAAAGG + Intergenic
917505991 1:175627618-175627640 CACCAGGCTTAGAACTTGATAGG + Intronic
920576876 1:207067734-207067756 TTCTAGGCTTAGAGTTAGAAGGG + Intronic
1063847192 10:10143540-10143562 GAATAGGCATAGAACTATAAAGG - Intergenic
1066788332 10:39031586-39031608 TTCCAGGCTGAAAACTAGAAGGG - Intergenic
1072217579 10:93300602-93300624 TTCTAGTCTTAAAACGAGAAAGG + Intergenic
1078625026 11:12947531-12947553 GAATAGGCTTAGATCTTGAAAGG + Intergenic
1080923955 11:36737019-36737041 CACAAGGCTTAGAACCAAAAAGG - Intergenic
1081063846 11:38514418-38514440 CAATAGGCTTATAACTAGTAAGG - Intergenic
1082587594 11:54961367-54961389 TCCCAGGATTAAAACTAGAAAGG + Intergenic
1093029764 12:14277455-14277477 TACTAGGCTTAGAAGTTGAGTGG - Intergenic
1096968036 12:55644117-55644139 TAATAGGCCTACAAATAGAAGGG + Intergenic
1100435629 12:94569043-94569065 TGCTAGGCTGAGCACTGGAATGG + Exonic
1105916177 13:24918795-24918817 GACTAGGCTTAGGAAGAGAAAGG + Intronic
1106982902 13:35311407-35311429 TAATAGGCTTAGAAAAGGAAGGG + Intronic
1110723339 13:78790568-78790590 TACTAGACTTAGATTTAGGAGGG + Intergenic
1111741315 13:92208549-92208571 TATTAGGCTTAAAAATAAAAAGG + Intronic
1113912443 13:113849432-113849454 TTCTAGGCTTGGAAGGAGAAGGG + Intronic
1115411284 14:33078327-33078349 TTCTGGGCTTAGAAATAAAATGG + Intronic
1116068876 14:40017750-40017772 GAGTAGGGTTAGACCTAGAAGGG + Intergenic
1119984051 14:79115658-79115680 TACTAGGCTGAGATCTAGGCAGG - Intronic
1121635192 14:95449488-95449510 GACCTGGCTTAGAACTACAAAGG + Intronic
1121999942 14:98639045-98639067 TACTAGGTATAGGACTACAAGGG - Intergenic
1126503318 15:49372983-49373005 TATTAGATTTAGAATTAGAATGG + Intronic
1127364099 15:58270890-58270912 AACCAGGCTTAGAACTAAATGGG + Intronic
1127411930 15:58717773-58717795 TAATCGTGTTAGAACTAGAAGGG - Intronic
1131784904 15:95901973-95901995 TACAAGGCTCAGAAGAAGAAGGG - Intergenic
1132471350 16:105306-105328 TCCTAACCTTAGAACTAGACAGG + Intronic
1140227080 16:73087192-73087214 TACTAGTCCTAAAACTAGACAGG + Intergenic
1140914419 16:79481793-79481815 TACTAGCCCTGGCACTAGAATGG + Intergenic
1144833829 17:18146256-18146278 TACTGGGCTCAGAGCAAGAAAGG + Intronic
1149948044 17:60952710-60952732 TACTAGGCCTAGTACCTGAATGG - Intronic
1155610112 18:27657943-27657965 TACTAGAATTAAAACTATAAAGG - Intergenic
1156814984 18:41298929-41298951 TTCTAGACATAGAAATAGAAGGG - Intergenic
1158377501 18:56887574-56887596 AAATAGGCTAAGAACAAGAAAGG - Intronic
1165495268 19:36149028-36149050 TGTTAGGCTTAGAACTGGAGAGG + Intronic
925817967 2:7771787-7771809 TAGCAGGCTTGGAACAAGAACGG + Intergenic
926051352 2:9746852-9746874 GACTAGGCCTAGGACTAAAATGG - Intergenic
927577782 2:24214101-24214123 TACTATGCTTAGAACAAGACAGG - Intronic
928906213 2:36370826-36370848 TACTAAGATTAGAAGTAGAGGGG - Intronic
930368330 2:50471780-50471802 TACTAGGCTTAATACTTGAGTGG + Intronic
932018472 2:68057986-68058008 CAGTAGGCCTAGAGCTAGAATGG - Intronic
934603111 2:95673516-95673538 TATTAGGCTCACAAATAGAATGG + Intergenic
935966399 2:108480801-108480823 TACTAGGCTTAATACTTGGATGG + Intronic
938377624 2:130819174-130819196 GAACAGGCTTAGAACTAGAGTGG - Intergenic
938868595 2:135450905-135450927 TACTAGGCTAAAGACTTGAAGGG - Intronic
939353236 2:141068278-141068300 TACTAGGCAAAGAAAGAGAAAGG + Intronic
939786576 2:146520931-146520953 TAATAGGCTTAATACTAGGATGG - Intergenic
945129585 2:206555309-206555331 TCCTAGGTTTTGAACTTGAATGG - Intronic
945454353 2:210032988-210033010 CACTAGGCTAAGAAACAGAATGG + Intronic
945589234 2:211708982-211709004 TACATGGATTAGAAGTAGAAAGG - Intronic
945799961 2:214416338-214416360 TAGTAGGGTTATAACGAGAAGGG - Intronic
947266793 2:228291466-228291488 TACAAAAATTAGAACTAGAATGG + Intergenic
1169793827 20:9440556-9440578 TCCTAGACTTAGAACTGGCATGG + Intronic
1173058034 20:39635455-39635477 TCCAAGGCTTACAACTAGTAAGG + Intergenic
1183725223 22:39585039-39585061 TAAAAAGCATAGAACTAGAAAGG - Intronic
949165286 3:933414-933436 TGGGAGGCTTAGAAATAGAAAGG - Intergenic
949330237 3:2914603-2914625 GAATAGACTTAGAACTAGCAAGG + Intronic
949786916 3:7751982-7752004 TACTAGGCTTAATACTTGGATGG + Intergenic
951241834 3:20295222-20295244 CACCAGGCTTAGGACTAGCAAGG + Intergenic
952005598 3:28838942-28838964 TACTATTTTTAGACCTAGAAAGG - Intergenic
955761536 3:62289429-62289451 AACAAGGCTTAGCACCAGAATGG + Intronic
957548660 3:81674919-81674941 AACTACACATAGAACTAGAAAGG + Intronic
962361151 3:134743818-134743840 TACTAGGGTTGGAACTTTAATGG - Intronic
966234408 3:177685204-177685226 TCCTAGGCTTGAAACTAGAATGG - Intergenic
970701659 4:18748399-18748421 TTCTAGGTTTTGAACTAGAGAGG + Intergenic
972210639 4:36832285-36832307 TGCTAGGGTTAGCACTAAAATGG + Intergenic
974572590 4:63673031-63673053 TACTATGTTTAGAACTTGACTGG - Intergenic
980662790 4:135886176-135886198 TCTTAGGCTTAGAGCAAGAAGGG - Intergenic
981655489 4:147107928-147107950 TACTAGGCTTAACACTGGGATGG + Intergenic
982621872 4:157717946-157717968 TACTGGGGTTACAACTTGAAAGG + Intergenic
983238037 4:165202053-165202075 TACCAGATTAAGAACTAGAAAGG + Intronic
983333242 4:166358859-166358881 TGCTAGGTAGAGAACTAGAAAGG - Intergenic
986921388 5:12687843-12687865 TATTAGGCTAATAACTATAAAGG - Intergenic
989236710 5:39156341-39156363 TACCGGACTTGGAACTAGAAGGG + Intronic
989465807 5:41753871-41753893 TACCTATCTTAGAACTAGAAAGG - Intronic
989718410 5:44493538-44493560 GGTTAGGTTTAGAACTAGAATGG - Intergenic
991972997 5:72158725-72158747 TACGAGTCTTAGAACAATAAGGG - Intronic
993782721 5:92088333-92088355 CACTTGGCTTAAAACTACAAAGG - Intergenic
994933937 5:106227225-106227247 TTTTAGGCATAGAACTAAAAGGG - Intergenic
998361043 5:141587473-141587495 TACAAGGCTTAGAAATGGCAGGG - Intronic
998696848 5:144650727-144650749 TACTATGCTTATAACTCAAATGG - Intergenic
1001351470 5:170971321-170971343 TACTTTGCTCAGAACTTGAAAGG + Intronic
1002479802 5:179492670-179492692 CACAAGGCTTATAACCAGAAAGG + Intergenic
1004983194 6:21049748-21049770 TACCAGGCTTAGAAATGTAATGG + Intronic
1008376012 6:50793034-50793056 CACTGGGCTAAGAACTAGCATGG + Intergenic
1008755309 6:54788313-54788335 TAATATGCATAGAAATAGAAAGG - Intergenic
1015825473 6:137306593-137306615 TACTAGTCTCAGAATTAGTAGGG - Intergenic
1016276875 6:142364033-142364055 TACTAGGCTTACATTCAGAAGGG + Intronic
1016389501 6:143560972-143560994 TTCTAGGCTTAGAACCAGCAAGG + Intronic
1017855455 6:158347377-158347399 GACCAGGCTTAGCAGTAGAATGG - Intronic
1024012227 7:45278711-45278733 TACTGAGCTGAGAACTAGAAAGG - Intergenic
1027512485 7:79100197-79100219 TATTAGCCATAGAAGTAGAATGG + Intronic
1028514651 7:91663753-91663775 AACTAGTCTTAAAACTAGACTGG + Intergenic
1028929770 7:96399557-96399579 TATTAGGCTGAGCAGTAGAAAGG + Intergenic
1030982035 7:116197545-116197567 TAGTAGGCTTAGAAATTGTATGG - Intergenic
1031464361 7:122090412-122090434 TACTTGGCTTGGAATTACAAGGG - Intronic
1031954100 7:127924471-127924493 TAGTAGGCATGAAACTAGAAAGG - Intronic
1032684704 7:134221377-134221399 TAAGAGGCTTTGAAATAGAATGG - Intronic
1040681407 8:49814296-49814318 TTCTAGTCTTATAACTAAAAAGG - Intergenic
1043061225 8:75506605-75506627 TAATAAGCTTTGAATTAGAAAGG - Intronic
1047290982 8:123530430-123530452 TTTTAGGCTTAGAAGTAGGAGGG - Intronic
1049982390 9:916286-916308 TACTGGGCCTAGAACTATGATGG - Intronic
1055440291 9:76330288-76330310 GACTAGGCTTAAAACAAGCATGG + Intronic
1056388505 9:86119021-86119043 CACTGGGCTGAGAACTAGAGAGG - Intergenic
1058458727 9:105162845-105162867 CTCTAGGCTTATAACCAGAAAGG + Intergenic
1060221060 9:121764347-121764369 GACTAGACTTTGAAGTAGAACGG + Intronic
1061937496 9:133866239-133866261 TACTAGGCTTAGAACTAGAAAGG - Intronic
1186565412 X:10656935-10656957 TACTGGGCATAGAAATGGAAAGG - Intronic
1187341159 X:18423055-18423077 TACAAGGTCTAGACCTAGAAGGG + Intergenic
1189397895 X:40639984-40640006 TACTAGGCTAAGAATCACAAGGG + Intronic
1191853153 X:65601281-65601303 TCCTAGGAGCAGAACTAGAAAGG - Intronic
1192063601 X:67857151-67857173 TACTAGGCCTAGAACATGAAGGG - Intergenic
1197216962 X:123875354-123875376 GAATATGTTTAGAACTAGAATGG + Intronic
1201367024 Y:13218494-13218516 TACTATGCATAAACCTAGAAGGG + Intergenic