ID: 1061942839

View in Genome Browser
Species Human (GRCh38)
Location 9:133892245-133892267
Sequence CCCGGGACACCTGTTCCCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 162}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061942839_1061942843 -10 Left 1061942839 9:133892245-133892267 CCAGTGGGAACAGGTGTCCCGGG 0: 1
1: 0
2: 0
3: 8
4: 162
Right 1061942843 9:133892258-133892280 GTGTCCCGGGTTGGCTGCATGGG No data
1061942839_1061942847 4 Left 1061942839 9:133892245-133892267 CCAGTGGGAACAGGTGTCCCGGG 0: 1
1: 0
2: 0
3: 8
4: 162
Right 1061942847 9:133892272-133892294 CTGCATGGGGCTGTGCTGCTAGG No data
1061942839_1061942848 12 Left 1061942839 9:133892245-133892267 CCAGTGGGAACAGGTGTCCCGGG 0: 1
1: 0
2: 0
3: 8
4: 162
Right 1061942848 9:133892280-133892302 GGCTGTGCTGCTAGGAAGTGAGG No data
1061942839_1061942849 20 Left 1061942839 9:133892245-133892267 CCAGTGGGAACAGGTGTCCCGGG 0: 1
1: 0
2: 0
3: 8
4: 162
Right 1061942849 9:133892288-133892310 TGCTAGGAAGTGAGGCCTCCTGG No data
1061942839_1061942844 -9 Left 1061942839 9:133892245-133892267 CCAGTGGGAACAGGTGTCCCGGG 0: 1
1: 0
2: 0
3: 8
4: 162
Right 1061942844 9:133892259-133892281 TGTCCCGGGTTGGCTGCATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061942839 Original CRISPR CCCGGGACACCTGTTCCCAC TGG (reversed) Intronic
900342012 1:2193985-2194007 CCCAGGACAGGTGTGCCCACTGG - Exonic
901280248 1:8027511-8027533 CCCGAGAAACCTCCTCCCACAGG - Intergenic
902383066 1:16061639-16061661 CCCTGCCCACCTGGTCCCACTGG - Intronic
904403092 1:30269728-30269750 CCCGGGAGACCTGTATCCTCTGG + Intergenic
904915480 1:33967423-33967445 CCCAGCACACCTGCACCCACAGG + Intronic
905455847 1:38087390-38087412 CCCAGGCCACCTCTTCCCCCAGG - Intergenic
905946472 1:41905356-41905378 CCTGGCACCCCAGTTCCCACTGG - Intronic
907298060 1:53468260-53468282 GCCTGGACACCTCTGCCCACAGG - Intergenic
908656548 1:66394757-66394779 CCCTGTACACCTGCTGCCACGGG + Intergenic
911072756 1:93845841-93845863 CCCTGGACCCCAGTTCTCACAGG - Intronic
914743584 1:150485109-150485131 CCCGGGAAACCTGGTCTCTCCGG + Intergenic
923465201 1:234242085-234242107 CCCACGATTCCTGTTCCCACTGG - Intronic
1065584180 10:27201282-27201304 CCAGGGACAGGTGTTACCACAGG + Intronic
1066350534 10:34632896-34632918 CCCGAGCCACCTGTGGCCACTGG - Intronic
1067851745 10:49759091-49759113 CCCCCGACACCTGTGCTCACTGG - Intronic
1070820904 10:79353685-79353707 CCCGGGTCACCCGTCCTCACAGG + Exonic
1072750058 10:97972024-97972046 CCCGGGAAACTTGTTTCTACTGG + Intronic
1075427141 10:122350667-122350689 TCTGGGACACCTGTTCCCTATGG + Intergenic
1076348978 10:129801782-129801804 CCTGGGAGACATGTTCCCAGTGG - Intergenic
1076687884 10:132206292-132206314 CCAGGGACACCTTGTGCCACCGG + Intergenic
1076923918 10:133471737-133471759 TCCAGGACACCTCTTCCCACAGG - Intergenic
1077319606 11:1935371-1935393 CCCCGGACACCTGCTTCCTCAGG + Intronic
1077630572 11:3808598-3808620 CCCGGGCCACCTGGGCCCCCGGG + Exonic
1078095089 11:8291858-8291880 CCAGGGAGACCTGCTCCCAGAGG + Intergenic
1078338772 11:10484364-10484386 CTCGGGACAGTTATTCCCACTGG + Intronic
1080583659 11:33663501-33663523 CAAGGGATACCTGATCCCACTGG - Intronic
1082024880 11:47565017-47565039 CCCAGGACCCCTGTTCACCCTGG + Intronic
1084481071 11:69420587-69420609 CCCAGGACTCCCGTCCCCACGGG + Intergenic
1088907535 11:114165850-114165872 CCTGGGACATCTGTGCTCACAGG + Intronic
1091303308 11:134521630-134521652 CCCTGGCCACCCCTTCCCACGGG + Intergenic
1091671225 12:2453607-2453629 ACCCGGACTCCTGTTCCCATGGG + Intronic
1097160962 12:57046461-57046483 CCCAGAACCCCTGTTCCCTCTGG - Intronic
1097938318 12:65278263-65278285 CCCCTGACACGTCTTCCCACAGG + Intergenic
1098522466 12:71449062-71449084 CACTAGACACCTGTTCCCAGGGG + Intronic
1105020773 12:132815312-132815334 CCCTGGTCACCTGTTCCTGCTGG - Intronic
1105431371 13:20340357-20340379 CCCGGGACTTCTGTACACACAGG + Intergenic
1106432366 13:29693393-29693415 CTCTGCATACCTGTTCCCACTGG - Intergenic
1108907784 13:55500722-55500744 CTTGGGACATCTGTCCCCACTGG - Intergenic
1112082029 13:95982348-95982370 CCCAGGTAACCTGTTCCTACTGG - Intronic
1112344432 13:98577483-98577505 CCCGGGACGCGTTTTCCCAGAGG - Intronic
1113421366 13:110173971-110173993 CCTGGGACTCCTGGCCCCACAGG - Exonic
1113805031 13:113107404-113107426 CCCGGGACACCCACTCCCCCGGG - Intronic
1113805071 13:113107506-113107528 CCCGGGACACCCACTCCCCCGGG - Intronic
1113805097 13:113107574-113107596 CCCGGGACACCCACTCCCCCGGG - Intronic
1113805413 13:113108425-113108447 CCCGGGACACCCACTCCCCCGGG - Intronic
1113805463 13:113108561-113108583 CCCGGGACACCCACTCCCCCGGG - Intronic
1113805561 13:113108834-113108856 CCCGGGACACCCACTCCCCCGGG - Intronic
1113851566 13:113421219-113421241 CCCAGGACACCTCTACCCCCGGG + Intergenic
1113851587 13:113421269-113421291 CCCGGGACACCTCTACCCCCGGG + Intergenic
1113851621 13:113421353-113421375 CCCGGGACACCTCTACCCCTGGG + Intergenic
1121127424 14:91417360-91417382 GCGGGTACACCTGTTCCCGCTGG - Intronic
1122051595 14:99064702-99064724 CCAGGATTACCTGTTCCCACAGG + Intergenic
1122893580 14:104744220-104744242 CCCGGGACCCCTGCTCCCCCAGG - Intronic
1129341567 15:74889941-74889963 CCCGGGGCACCCGTGCCCAGAGG - Intergenic
1130656391 15:85794629-85794651 CCCGGGACACGTAGTCCCGCGGG + Intronic
1133399981 16:5478724-5478746 CACGAGGCACCTTTTCCCACTGG + Intergenic
1134179807 16:12038378-12038400 CCCGGGGCACCTGTTAACAGAGG - Intronic
1135109325 16:19678361-19678383 CTGGGGACACCTTTTCCCACTGG + Intronic
1135166780 16:20146200-20146222 CCTAGGGCACCTGTTCCCAAAGG - Intergenic
1135306552 16:21372145-21372167 CCCGGGACACCTATTAACAGAGG - Intergenic
1136303297 16:29351287-29351309 CCCGGGACACCTATTAACAGAGG - Intergenic
1136514098 16:30757356-30757378 CACAGGACACCTGTTCTCCCTGG - Exonic
1140788542 16:78367327-78367349 CCTGGGCCACATGTGCCCACAGG - Intronic
1141679938 16:85538035-85538057 CCCTGGGCACCATTTCCCACTGG + Intergenic
1145207328 17:20991530-20991552 CCTGGGACCCCTGCTCCTACCGG - Intergenic
1145264079 17:21371207-21371229 CCGGGGACACCTTTGCCCCCAGG - Intergenic
1147035425 17:37676319-37676341 CCCGGGTCTCCTTTTCCCAGAGG + Intergenic
1150384973 17:64751486-64751508 CCCGTGACACCTGCTGTCACTGG - Intergenic
1152127878 17:78458317-78458339 CCTGGGACACTGGGTCCCACGGG - Intronic
1152219982 17:79058351-79058373 CCCAGGAAACTTGTTTCCACTGG - Intergenic
1155400159 18:25429268-25429290 CCCCTCACCCCTGTTCCCACTGG - Intergenic
1158706082 18:59793463-59793485 CCCGGGATTGCTGGTCCCACAGG - Intergenic
1159539081 18:69752808-69752830 CCCTGGTCCCCTGGTCCCACGGG + Intronic
1161614750 19:5263879-5263901 GCCTGCACACCTGTGCCCACAGG + Intronic
1162993229 19:14317117-14317139 CCTGGGACCCCTGTTCCCTGAGG + Intergenic
1163334225 19:16660846-16660868 CGCGGGACGCCCGTTCCCAGGGG - Intergenic
1165068358 19:33241568-33241590 CCCAGGACACCCCTTCCCATAGG + Intergenic
1165354128 19:35293393-35293415 ACAGGGACCCCTGTGCCCACAGG - Intronic
1165894091 19:39131285-39131307 CCGTGGAGACCTGTTCCCCCTGG + Intronic
1166574122 19:43820685-43820707 CCCGGGACTACAATTCCCACAGG - Intronic
1167426558 19:49432651-49432673 CCCTGTACACCTGTTCCCGCAGG - Exonic
926341700 2:11909523-11909545 CCAGGGACTCTTGTTCCCAAGGG - Intergenic
926580951 2:14632741-14632763 GCCGGGGCGCCTGCTCCCACTGG - Exonic
927826058 2:26311042-26311064 CCTGGGCTACCTGTGCCCACTGG - Exonic
927839867 2:26433755-26433777 CCTGGGAGACCTGGTACCACTGG + Intronic
928186601 2:29115821-29115843 CCAGCGACACCGGTGCCCACGGG - Intronic
930008289 2:46915436-46915458 CCCGACACAGCTGGTCCCACAGG + Intronic
930787239 2:55282507-55282529 CCTGGGACACCTGATCTCAGCGG - Intergenic
932144723 2:69307181-69307203 CCCGGGACGGCTGTGCCCCCAGG + Intergenic
932845860 2:75135471-75135493 CCCAGGACACCTGGTGCTACTGG + Intronic
933902855 2:86861875-86861897 CCCGGGACACCTGGCCCCGGGGG + Exonic
935777690 2:106487395-106487417 CCCGGGACACCTGGCCCCGGGGG - Intergenic
936089261 2:109490396-109490418 CCCTGAACCCCAGTTCCCACGGG - Intronic
937910534 2:127073531-127073553 CCCTGGACATCAGTCCCCACAGG + Intronic
946217371 2:218194997-218195019 CCCAGGCCAGCTGTTACCACTGG + Intergenic
947611748 2:231528966-231528988 CCCTGGAGACCTGTACCCAGGGG - Exonic
947630344 2:231648688-231648710 CCTGGGACACCTCTTCCCCAAGG - Intergenic
948926575 2:241102431-241102453 CCCGGGACACCTGAGCCCCGCGG - Intergenic
949036539 2:241818201-241818223 CCCCGGGCCCCTGTCCCCACGGG + Intergenic
1172437798 20:34942358-34942380 CCCGGGTCACATGTTGCCCCTGG - Intronic
1173615691 20:44401517-44401539 CCAGGCACACCTGCCCCCACTGG - Intronic
1174038467 20:47682777-47682799 CCCACCACACCTGTTTCCACAGG + Intronic
1175684971 20:61022178-61022200 ACAGGGACACCTGTTCTCAGAGG + Intergenic
1175981824 20:62742600-62742622 CCCCAGACACCTGTTTACACAGG + Intronic
1176141631 20:63547533-63547555 CGCTGGACACCGGGTCCCACCGG - Intergenic
1176448455 21:6841433-6841455 CCCTGGACACCGGTAGCCACTGG - Intergenic
1176826625 21:13706455-13706477 CCCTGGACACCGGTAGCCACTGG - Intergenic
1184296159 22:43526857-43526879 CCCCGCACACCTGTGCTCACTGG + Intergenic
1184766825 22:46576691-46576713 CCCGGGACGCGGGTTTCCACCGG + Intronic
1185199702 22:49494188-49494210 CCCGGGACAGCTGCTTCCACAGG - Intronic
952933720 3:38379352-38379374 CCCGGGACACATGCTGCCAGTGG - Intronic
954114624 3:48459525-48459547 CCCGGGGCACCGGTTCTCAGAGG - Intronic
956890373 3:73607401-73607423 CCCAGGACACCTCCTCCCGCAGG + Intronic
958962408 3:100522727-100522749 TCTGGCACACCTGTTCCCACTGG + Intronic
961794649 3:129401072-129401094 CCTGGGACCCCAGTGCCCACAGG - Intergenic
965531185 3:169772525-169772547 CCCGGGACACATGTTCCACGTGG - Intergenic
967652448 3:192003325-192003347 TCCTGGACAGCTGTTCCCAAAGG + Intergenic
971804347 4:31336024-31336046 AAGGGGACACCTATTCCCACAGG + Intergenic
980977929 4:139628837-139628859 CACAGGACACCGGCTCCCACCGG - Intergenic
1002457146 5:179351652-179351674 CCCAGGACAGCTATGCCCACAGG - Intergenic
1002598702 5:180341006-180341028 ACTGGGCCACCAGTTCCCACAGG + Intronic
1003120144 6:3312744-3312766 CCCCGGACACCTGTCACCAGAGG + Intronic
1014246742 6:119078317-119078339 GCCGGGGCACCTGTCCCCGCGGG + Exonic
1017525170 6:155236236-155236258 CCTGGGACAGGTGATCCCACTGG + Intronic
1019274238 7:167399-167421 CCAGGAACACCAGCTCCCACTGG - Intergenic
1019289388 7:242956-242978 CCCGGGATACCTGTGCCACCCGG + Intronic
1019289394 7:242974-242996 CCCGGGATACCTGTGCCACCCGG + Intronic
1019289400 7:242992-243014 CCCGGGAGACCTGTGCCACCAGG + Intronic
1019289468 7:243243-243265 CCCGGGAGACCTGTGCCACCCGG + Intronic
1019289484 7:243297-243319 CCCGGGAGACCTGTGCCACCCGG + Intronic
1019289500 7:243351-243373 CCCGGGAGACCTGTGCCACCAGG + Intronic
1019289543 7:243512-243534 CCCGGGAGACCTGTGCCACCCGG + Intronic
1019289559 7:243566-243588 CCCGGGAGACCTGTGCCACCCGG + Intronic
1019289575 7:243620-243642 CCCGGGAGACCTGTGCCACCCGG + Intronic
1019289591 7:243674-243696 CCCGGGAGACCTGTGCCACCCGG + Intronic
1019289607 7:243728-243750 CCCGGGAGACCTGTGCCACCCGG + Intronic
1019421381 7:952877-952899 CCGGGCACACCTGCACCCACTGG + Intronic
1021983682 7:26079151-26079173 CCCGCTACACCTGATCCCGCGGG - Intergenic
1023131878 7:37011669-37011691 CTGGGGACACCTGTTCCTCCAGG - Intronic
1032125066 7:129188084-129188106 TCCCAGACACCTGTTCCCGCAGG + Intergenic
1032591083 7:133193136-133193158 CCAGGCACACCTGCTGCCACTGG + Intergenic
1035028252 7:155841088-155841110 CCTGAGACACATGTGCCCACGGG - Intergenic
1035221241 7:157407659-157407681 CCGGGGACACCTGTGCACCCTGG - Intronic
1035588530 8:795653-795675 CACTGGACACCTGCTCTCACTGG - Intergenic
1035588532 8:795670-795692 CACTGGACGCCTGTTCTCACTGG - Intergenic
1035588540 8:795738-795760 CACTGGACGCCTGTTCTCACTGG - Intergenic
1035588548 8:795789-795811 CACCGGACGCCTGTTCTCACCGG - Intergenic
1035588562 8:795908-795930 CACTGGACGCCTGTTCTCACTGG - Intergenic
1035588586 8:796146-796168 CACTGGACACCTGCTCTCACTGG - Intergenic
1035588588 8:796163-796185 CACTGGACACCTGTTCTCACTGG - Intergenic
1036459413 8:8938670-8938692 CCGTGGAGACCTGTTTCCACGGG - Intergenic
1037788806 8:21919313-21919335 CCCGGGACCCCTGCACCCAGTGG - Intergenic
1037819978 8:22130796-22130818 CCCGGGGCGCGTGTTCCCCCCGG - Exonic
1038151372 8:24944120-24944142 CTCGGGAAACCTGCTGCCACTGG + Intergenic
1047252543 8:123191694-123191716 CCTGGGAGAGCTGTTCCCATTGG - Intronic
1049477884 8:142805333-142805355 CCTGGGACACCTGTGCTCTCTGG - Intergenic
1049958098 9:711756-711778 CCCGGGAGAGCTGTTCCAGCTGG - Exonic
1055606721 9:77977924-77977946 CCAGGGACTGCTGTTGCCACTGG - Intronic
1055706713 9:79013370-79013392 CCATGGATACCAGTTCCCACTGG + Intergenic
1056703828 9:88934563-88934585 CCAGGGACACCTGGAACCACAGG + Intergenic
1061942839 9:133892245-133892267 CCCGGGACACCTGTTCCCACTGG - Intronic
1061971698 9:134048726-134048748 CCCGGGACCCCTGAGCCCTCGGG - Intronic
1062701445 9:137907015-137907037 ATCAGGACACCTGCTCCCACAGG - Intronic
1203520736 Un_GL000213v1:43085-43107 CCCTGGACACCGGTAGCCACTGG + Intergenic
1185507769 X:642834-642856 CCCAGGACACCAGGTCCCAAAGG - Intronic
1185507831 X:643051-643073 CCCGGGACACCAGATCCCCAAGG - Intronic
1185927476 X:4163205-4163227 CCCTGGAGTCCTTTTCCCACAGG - Intergenic
1189891849 X:45610866-45610888 CCAGGGACACCCATTCCCCCAGG - Intergenic
1195750760 X:108160547-108160569 ACGGGGGCACCTGTTCCGACTGG + Exonic
1195767429 X:108311140-108311162 CACTGGACACCTGTTTTCACAGG - Intronic
1201151646 Y:11098233-11098255 CCAGGGACACCAGGTTCCACAGG + Intergenic