ID: 1061945258

View in Genome Browser
Species Human (GRCh38)
Location 9:133905131-133905153
Sequence GCCAGAACAGTGGCTCAGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061945254_1061945258 -3 Left 1061945254 9:133905111-133905133 CCACACTTCACAGCACCACAGCC No data
Right 1061945258 9:133905131-133905153 GCCAGAACAGTGGCTCAGCCGGG No data
1061945252_1061945258 3 Left 1061945252 9:133905105-133905127 CCTGGCCCACACTTCACAGCACC No data
Right 1061945258 9:133905131-133905153 GCCAGAACAGTGGCTCAGCCGGG No data
1061945251_1061945258 4 Left 1061945251 9:133905104-133905126 CCCTGGCCCACACTTCACAGCAC No data
Right 1061945258 9:133905131-133905153 GCCAGAACAGTGGCTCAGCCGGG No data
1061945247_1061945258 28 Left 1061945247 9:133905080-133905102 CCCTGTGCAAAGTCACTCACCAA No data
Right 1061945258 9:133905131-133905153 GCCAGAACAGTGGCTCAGCCGGG No data
1061945250_1061945258 9 Left 1061945250 9:133905099-133905121 CCAAGCCCTGGCCCACACTTCAC No data
Right 1061945258 9:133905131-133905153 GCCAGAACAGTGGCTCAGCCGGG No data
1061945253_1061945258 -2 Left 1061945253 9:133905110-133905132 CCCACACTTCACAGCACCACAGC No data
Right 1061945258 9:133905131-133905153 GCCAGAACAGTGGCTCAGCCGGG No data
1061945248_1061945258 27 Left 1061945248 9:133905081-133905103 CCTGTGCAAAGTCACTCACCAAG No data
Right 1061945258 9:133905131-133905153 GCCAGAACAGTGGCTCAGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061945258 Original CRISPR GCCAGAACAGTGGCTCAGCC GGG Intronic