ID: 1061945773

View in Genome Browser
Species Human (GRCh38)
Location 9:133907619-133907641
Sequence ACTGATTTATGGACTCTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061945762_1061945773 26 Left 1061945762 9:133907570-133907592 CCCCTGGGAGATGTTTTAGGGGA 0: 1
1: 0
2: 1
3: 16
4: 156
Right 1061945773 9:133907619-133907641 ACTGATTTATGGACTCTGGAGGG No data
1061945760_1061945773 27 Left 1061945760 9:133907569-133907591 CCCCCTGGGAGATGTTTTAGGGG 0: 1
1: 0
2: 1
3: 11
4: 130
Right 1061945773 9:133907619-133907641 ACTGATTTATGGACTCTGGAGGG No data
1061945764_1061945773 24 Left 1061945764 9:133907572-133907594 CCTGGGAGATGTTTTAGGGGATG 0: 1
1: 0
2: 0
3: 11
4: 132
Right 1061945773 9:133907619-133907641 ACTGATTTATGGACTCTGGAGGG No data
1061945769_1061945773 -7 Left 1061945769 9:133907603-133907625 CCTCGCTGGAATCAAAACTGATT 0: 1
1: 0
2: 1
3: 4
4: 80
Right 1061945773 9:133907619-133907641 ACTGATTTATGGACTCTGGAGGG No data
1061945763_1061945773 25 Left 1061945763 9:133907571-133907593 CCCTGGGAGATGTTTTAGGGGAT 0: 1
1: 0
2: 1
3: 14
4: 141
Right 1061945773 9:133907619-133907641 ACTGATTTATGGACTCTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061945773 Original CRISPR ACTGATTTATGGACTCTGGA GGG Intronic
No off target data available for this crispr