ID: 1061948550

View in Genome Browser
Species Human (GRCh38)
Location 9:133922293-133922315
Sequence GTGGGTGTCAAGCCCCTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 155}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061948550_1061948560 14 Left 1061948550 9:133922293-133922315 CCAGGAAGGGGCTTGACACCCAC 0: 1
1: 0
2: 2
3: 22
4: 155
Right 1061948560 9:133922330-133922352 GCCCAGTGGACCAAGGGGCCTGG No data
1061948550_1061948559 9 Left 1061948550 9:133922293-133922315 CCAGGAAGGGGCTTGACACCCAC 0: 1
1: 0
2: 2
3: 22
4: 155
Right 1061948559 9:133922325-133922347 GATGTGCCCAGTGGACCAAGGGG No data
1061948550_1061948556 0 Left 1061948550 9:133922293-133922315 CCAGGAAGGGGCTTGACACCCAC 0: 1
1: 0
2: 2
3: 22
4: 155
Right 1061948556 9:133922316-133922338 GGGGAAGCAGATGTGCCCAGTGG No data
1061948550_1061948558 8 Left 1061948550 9:133922293-133922315 CCAGGAAGGGGCTTGACACCCAC 0: 1
1: 0
2: 2
3: 22
4: 155
Right 1061948558 9:133922324-133922346 AGATGTGCCCAGTGGACCAAGGG No data
1061948550_1061948557 7 Left 1061948550 9:133922293-133922315 CCAGGAAGGGGCTTGACACCCAC 0: 1
1: 0
2: 2
3: 22
4: 155
Right 1061948557 9:133922323-133922345 CAGATGTGCCCAGTGGACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061948550 Original CRISPR GTGGGTGTCAAGCCCCTTCC TGG (reversed) Intronic
900385219 1:2407496-2407518 CTGGGTGTCCAGCCACTTCCTGG + Intronic
900547002 1:3234826-3234848 GTGGGTGTCAGGCACCATCACGG - Intronic
900775773 1:4584378-4584400 GTGGCTCTCAAGCCATTTCCAGG + Intergenic
901223957 1:7601149-7601171 GTGGGGGTCAGCCCCCTGCCCGG - Intronic
903928644 1:26849584-26849606 GTGGGTCACAAGCCCATTGCAGG - Intronic
904532097 1:31176638-31176660 GGGGGTGTCAGCCCCCCTCCCGG + Intergenic
904559128 1:31385174-31385196 GTGGGTTCCAACACCCTTCCTGG - Intergenic
904818712 1:33226059-33226081 GTGGGTGTCAAGCCCCCAGGAGG + Intergenic
905474270 1:38214786-38214808 GTGTGTCTCAGGACCCTTCCTGG + Intergenic
909931459 1:81503721-81503743 GTGGGTGTCCAGCTTCCTCCAGG + Intronic
911579861 1:99622058-99622080 GTGGATTTCAAGCCCCTAACTGG - Intergenic
911745995 1:101442452-101442474 GTGGGTCTTAAGACCCTCCCAGG - Intergenic
911924501 1:103811705-103811727 GTGGGTGAGAACCCTCTTCCAGG + Intergenic
915374256 1:155378359-155378381 GTTGATGTCAAACCCCTTTCTGG - Exonic
917643156 1:177003166-177003188 GTGTGTGTTATGTCCCTTCCTGG - Intronic
923624868 1:235605823-235605845 GTGGCACTCAAGGCCCTTCCTGG - Intronic
1062798298 10:360576-360598 GTGGGAGGCAAGCCCTTCCCAGG + Intronic
1065935290 10:30515584-30515606 GTGGGTGTCAAGGCCATAGCAGG + Intergenic
1068758615 10:60682601-60682623 GAGGGTCTTAAGACCCTTCCTGG + Intronic
1073426729 10:103459562-103459584 GTGGATGGCAAACCCTTTCCTGG + Intergenic
1076930580 10:133529138-133529160 GTGGGTCTCTTCCCCCTTCCCGG - Intronic
1077186158 11:1236320-1236342 CTGGGTCTCAGGCCCCTCCCTGG + Intronic
1077503621 11:2920229-2920251 GTGGGGGTCCAGCCCCTCCCAGG - Intronic
1077518727 11:3018385-3018407 GTGAGTCCCCAGCCCCTTCCTGG - Intronic
1077536988 11:3129208-3129230 GTGGCTCTGAAGCCCCTTCCGGG - Intronic
1081569411 11:44280313-44280335 GTGGGTGTGGAGCCAGTTCCTGG - Intronic
1081854931 11:46297004-46297026 GGGTTTGCCAAGCCCCTTCCTGG - Intronic
1081979898 11:47259744-47259766 GGGGGTCTCAGGCCCCATCCCGG - Intronic
1082010777 11:47448494-47448516 GTGGGTCTCAAGCCCATTGTAGG - Intronic
1083139329 11:60708842-60708864 TTGGTTGTCAAGCCCTTTCTGGG - Intronic
1083609085 11:63996681-63996703 GTGGGTGTCTACCTCCTCCCCGG + Intronic
1083655879 11:64229429-64229451 GTGGGTGACCAGCCCCTGCGGGG - Intronic
1084481627 11:69424080-69424102 GTGGGTGTCAGACCCATGCCAGG + Intergenic
1087198220 11:95321025-95321047 GGGGGTGTCAGCCCCCTGCCCGG - Intergenic
1089338202 11:117740126-117740148 GTAGTTGTCCAGCCCCTGCCTGG - Intronic
1089457994 11:118636522-118636544 GTGTGTGTCAGGCACCTTGCTGG + Intronic
1090244366 11:125205271-125205293 TTGGGTGTGGAGTCCCTTCCGGG + Intronic
1090628184 11:128624099-128624121 GTGGGTTTAGAGCCCCTCCCAGG - Intergenic
1092295933 12:7199869-7199891 GTGGGGGTCAGCCCCCTGCCCGG - Intronic
1094081586 12:26542193-26542215 GTGGGTGTCAAGCCTTTCCTGGG + Intronic
1096280030 12:50244900-50244922 CTGGATGTCAGTCCCCTTCCTGG - Intronic
1101800095 12:108014274-108014296 CTCTGTGCCAAGCCCCTTCCAGG + Intergenic
1101863778 12:108504439-108504461 GTGGTGATCAAGCCCCTTGCTGG + Intergenic
1103931317 12:124452608-124452630 GTGGGCTTCCAGCCCCTTTCTGG - Intronic
1104973779 12:132543009-132543031 ATGGGGGCCAAGCCCCCTCCAGG + Intronic
1106255442 13:28018545-28018567 GTGGGTGACAAGCACGTTCCTGG + Exonic
1107516690 13:41136206-41136228 GTGGGTGTCAAGGGCCCTCATGG - Intergenic
1112849560 13:103688288-103688310 GTAATTGTCAAGCTCCTTCCTGG + Intergenic
1115525565 14:34277116-34277138 CTGGGTCTCATGCCCATTCCTGG - Intronic
1118139544 14:63064907-63064929 CTTGGTGTCCAGCGCCTTCCAGG - Intronic
1121691119 14:95877492-95877514 GTGGGTGTCCAGGCCGTGCCGGG + Intergenic
1122906973 14:104806088-104806110 GTGGGGGGCCAGCCCCTGCCTGG - Intergenic
1123412822 15:20073759-20073781 GTAGATGTCATGCCCCATCCCGG + Intergenic
1123522164 15:21080872-21080894 GTAGATGTCATGCCCCATCCCGG + Intergenic
1125750024 15:42021646-42021668 GGGCGTGTCCAGCCCCTGCCTGG + Intronic
1129295122 15:74596026-74596048 GTGGGTGTCCAGCTTCCTCCAGG + Exonic
1131001277 15:88941596-88941618 GGGGGTGTCAGCCCCCTGCCCGG - Intergenic
1131511050 15:93049739-93049761 GAGTGTGTCCAGCCCCTGCCTGG - Intronic
1133915575 16:10106594-10106616 CTGGGGGTCAGGCCACTTCCAGG - Intronic
1134100204 16:11446704-11446726 CTGGCTCTCAGGCCCCTTCCGGG + Intronic
1134602511 16:15544575-15544597 GTGAGTGTCAAGCCAGCTCCCGG - Intronic
1134854268 16:17505935-17505957 GTGGGGGTCAGTCCCCTGCCCGG - Intergenic
1136070871 16:27786265-27786287 AAGGGTGTCAAGCCCCTGCCTGG - Intergenic
1137291614 16:47055503-47055525 GCGGGAGTCCTGCCCCTTCCAGG - Intergenic
1138220297 16:55244595-55244617 GTGGGTATCATGCCCTTTTCAGG - Intergenic
1138448054 16:57077186-57077208 GTGTGAGTCGAGGCCCTTCCTGG + Intronic
1138562622 16:57810959-57810981 CTGGGTCTCATGCCCCTCCCTGG + Intronic
1140476667 16:75242527-75242549 GTAGATGTCATGCCCCATCCCGG + Exonic
1141428358 16:83957739-83957761 GTGAGTGTCAGGCCCCAGCCAGG + Intronic
1143771729 17:9173381-9173403 GTGGGTGTCAGGCCTCTTGGAGG - Intronic
1145174137 17:20685191-20685213 GTGGGGGTCAGCCCCCTGCCCGG + Intergenic
1147220989 17:38930624-38930646 GGGGGGGTCAACCCCCTGCCCGG - Intergenic
1148872610 17:50667736-50667758 CTGGATGTGCAGCCCCTTCCTGG + Exonic
1150884188 17:69066126-69066148 ATGGGTTCCATGCCCCTTCCAGG + Intergenic
1152135196 17:78499584-78499606 GTGGATGTTAAGTCCCTTCCAGG + Intronic
1152292795 17:79449849-79449871 GTGGGTGGCTGGCCCCCTCCTGG + Intronic
1152371499 17:79891283-79891305 CTGGCGGTCAAGCTCCTTCCTGG - Intergenic
1153605373 18:6827403-6827425 GGGGGGGTCAACCCCCCTCCCGG - Intronic
1155172646 18:23278267-23278289 GTGGGTTCCAATTCCCTTCCAGG - Intronic
1157079297 18:44505361-44505383 GTGGGTGTCAAGCCTCTTAGGGG - Intergenic
1160318939 18:77872387-77872409 GTGGGTGACAGGCGCCATCCTGG + Intergenic
1160580192 18:79879286-79879308 GTGGTTGGCAAGCCCCACCCAGG + Intronic
1162820066 19:13217553-13217575 GTGGGTGCCAGGCCTCATCCTGG - Intronic
1163322312 19:16581940-16581962 GTGGGTTTCTAGCACCTTACAGG - Intronic
1164298449 19:23937224-23937246 GTGGGGGTCAGCCCCCTGCCCGG - Intronic
1165446868 19:35861342-35861364 CTGGGTGTAAAGCTCCTTCCAGG - Intronic
1166291140 19:41864297-41864319 GTGGGTGCCCAGCCCCATGCAGG - Intronic
1168259556 19:55185837-55185859 GCGTGTGTCCAGCCCCGTCCTGG - Intronic
927967839 2:27282744-27282766 GTGGGTTTCAAGCCGCTGCTAGG + Exonic
929739601 2:44588427-44588449 GGGGGGGTCAGGCCCCTGCCCGG + Intronic
932211060 2:69930897-69930919 GAGGGTGACAAGCGCCTCCCTGG - Intronic
933948847 2:87311088-87311110 GTAGGTGTCATGCCCCTTCCAGG - Intergenic
934715338 2:96539698-96539720 GTGGGGGCCATGCCCCTTCCCGG + Intronic
936331351 2:111550508-111550530 GTAGGTGTCATGCCCCTTCCAGG + Intergenic
936556542 2:113502424-113502446 CTGAGGGTCAGGCCCCTTCCCGG + Intergenic
938405612 2:131031644-131031666 GTGAGTGTCCAGTCCCTGCCAGG + Intronic
946245162 2:218383192-218383214 ATGGGTGGCAAGTCCCTTCCAGG + Intronic
947739291 2:232477777-232477799 CTGGCTGTGAAGGCCCTTCCTGG - Intergenic
947800763 2:232927699-232927721 GTGGGTGTTGAGCCCCGGCCCGG - Intronic
948667518 2:239545797-239545819 GTGGCTGTCACACTCCTTCCAGG - Intergenic
1171376783 20:24699325-24699347 GTGTGTGTCAGGTCCCTGCCTGG - Intergenic
1171861522 20:30405706-30405728 GGGGGTGTCAGCCCCCTGCCCGG + Intergenic
1172693447 20:36805830-36805852 GTGTGTTTCCAGCCCCTTCCCGG - Intronic
1172907301 20:38379055-38379077 GTGGGGGTCAGCCCCCTGCCCGG + Intergenic
1173273142 20:41555399-41555421 GTGGGGGTCAGCCCCCTGCCCGG - Intronic
1173408797 20:42791378-42791400 GTGGGTGTCATTCTCCTTCAGGG + Exonic
1173910602 20:46667010-46667032 GTGAGTGCCACACCCCTTCCTGG - Intronic
1174742361 20:53027782-53027804 ATGGGTTTCAAGTCCCTTCAGGG - Intronic
1175931318 20:62495139-62495161 TTGAGTGTCAGGCCCCATCCTGG - Intergenic
1176373042 21:6073967-6073989 GTGGGAGCCAAGCCCTTTCCAGG - Intergenic
1178588388 21:33888588-33888610 CTGGGAGTCTAGCCCCTTCCCGG + Exonic
1178741717 21:35207372-35207394 GTAGGTGTCCAGCTCCTTCCTGG + Intronic
1179750435 21:43464276-43464298 GTGGGAGCCAAGCCCTTTCCAGG + Intergenic
1179951565 21:44711522-44711544 TTGGGTGCCAAGCTCCATCCAGG + Exonic
1180214825 21:46317403-46317425 GCGGGAGTCAAGCCCCTCCGAGG + Intronic
1183096628 22:35555861-35555883 GTTGCTGTCAACCCCATTCCAGG - Intergenic
949853528 3:8440395-8440417 GGGGGTGTCAGCCCCCTGCCCGG + Intergenic
949863704 3:8529879-8529901 GTGTGTGCCAAGCCCTTTTCAGG + Intronic
950819545 3:15742604-15742626 GTGGGGGTCAGCCCCCTGCCAGG + Intronic
954450311 3:50567936-50567958 GTGGGTGGCCAGGCCCTTCCGGG + Intronic
958989278 3:100823164-100823186 GTGGGTTTCTAACTCCTTCCTGG - Intronic
960921035 3:122747534-122747556 GTGGGGGTCAGCCCCCTGCCCGG + Intronic
962240673 3:133748325-133748347 GTGGCTGTCAAGGCCTTTCTAGG + Intronic
963974032 3:151460900-151460922 GTGGGGTTCCAGCCCTTTCCGGG + Intergenic
965730110 3:171762636-171762658 GTGAGTGGAAAGCCCGTTCCAGG + Intronic
968064552 3:195751297-195751319 GTGGGGGTGAGGCCCCATCCGGG + Intronic
968175163 3:196543200-196543222 GTGGGGGTCAGCCCCCTGCCCGG - Intergenic
968299531 3:197602401-197602423 GTGGGGGTCAGCCCCCTGCCCGG - Intergenic
968752410 4:2396855-2396877 GTCGGAGTTAAGCCCCTTCAGGG - Intronic
969333641 4:6494315-6494337 ATGGGTGTGAAGGCCCTCCCCGG + Intronic
973862575 4:55079756-55079778 TTGGGTCACAAGCCTCTTCCAGG + Exonic
976265920 4:83186043-83186065 GTGGGGGTCAGCCCCCTGCCCGG - Intergenic
985330147 4:188823005-188823027 CTGGGAGTGATGCCCCTTCCAGG - Intergenic
986032173 5:3904975-3904997 GTGGCTGTGAAGGCCCTCCCTGG + Intergenic
992879425 5:81091389-81091411 GTGGGAGTCAAGCCGTCTCCTGG + Intronic
994608738 5:102008208-102008230 GTGGTGGTCAAGCTCCTTGCAGG + Intergenic
996552381 5:124744294-124744316 GTGGCAGCCAGGCCCCTTCCGGG - Exonic
1001570533 5:172727663-172727685 GTGTGTGTGGAGCCACTTCCAGG + Intergenic
1003270463 6:4603304-4603326 GTGGGTGCCCTGCCCCTCCCAGG - Intergenic
1003371441 6:5531235-5531257 GTGGGAGTCAAGCCCCTGCAGGG + Intronic
1005475619 6:26204768-26204790 GGGGGTGTCAAGCGCATTTCTGG + Exonic
1006154037 6:32004553-32004575 GTGGCTATCCAGCCCCTTCCTGG + Intergenic
1006160346 6:32037290-32037312 GTGGCTATCCAGCCCCTTCCTGG + Intergenic
1006492581 6:34398274-34398296 GGGGGTGTCAGCCCCCTGCCCGG + Intronic
1006502507 6:34467458-34467480 GAGGGGGTCGAGCCCCTTCTTGG + Intronic
1006581120 6:35078521-35078543 GTGGATGTCAGGGCCCCTCCTGG - Intronic
1018247747 6:161838926-161838948 GTGCTTGTCAGGCCCCTTGCAGG - Intronic
1019348825 7:543585-543607 ATGGGTGTCACGACCCATCCAGG - Intergenic
1019557513 7:1640046-1640068 CTGGGTGCCAGACCCCTTCCTGG - Intergenic
1019958655 7:4437574-4437596 GTGGGTGTCAGACTCCTTCCTGG - Intergenic
1024212081 7:47215145-47215167 GTGGTTATGAAGCCCCTGCCTGG + Intergenic
1025854379 7:65264944-65264966 GTGGGTGTCGAGCACCCTCTGGG + Intergenic
1026018917 7:66693442-66693464 GTAGGTCTCATGCCCCTCCCTGG + Intronic
1028727880 7:94109807-94109829 GTGAGTCTCAAGCTCCTTCTAGG - Intergenic
1033280702 7:140004621-140004643 GGGGGAGTCCAGACCCTTCCAGG + Intronic
1035960113 8:4127194-4127216 GTGGCTGTCCGGCCCCCTCCAGG + Intronic
1036204959 8:6798770-6798792 TTGTGGGTCAAGCCCCTCCCGGG + Intergenic
1040590929 8:48791259-48791281 TTTGGAGTCATGCCCCTTCCAGG + Intergenic
1041381763 8:57259575-57259597 GTGGCCGTTCAGCCCCTTCCTGG + Intergenic
1043745465 8:83869145-83869167 GTGGGAGCCCCGCCCCTTCCTGG + Intergenic
1047760340 8:127949771-127949793 GTGAGTGTCAGGCCCCACCCAGG + Intergenic
1048823182 8:138398228-138398250 CTGGGGGTCAAGCACCTTGCTGG - Intronic
1049210072 8:141381923-141381945 CTGTGTGCCAGGCCCCTTCCAGG - Intergenic
1049377698 8:142296812-142296834 GAGGGTGTCCTGCCCCGTCCTGG - Intronic
1049380978 8:142315620-142315642 GTGCGTGTCCAGCCCCACCCCGG - Intronic
1049896480 9:114915-114937 CTGAGGGTCAGGCCCCTTCCCGG - Intergenic
1053076514 9:35138945-35138967 GTGGGAGCCCCGCCCCTTCCAGG + Intergenic
1053286916 9:36855648-36855670 GTGGCGGTCAAGGCCCTTCAGGG + Intronic
1055242117 9:74197712-74197734 GTGGGTGTCAGCCCCCCACCCGG + Intergenic
1057898116 9:98925696-98925718 GCGGGTGTCAAGCAGCTTCCTGG + Intergenic
1060783017 9:126427307-126427329 GTGGGTGTCAGGCACCTTATGGG + Intronic
1061446378 9:130640518-130640540 TTGAGTGTCAAGCCACTTTCTGG - Intergenic
1061948550 9:133922293-133922315 GTGGGTGTCAAGCCCCTTCCTGG - Intronic
1062059898 9:134489648-134489670 GTGGGTGGCAGGCGGCTTCCTGG + Intergenic
1062327382 9:136018658-136018680 GTGGGTGCACAGCCCCTGCCCGG + Intronic
1062480010 9:136746757-136746779 GTGGGTGTCTACCCCCTGGCAGG - Intronic
1062585842 9:137249591-137249613 GTGGGTCTTAAGACCCTTCCAGG + Intergenic
1189968229 X:46395325-46395347 GTGGGGGTCAGCCCCCTGCCCGG - Intergenic
1199704071 X:150409013-150409035 GAGGTTGTCTAGTCCCTTCCAGG - Intronic
1200149239 X:153943271-153943293 CTGGGGGTGCAGCCCCTTCCAGG + Intronic