ID: 1061949212

View in Genome Browser
Species Human (GRCh38)
Location 9:133926842-133926864
Sequence CAGAGCACACAGAAGCAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061949211_1061949212 -9 Left 1061949211 9:133926828-133926850 CCAGCTGAGCTAAGCAGAGCACA 0: 1
1: 0
2: 1
3: 24
4: 193
Right 1061949212 9:133926842-133926864 CAGAGCACACAGAAGCAGAGAGG No data
1061949207_1061949212 27 Left 1061949207 9:133926792-133926814 CCAGGCTCCGATCATCTGAGGCT 0: 1
1: 0
2: 1
3: 4
4: 95
Right 1061949212 9:133926842-133926864 CAGAGCACACAGAAGCAGAGAGG No data
1061949206_1061949212 28 Left 1061949206 9:133926791-133926813 CCCAGGCTCCGATCATCTGAGGC 0: 1
1: 0
2: 0
3: 12
4: 103
Right 1061949212 9:133926842-133926864 CAGAGCACACAGAAGCAGAGAGG No data
1061949210_1061949212 -2 Left 1061949210 9:133926821-133926843 CCTGGCACCAGCTGAGCTAAGCA 0: 1
1: 0
2: 1
3: 15
4: 186
Right 1061949212 9:133926842-133926864 CAGAGCACACAGAAGCAGAGAGG No data
1061949208_1061949212 20 Left 1061949208 9:133926799-133926821 CCGATCATCTGAGGCTGCATGTC 0: 1
1: 0
2: 1
3: 14
4: 121
Right 1061949212 9:133926842-133926864 CAGAGCACACAGAAGCAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061949212 Original CRISPR CAGAGCACACAGAAGCAGAG AGG Intronic
No off target data available for this crispr