ID: 1061950135

View in Genome Browser
Species Human (GRCh38)
Location 9:133931499-133931521
Sequence CAGAGGACAGGGAAGGCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 984
Summary {0: 1, 1: 1, 2: 8, 3: 93, 4: 881}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061950135 Original CRISPR CAGAGGACAGGGAAGGCAGC TGG (reversed) Intronic
900241943 1:1621373-1621395 CAGCCATCAGGGAAGGCAGCTGG - Intronic
900250443 1:1666023-1666045 CGGAGGCAAGGGGAGGCAGCAGG + Intronic
900294387 1:1941602-1941624 ATGAAGACAGGGAAGACAGCGGG + Intronic
900574998 1:3378687-3378709 GAGAGGACAGGAAAGGTGGCAGG + Intronic
900587885 1:3442155-3442177 TTCAGGACAGGGAAGGCAGATGG + Intergenic
900662056 1:3789680-3789702 CAGGGGACAGGAAGGGAAGCGGG + Intronic
900746204 1:4362326-4362348 CAGCCAACAGGGAAGGAAGCTGG - Intergenic
900769403 1:4528789-4528811 CAGGTGACAGAGGAGGCAGCAGG - Intergenic
900786316 1:4652927-4652949 CAGAGGACCCGAGAGGCAGCAGG - Intergenic
901157747 1:7151711-7151733 CGGAGGACATGGCAGGCTGCTGG + Intronic
901578862 1:10224040-10224062 CAGAGGCCAAGGCAGGCAGATGG - Intronic
901974357 1:12932518-12932540 CAGAGGAGAGAGATGGCAGCAGG - Intronic
902010817 1:13269250-13269272 CAGAGGAGAGAGATGGCAGCAGG + Intergenic
902590315 1:17469334-17469356 TACAGGACAGGGAAGGAAGCTGG + Intergenic
902816185 1:18918011-18918033 CAGAGGAAGGGGCAGGAAGCGGG + Intronic
903129271 1:21268132-21268154 CAGAAGACAATGGAGGCAGCAGG + Intronic
903304237 1:22401465-22401487 CGGAGGAGTGGGAAGGCAGTGGG - Intergenic
903736893 1:25535536-25535558 CAGAGGGCATGGGAGGCAGCCGG + Intergenic
903817386 1:26074518-26074540 TAGAAGACAGGCAAGGCATCAGG + Intergenic
904426040 1:30423779-30423801 CAGAGGATGAGGAAGGCAGTGGG + Intergenic
904587108 1:31586675-31586697 CAGAGGAGGGGGAAGGGAGCTGG - Intronic
905018155 1:34791563-34791585 CTGAGGAAAGGGAAGGTGGCAGG - Intronic
905183475 1:36180105-36180127 AGGAGTACAGGGAAGGCTGCTGG - Intronic
905201904 1:36321554-36321576 GAGCGGACAGGGAGGCCAGCTGG - Intronic
905309036 1:37036908-37036930 CACTGGACTTGGAAGGCAGCTGG + Intergenic
905325148 1:37146532-37146554 CAGTGGACACTGAAGGCATCTGG + Intergenic
905329208 1:37180328-37180350 CAGCAGACTGGGAAGGCAGAGGG - Intergenic
905819929 1:40980909-40980931 CAGAGCACAGGAAAGGGAACAGG - Intronic
905906634 1:41622778-41622800 CAGGGGAAAGGGAAGGTGGCTGG + Intronic
905907215 1:41627106-41627128 CAGAGGGCAGGGCATGCAGATGG + Intronic
906258448 1:44368123-44368145 CAGAAGAAAGAGAGGGCAGCTGG + Intergenic
906305993 1:44719552-44719574 CAGTGGTCTGGGAAGGCAGAGGG - Intronic
906475010 1:46163685-46163707 AAGAGGGCAGGGAAAGCACCAGG - Intronic
906833389 1:49058473-49058495 CACATGACTGGGAAGGCTGCAGG - Intronic
906969397 1:50495257-50495279 CAGAGGCTAGGGAGGGCAGTGGG - Intronic
907303705 1:53502731-53502753 GAGAGGAGAGGGAAGGGGGCAGG + Intergenic
907407107 1:54260395-54260417 CAGTGGTCAGGGAGGGCAGGAGG + Intronic
907594375 1:55705902-55705924 TAGAGGACAGGGAAAGGAGGAGG - Intergenic
907608889 1:55847855-55847877 TGGAGGACACGGAAGGCAGGAGG - Intergenic
908316509 1:62937794-62937816 CTGAGGAAAGGGCAGGCAGCCGG + Intergenic
908794507 1:67817688-67817710 GGGAAGAAAGGGAAGGCAGCAGG + Intronic
909564504 1:77039569-77039591 CAGAGGATAGATAAGGCAGGGGG + Intronic
910285482 1:85549515-85549537 AAGTGGACACGGAAGGCACCTGG + Intronic
910310684 1:85820605-85820627 CAGATGGTAGGGAAGGCAGGTGG - Intronic
911072104 1:93840288-93840310 CAAACCACAGGGAAAGCAGCAGG - Intronic
912694010 1:111827295-111827317 AAGAGGAGAGGTAAGGCAGCTGG + Intronic
912695887 1:111842046-111842068 CTGGAGAGAGGGAAGGCAGCTGG + Intronic
912860760 1:113211768-113211790 CAGAGGACAGGGAGGGGAGATGG + Intergenic
913516950 1:119612968-119612990 CTGAGGTCAGTGAAGGAAGCAGG - Intergenic
913665979 1:121049225-121049247 CTGAGGAAAGGGAAGGCTTCAGG - Intergenic
914017377 1:143832501-143832523 CTGAGGAAAGGGAAGGCTTCAGG - Intergenic
914655988 1:149741033-149741055 CTGAGGAAAGGGAAGGCTTCAGG - Intergenic
914859607 1:151375016-151375038 CAGAGGGAAGGATAGGCAGCTGG - Intergenic
915106973 1:153540803-153540825 CAGCGGGCAGGGAGGGCAGGGGG + Intronic
915157606 1:153891269-153891291 AAGAAAAAAGGGAAGGCAGCCGG + Intronic
915452206 1:156013887-156013909 CAGATGAAAAGGAAGGCAGAAGG + Intronic
915473122 1:156137521-156137543 CAGAGGACAGAGTAAGCAGCAGG + Intronic
915982360 1:160428279-160428301 CAGAGGAAAGAGAAGACAGACGG - Exonic
916114288 1:161474085-161474107 AGGAGGACAGGGAAGCCTGCAGG + Intergenic
916180269 1:162077633-162077655 AACAGGACATGGAAGGCAGATGG - Intronic
916195155 1:162215575-162215597 CAGAGCTCAGGCCAGGCAGCAGG - Intronic
916628021 1:166580528-166580550 CAGAGGCCAGGGAAGTGGGCTGG + Intergenic
916674441 1:167054127-167054149 CACAGGACAGTGAGGTCAGCAGG + Exonic
916773386 1:167935972-167935994 CAGCGGGCAGGGAAAGCCGCGGG - Exonic
916786798 1:168092429-168092451 CAGAGGAGAGGGATGCCACCTGG - Intronic
917443981 1:175091258-175091280 GAGAGAAAAGGGAAGGCAGGGGG + Intronic
917809518 1:178644413-178644435 CAGAGGCCAAGGAATACAGCTGG + Intergenic
917854964 1:179092380-179092402 TAAAGGACAGGGAAGGCAGGTGG - Intronic
918048250 1:180954052-180954074 CACCGGCCAGGGCAGGCAGCGGG + Intergenic
919797207 1:201328079-201328101 CAGAGCTCAGGGCTGGCAGCAGG + Intronic
919973056 1:202593098-202593120 CAGAGGAAAGGGAAGGGAAGGGG + Exonic
920030501 1:203034724-203034746 AGGAGGACAGGGAAGGCCGAGGG + Intronic
920529943 1:206694522-206694544 CAGAAGCCAAGGAAGGCAGTCGG - Intronic
920661086 1:207915067-207915089 CAGAGGACAAGAAAAGCAGGTGG - Intergenic
920882896 1:209896972-209896994 AAGAGGACAGGGAAGGCTTTGGG + Intergenic
921034104 1:211359808-211359830 GAGAGAACAGGGTGGGCAGCTGG - Intronic
921308142 1:213817306-213817328 CAGAGGCCAGAGAAGGAAGGCGG + Intergenic
921667428 1:217889580-217889602 CAGAGGACAGGGACGGTAGGGGG + Intergenic
922031507 1:221804645-221804667 GAGAGAACAGAGAAGGCAGAGGG - Intergenic
922236058 1:223723588-223723610 AAGTGCAGAGGGAAGGCAGCTGG - Intronic
922249634 1:223836818-223836840 CAGAAGAGAGGAAAAGCAGCAGG + Intronic
922875932 1:228939965-228939987 CAGAGGACAGGGAAGGAAAGAGG + Intergenic
923226031 1:231939718-231939740 CAGAGAACAGGGCAGGTAGTAGG - Intronic
923629305 1:235639466-235639488 AGAAGGACAGGGAAGGCATCTGG - Intronic
924002648 1:239571042-239571064 CATCTGGCAGGGAAGGCAGCTGG - Intronic
924173206 1:241362671-241362693 CAGAGTACAGGGAAGGTACATGG - Intergenic
924937839 1:248787385-248787407 CAGTGGCCAGGGATGGCAGTTGG - Intergenic
1062944499 10:1450211-1450233 CAGAGGGCAGGAAAAGAAGCAGG - Intronic
1064000018 10:11655714-11655736 TAGTGGACAGGGAAGGAAGCTGG - Intergenic
1064240628 10:13624800-13624822 CAGATGACAGGGCAGCAAGCTGG - Intronic
1064285161 10:13985338-13985360 CATGGGACAGGGAAGGAGGCTGG + Intronic
1065082272 10:22140313-22140335 CAGAGGAAAGGGAAGAGTGCAGG + Intergenic
1065917405 10:30365120-30365142 GAGAGGCCAGGGAAGGCAGGGGG - Intronic
1066451406 10:35533422-35533444 CTGAGGAGAGTGGAGGCAGCTGG - Intronic
1067077858 10:43198280-43198302 CAGCAGACAGAGAAGGCACCTGG + Intronic
1067692412 10:48510305-48510327 CAGACATCAGGGCAGGCAGCAGG + Intronic
1067820082 10:49520764-49520786 CTGAGGACAGGGAGGGCAGGTGG - Intronic
1069632308 10:69904427-69904449 GAGAGGCCAGGGAAGGCTGCTGG - Intronic
1069635434 10:69922039-69922061 CAGACTGCAGGAAAGGCAGCTGG + Intronic
1069787515 10:70998185-70998207 CAGAGGAAAGGGAAAGCATGTGG + Intergenic
1069852801 10:71421258-71421280 CAGAGGGCTGGGCAGGGAGCAGG - Intronic
1070409394 10:76125603-76125625 CAGAGTACAGTGAAGGTAGGGGG + Intronic
1070727164 10:78800295-78800317 CCCAGCACAGGGATGGCAGCAGG + Intergenic
1071780719 10:88841308-88841330 CAGAGAAGAGAGAAGGCAGTAGG + Intronic
1073426571 10:103458808-103458830 CAGTGGGCAGGGTGGGCAGCAGG - Exonic
1073580679 10:104663079-104663101 CAGAGTGAAAGGAAGGCAGCCGG - Intronic
1073591802 10:104764997-104765019 CAGAGGTCAGGGAAGGTGGTGGG + Intronic
1074473933 10:113752705-113752727 GAGAGGACAGATAAGGCAGTAGG - Intronic
1074777890 10:116779551-116779573 CAGGAGACAGGGAAGGTTGCAGG + Intergenic
1074979843 10:118610651-118610673 CACAGGACAGGAGAGGCATCAGG - Intergenic
1075061291 10:119258775-119258797 GAGAGGAAAAGGAAGGTAGCTGG + Intronic
1075129444 10:119725911-119725933 CGGAGGAAAGGGCAGGAAGCGGG + Intergenic
1075177732 10:120181534-120181556 CATGGGAGAGGGAAGGCAACAGG - Intergenic
1075211298 10:120493567-120493589 CCCAGGGCATGGAAGGCAGCGGG - Intronic
1075252941 10:120898578-120898600 CACAGGTCAGGGGAGGCAGCTGG + Intronic
1075472579 10:122703994-122704016 CAGAGCCCAGGGATGGCTGCAGG - Intergenic
1075598360 10:123748846-123748868 GAGAGGACAGGGAGGGCACGTGG - Intronic
1075797490 10:125131078-125131100 GAGATGGCAGGGAAGGCAGGAGG + Intronic
1075871544 10:125775005-125775027 CAGAGGCCAGGGCAGGGAGCAGG - Intronic
1075912169 10:126133907-126133929 TGGAGGACAGGAAAGGCAACAGG - Intronic
1076380640 10:130022638-130022660 CAGAGGACAGGGCAGGGCCCAGG - Intergenic
1076812923 10:132898565-132898587 CAGAGGGCAGGGCAGGGGGCGGG - Intronic
1076850488 10:133090087-133090109 CAGAGGACAGTGAACGGAGAAGG + Intronic
1076980914 11:204278-204300 CAGTGGACAGGGAAGGCCCAGGG + Exonic
1077082193 11:729092-729114 CAGAGGTCCGAGCAGGCAGCTGG - Intergenic
1077185774 11:1234750-1234772 CAGCGGGCAGGGAGGGCAGGGGG + Intronic
1077991738 11:7418170-7418192 CCCAGGACTGGGAAGGCAGAGGG + Intronic
1078103999 11:8346987-8347009 CAGATGACTGGGAAGGGAGTAGG + Intergenic
1078196835 11:9143577-9143599 CATAGGAGAGGCAGGGCAGCTGG + Intronic
1078202875 11:9199728-9199750 CAGAGGGCAGGACATGCAGCAGG + Intronic
1078241408 11:9534013-9534035 CAGAGGAAAGGGCAAGCAGGAGG - Intergenic
1078323369 11:10357345-10357367 CAGAGGAAAGAGAAGACAGAAGG + Intronic
1079449700 11:20589296-20589318 CAGGGGACAGGGAAGCTAGAAGG - Intergenic
1079811578 11:25004332-25004354 CAGAGGACAGAAAATGGAGCAGG - Intronic
1079832470 11:25285913-25285935 CAGAGGCCAGGAAAGGTAGGGGG - Intergenic
1080587504 11:33695093-33695115 CAGAGGGCAGTGAAGGGCGCAGG - Intergenic
1081206720 11:40284108-40284130 CAGAGGACAGGGAGATCAGTGGG + Intronic
1081653274 11:44839788-44839810 CAGAGGACAGAGAAGGCCAGTGG + Intronic
1081739534 11:45428614-45428636 CAGAGGTCAGGGAGGGTTGCCGG - Intergenic
1081859687 11:46325734-46325756 GGGAGGTGAGGGAAGGCAGCCGG + Intergenic
1082996148 11:59257136-59257158 GAGATGGCAGGGAGGGCAGCTGG - Intergenic
1083228498 11:61300068-61300090 GAGAGGAGGGGGAGGGCAGCAGG + Exonic
1083520483 11:63306247-63306269 CAGAGGCTAGGGAAGGAAGAAGG - Intronic
1083560765 11:63671372-63671394 CAGAGGAGAGGGACGGGTGCGGG + Exonic
1083775668 11:64893361-64893383 CCTAGGACAGGGAGGGCGGCAGG + Intergenic
1083871070 11:65488921-65488943 CACTGGGCAGGGAAGGCTGCAGG + Intergenic
1083972017 11:66084053-66084075 CTGGGGACAGGGTGGGCAGCAGG + Intronic
1084064178 11:66693893-66693915 CAGAGGGCAAGGCAAGCAGCAGG + Intronic
1084118142 11:67053824-67053846 CAGAGGACAGGGGATGCACGCGG + Intergenic
1084125348 11:67095558-67095580 CAGGGGACAGGGCAGGGAGAGGG - Intergenic
1084695036 11:70747973-70747995 AAGAGGAGAGGGAAGGAGGCAGG + Intronic
1084733053 11:71086974-71086996 CAGAGGGCAGTGAACGCACCTGG + Intronic
1084953202 11:72678014-72678036 CAGGGGAGGGGGAAGGAAGCAGG - Intergenic
1085229487 11:74952611-74952633 CAAAGGACAGGGAACAGAGCTGG - Intronic
1085265642 11:75236435-75236457 CAGAGGGATGGGAAGGCAGCAGG + Intergenic
1086180298 11:83943061-83943083 CAGAAGGCAAGGATGGCAGCAGG - Intronic
1087407951 11:97752786-97752808 GAGAGGCCAGGGATGGGAGCAGG + Intergenic
1087601318 11:100319447-100319469 CAGAAAAAAGGGAAGTCAGCTGG - Intronic
1088120385 11:106362143-106362165 CAGAGGACAGGGAAAGTGTCTGG + Intergenic
1088735186 11:112722987-112723009 CAGAGAACAGAGACGGGAGCAGG + Intergenic
1088756528 11:112889834-112889856 CAGAGGATGGGGAGGGCAGCAGG - Intergenic
1089002033 11:115060106-115060128 GAGAGGTCAGGGAAGGCAGAGGG - Intergenic
1089154443 11:116390165-116390187 CACATGACAGGGAAGGCCTCAGG + Intergenic
1089169586 11:116502822-116502844 TAGAGCCCAGGGAAGCCAGCTGG - Intergenic
1089297310 11:117477887-117477909 CAGAGCACTGAGAAGGCAGCCGG - Intronic
1089588516 11:119525000-119525022 CAGTGTGGAGGGAAGGCAGCTGG - Intergenic
1089742105 11:120591566-120591588 CAGAGGAGGCAGAAGGCAGCTGG - Intronic
1089847056 11:121466654-121466676 CGCAGGACAGGGGAGCCAGCAGG - Intronic
1091698397 12:2643311-2643333 CAAAGGGCAGGGAACGCACCAGG - Intronic
1091778975 12:3201925-3201947 CAGTGGACCGGGCAGGGAGCTGG + Intronic
1091792563 12:3280256-3280278 AGGAAGGCAGGGAAGGCAGCTGG - Intronic
1092016931 12:5167368-5167390 CAGAGGACTGCTAAGGCCGCAGG - Intergenic
1092168783 12:6360335-6360357 CAGAGCAAAGGGAGGGCATCGGG + Intronic
1092860643 12:12716957-12716979 CAGAGGACCGCGAAGGTCGCCGG - Intronic
1093213563 12:16336129-16336151 CAGAGGACAGGTATGGCAATGGG + Intergenic
1094320098 12:29173916-29173938 AAGAGGACAGGCAAGGGTGCAGG - Intronic
1094799018 12:34008624-34008646 CACAGGCCAAGGAAGGCAGGAGG - Intergenic
1095111766 12:38302732-38302754 CACAGGCCAAGGAAGGCAGGAGG - Intergenic
1095954022 12:47796329-47796351 CAGAGGCCAGGGTGGGCAGGAGG + Intronic
1095955434 12:47803111-47803133 CAGGGGACATGGAGGCCAGCTGG + Intronic
1095960585 12:47832293-47832315 CAGAGGACAGGGCTGACTGCAGG + Intronic
1096031436 12:48419206-48419228 CAAAGACCAGAGAAGGCAGCAGG + Intergenic
1096077737 12:48815533-48815555 CAGGGGAGAGGGAAGGGAGCAGG + Intronic
1096190801 12:49617303-49617325 CGGAGGCCAGGGCAGGCAGACGG + Intronic
1096281789 12:50261582-50261604 GAGGGGTCAGGGAAGGCATCTGG - Intronic
1096557243 12:52410920-52410942 CAGAGGAGTGGGAGGGAAGCAGG - Intergenic
1096678953 12:53242170-53242192 GGGAGGACAGGCAGGGCAGCGGG - Intergenic
1096684862 12:53281566-53281588 CACAGGTCAGGGAAAGGAGCAGG - Exonic
1096835890 12:54351050-54351072 CAGAGGACAGGGCAGTAAGAAGG - Exonic
1097250499 12:57630054-57630076 CAGAGGGCATGGGAGGCATCTGG - Intronic
1097281980 12:57850627-57850649 CAGAGGAAAGGGGATACAGCAGG - Intergenic
1097895880 12:64824674-64824696 CCGAGCGCAGGGAAGCCAGCAGG - Exonic
1098634042 12:72758377-72758399 CTGAGGACAGGGATGCCAGGTGG - Intergenic
1099151602 12:79121152-79121174 CAGAGGAGAAGGAAGACAGAAGG - Intronic
1099893673 12:88619044-88619066 CAGAGGAGAAGGAAGGGAGGAGG + Intergenic
1099940759 12:89185255-89185277 CATAGGACACGGAAGGTAGTGGG + Intergenic
1100092235 12:90985580-90985602 CAGAGGACAGAAAATGGAGCAGG + Intronic
1100211121 12:92399579-92399601 CAGAGAACAGGGGAGTCAGACGG - Intergenic
1100228256 12:92580794-92580816 CAGTGGCCTGGAAAGGCAGCAGG - Intergenic
1100754120 12:97731553-97731575 CAGAGAAGAGGAAAGGCTGCAGG + Intergenic
1101029152 12:100643092-100643114 CAGAAGACAGCAAAGGCATCAGG - Intergenic
1101332066 12:103765219-103765241 CAGACAACAGGGAAGGCATGGGG - Intronic
1101649143 12:106659040-106659062 CAGGGGTCAGGGAAGGAAGTGGG - Intronic
1101801886 12:108029502-108029524 AAGTGGACAGGGAAGGCGGAGGG + Intergenic
1102142617 12:110628022-110628044 CAGAAGAGAGAGAAGGAAGCAGG - Intronic
1102819340 12:115894685-115894707 CAGAGCAAGGGGGAGGCAGCAGG + Intergenic
1102908718 12:116696611-116696633 CAGGGGTCAGGGAAGGCCTCCGG + Intergenic
1102923890 12:116812348-116812370 CAGAGGACGGGGATGGCAGAGGG + Intronic
1103200512 12:119084213-119084235 GAGAGGAGAGGGAAGAGAGCAGG + Intronic
1103235026 12:119364963-119364985 CAGTGGACATGGAAGGCAGTTGG + Intronic
1103614475 12:122143342-122143364 CAGACAAGAGGGCAGGCAGCTGG - Exonic
1103739002 12:123078691-123078713 CAGAGGAGAAGGGAGGCTGCTGG + Intronic
1103804313 12:123560498-123560520 GACAGGACAGGTAAGGCAGGTGG - Intergenic
1104493742 12:129217499-129217521 CACAGGGCAGGGAAGGCTGGAGG - Intronic
1104704383 12:130932482-130932504 CAGGGGACAAGGAGGGGAGCAGG - Intergenic
1104785377 12:131445032-131445054 CAAAGGACAGGGGAGGACGCGGG + Intergenic
1104903722 12:132202723-132202745 CAGTGGCCAGGGAAGGAAGGGGG + Intronic
1105241206 13:18610653-18610675 CAGAGGAGAGGCAAGGCCGGTGG + Intergenic
1105844523 13:24282625-24282647 CTGGGGCCAGGGAAGCCAGCTGG - Intronic
1105889045 13:24668978-24669000 CAGAGGACAATGAGGCCAGCAGG - Intergenic
1106124604 13:26890026-26890048 AGGGGGACAGGGAAGGAAGCTGG + Intergenic
1106125183 13:26895453-26895475 CAGAGGGGAAGGAAGGCTGCCGG - Intergenic
1106512601 13:30424183-30424205 CAGAGGTGGGGGAAGACAGCTGG - Intergenic
1106605513 13:31225020-31225042 CAGTGCTCAGGAAAGGCAGCAGG - Intronic
1106987978 13:35378235-35378257 CAGAGGCCAGGCCAGCCAGCTGG - Intronic
1106990198 13:35409729-35409751 CAGGGGAAAAGGAAGGCAGAAGG + Intronic
1108456315 13:50617495-50617517 GAGAGGGCAGGGAAGTGAGCTGG - Intronic
1108594560 13:51938201-51938223 CCCAGGACAGAGCAGGCAGCAGG - Intronic
1109542293 13:63794952-63794974 CAAAGCACATGGAAGTCAGCTGG - Intergenic
1109679997 13:65739025-65739047 CAGAGATCAGGGAGGGTAGCAGG + Intergenic
1111884854 13:94007333-94007355 CAGTGAACAGTGAAGACAGCAGG + Intronic
1111954671 13:94743222-94743244 TAGAGGAAAGGGAGGGCTGCAGG - Intergenic
1112108444 13:96267785-96267807 GAGAGGACAGGGAAGTAGGCAGG + Intronic
1112274712 13:98005643-98005665 CAGATGCAAGAGAAGGCAGCAGG + Intronic
1112305790 13:98272482-98272504 CAAAGGACAAGGAAGTCAGAGGG - Intronic
1112350183 13:98626441-98626463 GAGAGGAGAGGGAAGGAAGCTGG + Intergenic
1112350544 13:98629862-98629884 CAGAAGACAAGTCAGGCAGCTGG - Intergenic
1113710816 13:112464091-112464113 GAGAGGGCATGGAAGCCAGCTGG + Intergenic
1113839375 13:113350099-113350121 CCGAGGGCAGGGCAGGCATCTGG - Intronic
1113891829 13:113740005-113740027 GAGAGCCCAGGGAGGGCAGCAGG - Intergenic
1114516456 14:23302738-23302760 CAGAGGAGAGGCAAAGCAACGGG - Exonic
1114537447 14:23432028-23432050 CAGAGGTCAGGGCTGGCACCAGG + Intronic
1114696424 14:24631328-24631350 CAGAGGGCAGGGCAGGCCGCTGG + Intronic
1115620117 14:35132830-35132852 CAAAGGAAAGGGAAGGAAGAAGG + Intronic
1115961300 14:38837875-38837897 CAGAGGTCTGGGGACGCAGCCGG + Intergenic
1117034705 14:51716026-51716048 CAAAGGAGAGGGAAGTCAGCTGG + Intronic
1117148203 14:52856454-52856476 AAGATCACTGGGAAGGCAGCGGG + Intergenic
1118345926 14:64940837-64940859 AATAGGACAGGGATGGCAGTGGG - Intronic
1118550051 14:66940208-66940230 GAGAGGACAGGGAAGGAAAAAGG + Intronic
1118599826 14:67464299-67464321 CACAGGCCAGGGGAGGCTGCAGG - Intronic
1119458927 14:74781816-74781838 CAGAAGACAGGGAAGGTGGGGGG - Exonic
1119777778 14:77259134-77259156 CAGAGGAGTGGGATGGCAGTAGG - Exonic
1119785978 14:77314670-77314692 CAGAGGACAGGGCAGTAACCAGG - Intronic
1120228940 14:81821978-81822000 CAGAAAACAGGGAGGGCAGAGGG + Intergenic
1121010348 14:90516729-90516751 GATAGGCCAGAGAAGGCAGCTGG + Intergenic
1121243738 14:92448136-92448158 CAGAGGTCAGTGCAGGCGGCTGG + Intronic
1121390000 14:93565708-93565730 CAGACGACAGGGAAGTCCACAGG + Intronic
1121916006 14:97837424-97837446 GAGTGGAGAGGGAGGGCAGCAGG + Intergenic
1122053922 14:99079413-99079435 CAGGGTTCAGGGAAGGCAGGAGG + Intergenic
1122289614 14:100673279-100673301 CAGAGGGCTGGCAGGGCAGCCGG - Intergenic
1122857805 14:104568183-104568205 AAAAGGACAGGGCACGCAGCCGG + Intronic
1122877754 14:104676758-104676780 CAGGGGGCAGGGAAGGTAGCCGG - Intergenic
1123056167 14:105571767-105571789 CAGAGAACAGGACAGCCAGCAGG + Intergenic
1123056176 14:105571797-105571819 CCGAGGACAGGGATGGATGCTGG + Intergenic
1123057756 14:105580008-105580030 CCGAGGACAGGGATGGACGCTGG - Intergenic
1123057765 14:105580038-105580060 CAGAGAACAGGACAGCCAGCAGG - Intergenic
1123080599 14:105691897-105691919 CAGAGAACAGGACAGCCAGCAGG + Intergenic
1123080607 14:105691927-105691949 CTGAGGACAGGGATGGACGCTGG + Intergenic
1123082038 14:105699941-105699963 CCGAGGACAGGGATGGACGCTGG - Intergenic
1123082047 14:105699971-105699993 CAGAGAACAGGAGAGCCAGCAGG - Intergenic
1123122632 14:105925059-105925081 CAGATGGCAGGGTAGGCAGGTGG + Intronic
1123223451 14:106878032-106878054 CTGAGCACACAGAAGGCAGCAGG + Intergenic
1123457480 15:20439167-20439189 CAGGGCACAGGGAAGGGAGACGG + Intergenic
1123457518 15:20439353-20439375 CAGGGTACAGGGAAGGGAGACGG + Intergenic
1123457545 15:20439477-20439499 CAGGGTACAGGGAAGGGAGACGG + Intergenic
1123514608 15:21023133-21023155 CAGATGGCAGGGTAGGCAGGTGG + Intergenic
1123660526 15:22560944-22560966 CAGGGTACAGGGAAGGGAGACGG - Intergenic
1123660553 15:22561068-22561090 CAGGGTACAGGGAAGGGAGACGG - Intergenic
1123660578 15:22561192-22561214 CAGGGCACAGGGAAGGGAGACGG - Intergenic
1124061109 15:26294330-26294352 CAGGCGACAGGCAAGGCAGTAGG + Intergenic
1124263638 15:28214378-28214400 CAGGGCACAGGGAAGGGAGACGG + Intronic
1124263650 15:28214440-28214462 CAGGGCACAGGGAAGGGAGACGG + Intronic
1124263662 15:28214502-28214524 CAGGGCACAGGGAAGGGAGACGG + Intronic
1124263689 15:28214624-28214646 CAGGGCACAGGGAAGGTAGACGG + Intronic
1124358805 15:29019115-29019137 CAGAGGACAGGTCATGCTGCAGG + Intronic
1124702789 15:31931317-31931339 CACAGCACAGGGAAGGAAACAGG - Intergenic
1125775103 15:42205561-42205583 CAGAAGACAGGGAAGAAATCAGG + Intronic
1126820904 15:52503013-52503035 CAGAGGCCAGGCAAGGTAGCAGG + Intronic
1126919712 15:53507530-53507552 CAGAGGACAGGGAAGGCAGATGG - Intergenic
1127065100 15:55229181-55229203 GAGAAGACAGGGAAGACAGAAGG - Intronic
1127487158 15:59429897-59429919 CTGAGAACAGGGCAGGCAGGTGG + Intronic
1127531339 15:59846355-59846377 AAGAGGACAGGGCAGCCAGCAGG - Intergenic
1127532007 15:59852579-59852601 CAGAGCACAACCAAGGCAGCAGG + Intergenic
1127556078 15:60088982-60089004 GAGAGGAGAAGGAAGGGAGCAGG + Intergenic
1127992959 15:64134172-64134194 CAGACTACTGGGAAAGCAGCAGG - Intronic
1128083466 15:64870467-64870489 CAGAGGAGGAGGAAGGGAGCTGG - Intronic
1128223193 15:65982891-65982913 CAGAGGAGAGGGGTGGCAGATGG - Intronic
1128813031 15:70585814-70585836 CAGAGTTCAGGGGAGGCTGCGGG - Intergenic
1129185826 15:73905875-73905897 CAGAGGCCAGGGAAGGGCCCTGG - Intergenic
1129194380 15:73955445-73955467 AAGAGGACAGGGAGGGATGCTGG - Intergenic
1129224150 15:74156684-74156706 CAGGAGACAGAGAAGGAAGCTGG + Intergenic
1129264241 15:74385506-74385528 CAGGGGCCAGGAAAGGCAGGAGG - Intergenic
1129463337 15:75710763-75710785 CAGAAATCAGGGCAGGCAGCTGG + Intronic
1129721550 15:77880639-77880661 CAGAAATCAGGGCAGGCAGCTGG - Intergenic
1129761208 15:78130359-78130381 CAGAGGGCAGGGAAGGGACCTGG + Intronic
1130628684 15:85542781-85542803 AAGAGGACAGTGAAGAGAGCCGG + Intronic
1130970199 15:88726377-88726399 CAGAGGAGGGTGAGGGCAGCGGG + Intergenic
1131025540 15:89138192-89138214 CACAGGAAAGGTAAGGAAGCCGG - Intronic
1131032722 15:89199943-89199965 CAGAGGGGAAGGAAGGAAGCAGG - Exonic
1131111014 15:89765572-89765594 AAGAGGAAAGGGAAGGGAGGAGG + Intronic
1131220248 15:90577858-90577880 CAGAGGCCAGGAAAGGGAGAGGG + Intronic
1131411045 15:92208641-92208663 AAGAGGACAGGCAAGGGTGCAGG + Intergenic
1132115543 15:99132908-99132930 CAGAGAACAGGGCAAGGAGCAGG + Exonic
1132333766 15:101030208-101030230 CAGAGGACAGGAGAGGTACCTGG - Intronic
1132399813 15:101498389-101498411 TAGAGGGCAGGCAGGGCAGCAGG + Intronic
1132688485 16:1172049-1172071 CAGAGTTCAGTGAAGGCTGCTGG - Intronic
1132881518 16:2163673-2163695 CAGAGGCCCGGGCAGGCAGGCGG - Intronic
1132981287 16:2739785-2739807 CTGAGACCAGGGAAGGCAGCCGG + Intergenic
1133056647 16:3148792-3148814 AAGAGAACAGGGCAGGGAGCAGG - Intronic
1133544831 16:6795869-6795891 AAAAGGAAAGGGAAGGCAGGGGG - Intronic
1134030771 16:10990605-10990627 CAGTGGGCAGGGATGGGAGCAGG + Intronic
1134086873 16:11363312-11363334 GAGAGTACAAGGCAGGCAGCTGG + Intronic
1134367380 16:13591889-13591911 CATAGGACAGGGTATGCAGGCGG - Intergenic
1134667290 16:16028094-16028116 CAAAGGAAAAGGAAGGCGGCAGG - Intronic
1135588371 16:23688569-23688591 CAGGGAACAGGGAAGCCTGCTGG - Intronic
1135684820 16:24490424-24490446 GGGAGGACAGGGAGTGCAGCTGG - Intergenic
1136776995 16:32877322-32877344 CTGGGGACTGGGAAGGGAGCAGG - Intergenic
1136893621 16:33984191-33984213 CTGGGGACTGGGAAGGGAGCAGG + Intergenic
1137442024 16:48505955-48505977 GAGAGCACAGGGAAGGTAGGAGG + Intergenic
1137930748 16:52585002-52585024 AAGAGGACAAGTAGGGCAGCAGG - Intergenic
1138361090 16:56427787-56427809 GAGAGGACTGGGAAGGAGGCAGG + Intergenic
1138609266 16:58110086-58110108 AAGAGGACAGGGATGGCATATGG + Intergenic
1139267801 16:65656411-65656433 CAGGGGACAGTGAAGGCAAGGGG - Intergenic
1139547914 16:67658285-67658307 CCAAGGACAGGGCAGGCAGAAGG + Exonic
1139667423 16:68467476-68467498 AAGAGGTCAGAGGAGGCAGCTGG - Intergenic
1139915369 16:70424989-70425011 CAGGGCACAGAGATGGCAGCTGG + Intronic
1140221446 16:73047528-73047550 CAGAGGGAAGGGAAGGAAGGAGG + Intronic
1140458669 16:75120371-75120393 AAGAGAACAGAGAAGGCACCAGG + Intergenic
1140649425 16:77070839-77070861 GAGAGGAGAGGGAATGCAGAAGG + Intergenic
1140798575 16:78464009-78464031 CCTAGGACAGGCAAGGCAGTGGG + Intronic
1141136359 16:81468192-81468214 CAGAGGGCTGGGGAGGCAGAAGG + Intronic
1141215720 16:82021268-82021290 CAGAAGACAGGAAAGGTAGAGGG + Intergenic
1141286346 16:82676010-82676032 CAAAGGACAGGGAAGAAAGGAGG + Intronic
1141374370 16:83516729-83516751 ATGATGACAGGGGAGGCAGCTGG - Intronic
1141704253 16:85655943-85655965 CAAGGGACAGGGAGGGCAGAGGG - Intronic
1141873475 16:86805782-86805804 CAGAGGCCAGGGTTGGCAGGCGG + Intergenic
1142304403 16:89277608-89277630 CAGAAGACAGAGACGGCAGTTGG - Intronic
1142376284 16:89708646-89708668 CAGAGGCACCGGAAGGCAGCTGG + Intronic
1203079412 16_KI270728v1_random:1139431-1139453 CTGGGGACTGGGAAGGGAGCAGG - Intergenic
1142607610 17:1090766-1090788 CAGAGAACAGGGCAGGAAGGAGG + Intronic
1142757156 17:2023402-2023424 CATACCACAGCGAAGGCAGCCGG + Intronic
1143181852 17:4988269-4988291 CAGAGGATGGGAAAGGCAGTTGG + Exonic
1143321002 17:6069154-6069176 CTGAGGACAGCAGAGGCAGCAGG - Exonic
1143455303 17:7063880-7063902 CAGAAGGCAGGGATGACAGCTGG + Intergenic
1143586127 17:7851422-7851444 CAGAGGGAGGGGAAGGAAGCAGG - Intronic
1143772014 17:9174950-9174972 TAGAGGACAGGAAAGCCAGCTGG - Intronic
1143794586 17:9326416-9326438 TAGAAAACAGGGAAGGAAGCTGG - Intronic
1144029036 17:11303660-11303682 CAGAGGACAAGGGAGCCATCAGG + Intronic
1144779229 17:17799577-17799599 CAGGGGCCAGAGAAGGCTGCAGG - Intronic
1144839331 17:18175943-18175965 GAGAGGACAGTGAGGGCAGAGGG - Intronic
1145065651 17:19759740-19759762 CAGGGGGCAGGGAGGGCAGAGGG - Intergenic
1145274152 17:21420123-21420145 CAGAAGGAAGGGAAGGCAGGAGG - Intergenic
1145312014 17:21706022-21706044 CAGAAGGAAGGGAAGGCAGGAGG - Intergenic
1146178097 17:30679567-30679589 GGGAGGACAGAGAAGGCAGGAGG + Intergenic
1146432617 17:32811919-32811941 CTGAGGAAATGGAAGGCACCTGG + Intronic
1147168313 17:38604837-38604859 GAGAAGATAGGGAAGGCAGGCGG - Intronic
1147309566 17:39587075-39587097 CAGGAGAGAGGGAAGGCAGTGGG + Intergenic
1147437795 17:40428351-40428373 GAGAGGGCAGGGGAGGCATCTGG + Intergenic
1147511764 17:41075713-41075735 CTGAAGGCAGGGTAGGCAGCAGG + Intergenic
1147598975 17:41734255-41734277 CGGGGGACTGGAAAGGCAGCGGG - Exonic
1147606452 17:41776418-41776440 CAGAGGAGGCGGAAGCCAGCTGG + Intronic
1147719796 17:42532059-42532081 CACAGGACAGCGGCGGCAGCAGG + Intergenic
1147819890 17:43235161-43235183 CAGAGGGCAGGGGTGGCTGCCGG + Intergenic
1147821202 17:43242559-43242581 CAGAGGGCAGGGGTGGCTGCCGG + Intergenic
1147822006 17:43247048-43247070 CAGAGGGCAGGGGTGGCTGCCGG + Intergenic
1147825610 17:43268007-43268029 CAGAGGGCAGGGGTGGCTGCCGG + Intergenic
1147826741 17:43274474-43274496 CAGAGGGCAGGGGTGGCTGCCGG + Intergenic
1147827630 17:43279352-43279374 CAGAGGGCAGGGGTGGCTGCCGG + Intergenic
1147828737 17:43285513-43285535 CAGAGGGCAGGGGTGGCTGCCGG + Intergenic
1147830925 17:43297786-43297808 CAGAGGGCAGGGGTGGCTGCCGG + Intergenic
1147831624 17:43301415-43301437 CAGAGGGCAGGGGTGGCTGCCGG + Intergenic
1148063281 17:44851070-44851092 CAGAGGCCACAGAAGGAAGCAGG + Exonic
1148125211 17:45233194-45233216 CCGAGAACAGGGAAGGCTGGTGG - Intronic
1148150027 17:45391440-45391462 CAGGGGAAAGGGAAGGAGGCAGG + Intergenic
1148152946 17:45406976-45406998 CAAAGGAGAGTGAGGGCAGCTGG + Intronic
1148454926 17:47806086-47806108 CAGCGGGGAGGAAAGGCAGCTGG + Intergenic
1148559422 17:48597446-48597468 TCCAGGACAGGGAAGGGAGCAGG - Intronic
1148714422 17:49705711-49705733 CAGATGACAGGATGGGCAGCAGG + Intronic
1148741046 17:49892879-49892901 CACAGCACAGGGAAGGGGGCAGG + Intergenic
1148741717 17:49897043-49897065 GAGAAGGCAGGGAAGGCACCTGG - Intergenic
1148765681 17:50037074-50037096 CAAAGGGCAGGGAAGGCTGAGGG + Intergenic
1149523255 17:57334437-57334459 CTGAGGACTGGCAGGGCAGCTGG + Intronic
1149607508 17:57935581-57935603 GGGAGGAAAGGGAGGGCAGCGGG - Intronic
1150002907 17:61452443-61452465 CCGAGGGCACGGCAGGCAGCTGG + Intronic
1150008709 17:61486069-61486091 CAGGGGACAGGGAAGTGAGAGGG + Intergenic
1150024530 17:61658938-61658960 CAGAAGATAGGGAAGGGAGAAGG - Intergenic
1150228028 17:63534332-63534354 CAGAGGACAGCCATGGCTGCTGG - Intronic
1150834467 17:68552029-68552051 AAGAGGAAAGCGAAGTCAGCTGG - Intronic
1151151182 17:72088730-72088752 AAGAAGACAGGGAAGGAAGGTGG - Intergenic
1151210994 17:72543593-72543615 CAGGGGACATGGAAGGGAGAGGG - Intergenic
1151363788 17:73604369-73604391 CAGGGCACAGGGAAGGGACCTGG + Intronic
1151512471 17:74569763-74569785 TAGAGGAGAGGGAAGGCACCGGG + Intergenic
1151567869 17:74909855-74909877 AGGAGGACAGGGAAGGGTGCAGG + Intergenic
1151826585 17:76527308-76527330 CAGAGGTGAGGGAAGGTGGCAGG + Intergenic
1151926225 17:77199407-77199429 CAGACGACAGGTCAGGCTGCTGG - Intronic
1151978824 17:77497480-77497502 CCGAGGGCAGGGCAGGCAGGTGG - Intronic
1152004236 17:77668206-77668228 CAGAGAACAGTGAACGCACCTGG - Intergenic
1152007473 17:77691610-77691632 GAGATGGCAGGGAGGGCAGCTGG + Intergenic
1152221926 17:79073622-79073644 GGGAGGACAGAGAAGGCAGAGGG - Intergenic
1152296366 17:79469497-79469519 CAGGGGACAGGGACGGCACAGGG - Intronic
1152516825 17:80830164-80830186 CACAGAACAGAGAAGCCAGCGGG - Intronic
1152592041 17:81218460-81218482 CTGCGGACAGGAGAGGCAGCAGG + Intronic
1152693460 17:81732343-81732365 AAGAGAACAGCAAAGGCAGCTGG + Intergenic
1152801563 17:82333261-82333283 CCGAGGACCGGGAAGGGAGGAGG + Intronic
1152821738 17:82441084-82441106 AAGGGGACAGGGAGGGCTGCAGG - Exonic
1153230074 18:2926704-2926726 CAGAGGACAGGGCACCCACCTGG + Exonic
1153335690 18:3922052-3922074 CAGGGAATTGGGAAGGCAGCAGG + Intronic
1154356389 18:13625575-13625597 AAGGGGCCAGAGAAGGCAGCGGG - Intronic
1154412677 18:14149833-14149855 GAGAGGACAGAGACGGCTGCGGG + Intergenic
1154447751 18:14449248-14449270 CAGAGGAGAGGCAAGGCCGGTGG - Intergenic
1155035325 18:22020824-22020846 AAGAGGACAGGAAAGCAAGCAGG + Intergenic
1155436174 18:25815427-25815449 CAGAGAAGAGGGAAGGCTACTGG + Intergenic
1155996121 18:32333107-32333129 GAGATGACAGGGAAGCCAGGAGG + Intronic
1156045441 18:32872155-32872177 CAGAGAAGAGGGAAGGAAACAGG + Intergenic
1156384504 18:36593420-36593442 CAGAGGAGAGGGAAGCAAGGGGG + Intronic
1156402772 18:36755874-36755896 CAGAGGACAGTGAATCCAGTAGG + Intronic
1156804919 18:41166564-41166586 CAGAGGGCCTGGAATGCAGCAGG - Intergenic
1157896557 18:51474495-51474517 CAGAGGCCAGGAAGGGTAGCAGG - Intergenic
1158099970 18:53819575-53819597 AAGAGGTCAGGGAAGGCTTCAGG - Intergenic
1159831163 18:73279636-73279658 CAGAGTGCAGGCGAGGCAGCTGG + Intergenic
1159938459 18:74387214-74387236 CAGAAGAAAGCCAAGGCAGCTGG - Intergenic
1160272873 18:77403665-77403687 CTGAAGACAGGAAAGCCAGCGGG + Intergenic
1160495453 18:79371738-79371760 CAGGGGACACAGAAGACAGCAGG - Intronic
1160660103 19:293963-293985 CAGTGGGCAGGGAAGGCTGAGGG + Intergenic
1160663774 19:313393-313415 CAGGGGCCAGGGAGGGCAGAGGG - Intronic
1160847233 19:1171998-1172020 CAGAGCACAGAAGAGGCAGCAGG - Intronic
1161058311 19:2201420-2201442 AAGAGCACAGGGAAGACAGCAGG - Intronic
1161159726 19:2755157-2755179 CCGGGCACAGGGAAGGCAGCTGG - Exonic
1161347310 19:3774798-3774820 CTGAGGCCAGGGGAGGCACCTGG - Intergenic
1161360941 19:3849332-3849354 AAGAGGACAGTGGAGGCGGCTGG + Intronic
1161483681 19:4523636-4523658 CAGAGCACAGGGACGGGAGTGGG - Exonic
1161747448 19:6069848-6069870 AAGAGGAATGGGGAGGCAGCTGG + Intronic
1161926629 19:7305530-7305552 CAGAGGGCAGAGTAGGCAGCGGG - Intergenic
1162671289 19:12259935-12259957 AAGAGGACAGGGAGGGAAGGTGG - Intronic
1163000482 19:14363700-14363722 CGGGGGACAGGCAGGGCAGCTGG - Intergenic
1163157152 19:15445785-15445807 CGGGGGACAGAGGAGGCAGCGGG + Intronic
1163374447 19:16921781-16921803 CGGATGACAGGGAACACAGCTGG - Intronic
1163374730 19:16923098-16923120 CCGGGGACAGGGAACGGAGCAGG + Intronic
1163469376 19:17487633-17487655 CTGGGGACAGAGAGGGCAGCTGG + Intronic
1163526547 19:17824867-17824889 CTGAGGTCAGGGGAGACAGCTGG + Exonic
1163663857 19:18594163-18594185 CAGGGGAGGGGGAAGACAGCAGG - Intronic
1163697740 19:18772485-18772507 CAGGGGACAGGGATGGCTTCAGG - Intronic
1163835236 19:19569334-19569356 CAGAGGCCAGGCATGGCTGCTGG - Intronic
1164617257 19:29674588-29674610 ACGAGGACAAGGAGGGCAGCAGG + Exonic
1165361297 19:35338477-35338499 CAGGGAACGGGGAAGGCAGATGG + Intronic
1165755086 19:38288322-38288344 CAGGGGACAGCGATGGCAACAGG - Intronic
1166007343 19:39916573-39916595 CTGGGGAAAGGGAAGGCAGAGGG - Intronic
1166326509 19:42054188-42054210 GAGTGGACAGGGGAGGCAGTGGG + Intronic
1166402693 19:42495408-42495430 GAGAGGAAAGGGAAGGGAGAGGG + Intergenic
1166538271 19:43589658-43589680 CAGAGAACAGGACAGGCAACGGG + Exonic
1166762238 19:45232196-45232218 CCAAGGCCAGGTAAGGCAGCAGG - Intronic
1167605158 19:50477903-50477925 CAGAGGACACAGAAGGCCCCAGG - Intronic
1168059701 19:53883888-53883910 CAGAGCTCAGGGAAGGGAGATGG - Intronic
1168167559 19:54561840-54561862 CAGAGGAAAGTGAAAGCAGAGGG + Intergenic
1168307495 19:55443307-55443329 GAGAGGGCAGGGGAGGCAGCTGG + Intergenic
1168567413 19:57436283-57436305 CAAAGGTGAGGGAAGGTAGCTGG + Intronic
924998768 2:387002-387024 CCCAGGACAGAGAAGGGAGCAGG - Intergenic
925283476 2:2701187-2701209 CCGAGGACAGTGAAGGCTGGTGG - Intergenic
925664736 2:6240640-6240662 CGGAGCACAGAGAAGGCAACGGG + Intergenic
925759483 2:7170648-7170670 CAGGGGACAGGGAATGGTGCAGG - Intergenic
926055303 2:9770853-9770875 GAGAGAACAGGGAAGGCGGAGGG - Intergenic
926434939 2:12827993-12828015 CAGAGGAATAGGCAGGCAGCTGG - Intergenic
926684732 2:15690072-15690094 CAGAGGCCAGAGCAAGCAGCAGG + Intergenic
927138226 2:20112816-20112838 GAGAGGACAGGGAGAGCAGCGGG + Intergenic
927141354 2:20133185-20133207 CACAAGACAGGGAGGGCAGCTGG + Intergenic
927147136 2:20173604-20173626 CATAGGACAGGGCAAGCAGCAGG + Intergenic
927386556 2:22540887-22540909 CAGAGAAGAGTGAATGCAGCTGG - Intergenic
927784030 2:25959941-25959963 CAGAGGCCAGGCCAGACAGCAGG - Intronic
928373788 2:30759207-30759229 GAGAGAAGAGGGAAGGCAGGGGG - Intronic
928428621 2:31199957-31199979 CTCAGGACAGGCAAGGCAGTAGG - Intronic
928685623 2:33746060-33746082 CAGAGAACAGGGAAAGCAGAGGG - Intergenic
929424556 2:41830815-41830837 GGGTGGACAGGGAAAGCAGCAGG - Intergenic
929511688 2:42569397-42569419 CAGAAGACTGGGAAGGAGGCAGG - Intronic
929578214 2:43066014-43066036 CTGAGGGCAGGGGAGCCAGCTGG + Intergenic
929581718 2:43085618-43085640 CAGTGGACAGAGATGGGAGCAGG - Intergenic
929619901 2:43343838-43343860 CACAGGACTGGGCACGCAGCAGG + Intronic
930170867 2:48250221-48250243 CAGAGAAAAGGGAGTGCAGCCGG + Intergenic
931994178 2:67824004-67824026 GAGAGGAGAGGGAAGGCATTCGG - Intergenic
932024172 2:68116752-68116774 CAGTCCACAGGGCAGGCAGCTGG - Intergenic
932374558 2:71224112-71224134 CAGAGGACAGAGACAGCAGAGGG + Intronic
932813330 2:74842629-74842651 CAGAGGACAGAGAAGTCAGAAGG + Intronic
932858187 2:75260699-75260721 TGGAGGACAGAGAAGGGAGCAGG + Intergenic
933278171 2:80304400-80304422 CAGAGGGAAAGGAAGGCGGCAGG - Exonic
933352299 2:81169606-81169628 CAGAGGCCAGGAAAGGTAGGAGG - Intergenic
933694736 2:85209438-85209460 CAGACCACAGGAAAAGCAGCAGG - Intronic
933698600 2:85238278-85238300 CCGAAGTCAGGGCAGGCAGCGGG + Intronic
933739823 2:85524694-85524716 CAGAGGGATGGGGAGGCAGCAGG + Intergenic
933767031 2:85716681-85716703 CACAGGACTTGGAAGGCAGAAGG - Intergenic
934121831 2:88847657-88847679 AGAAGGAGAGGGAAGGCAGCAGG + Intergenic
934553755 2:95276946-95276968 CAGAGCACAGGGCAGTCTGCAGG - Intronic
934927949 2:98395009-98395031 AAGGGGACAGAGCAGGCAGCAGG - Intronic
935155385 2:100479663-100479685 AAGAGGAGAGGGATGGAAGCAGG - Intronic
935673381 2:105574121-105574143 CAGAGCAGAGGGAAGGTGGCTGG - Intergenic
935709280 2:105882936-105882958 CAGAGGACAGCAGTGGCAGCAGG - Intronic
936067701 2:109344649-109344671 GAGATGACAGGCAAGGCAGTGGG + Intronic
936459060 2:112698077-112698099 CAGAGGACAGAGAAGGTGGTAGG - Intergenic
937070198 2:119057407-119057429 CTGAGGGCAGGGAAGGCTGGGGG - Intergenic
937395303 2:121530026-121530048 CAGCTGGAAGGGAAGGCAGCGGG + Intronic
937611815 2:123870886-123870908 GAGGTGACAGGGAAGGCAGGAGG - Intergenic
937637376 2:124171188-124171210 CAGAGGACAGGAGAGCCAACAGG - Intronic
937978599 2:127597092-127597114 CAGAGAGCAGGGCAGGGAGCAGG + Intronic
938116188 2:128604243-128604265 CAGAGCCCAAGGAAGGCACCTGG + Intergenic
938712465 2:133987348-133987370 CAGAGGACAGGACAGCAAGCAGG + Intergenic
939087295 2:137736770-137736792 CAGAGGAAAGGGTAGGAAGGGGG + Intergenic
939198077 2:138998260-138998282 CAGAGTACAGGGAAGGAAGCAGG + Intergenic
940497632 2:154453545-154453567 CAGGGGATAGGGAAGGCAGATGG - Exonic
940779778 2:157920377-157920399 CAGAGGCCAGGAAAGGTAGAGGG - Intronic
940907329 2:159180849-159180871 CACAGGGCAGGGGAGGCAGGAGG + Intronic
941063443 2:160874317-160874339 CAGAAGACAGGAAAGGTATCAGG + Intergenic
941201893 2:162521911-162521933 CAGAGGATAGGAAGGGTAGCAGG - Intronic
941861578 2:170286881-170286903 CAGAGGCCAGGAAGGGTAGCAGG - Intronic
942154057 2:173108472-173108494 CAGAGGACAAGGAAGGGGACAGG - Intronic
942333905 2:174859721-174859743 GAGAGGATAGGGAAGTCAGAAGG - Intronic
942543959 2:177043588-177043610 GAGAGGAAAAGGAAGGCAGAAGG - Intergenic
943133829 2:183888402-183888424 CAGAGGACAGAAAATGGAGCAGG + Intergenic
943708079 2:191057170-191057192 CAGAGGCTAGGAAAGGAAGCAGG - Intronic
943976915 2:194493655-194493677 CAGAGAAAAGAGAAGGAAGCTGG + Intergenic
944080482 2:195782798-195782820 CAGAAGACATGGAGGGCAGATGG - Intronic
944303089 2:198146839-198146861 CACAGGACAGGCATGCCAGCTGG - Exonic
944324441 2:198387190-198387212 CAGAGGAAAGGAAAGCCTGCAGG - Intronic
944499153 2:200340528-200340550 CAGAGAACAAAGATGGCAGCTGG - Intronic
944824104 2:203463525-203463547 CAGTGGTTAGGGAAGGCAGTGGG + Intronic
946153150 2:217789673-217789695 CAGAGAGGAGGGAAGGCAGAGGG + Intergenic
946422268 2:219571500-219571522 CAGCGGGCAGGGGAGGCTGCGGG - Intronic
947382583 2:229559627-229559649 CAGAAGAAAGGGAAGGAAGGAGG + Intronic
947669221 2:231926059-231926081 CAGGAGAGAGGGAAGGCAGGCGG - Intronic
948173883 2:235928346-235928368 CACAGGACAGTGCAGGCACCAGG + Intronic
948245062 2:236475132-236475154 CAGAGGACTGGAAGGGCAGGTGG - Intronic
948458011 2:238116258-238116280 AAGAGGGGAGGGAAGGAAGCTGG - Intronic
948585427 2:239016021-239016043 CAGGGGACGGGGGAGGCTGCCGG - Intergenic
948646567 2:239408747-239408769 CAGAGGACAGGAAGGGCAAAAGG + Intergenic
948770841 2:240250638-240250660 CTGAGGACAGAGAAGGCACCTGG + Intergenic
948792093 2:240384387-240384409 CATAGCACAGGGTAGCCAGCAGG - Intergenic
1168831185 20:846059-846081 CAGAGGCCAAGGAAGGAAGGAGG - Exonic
1168856593 20:1013367-1013389 CAGAGGCCAGGGAAGACAGCAGG - Intergenic
1168974199 20:1951919-1951941 CAGTGGTCAGGGAAGGCTTCTGG - Intergenic
1169153238 20:3306955-3306977 CCCAGGACAGGGAAGGGTGCAGG - Intronic
1169164241 20:3408100-3408122 CGGAGAACAGGGAAGCGAGCCGG - Intergenic
1169197734 20:3692520-3692542 CAGAGGACTTGCAGGGCAGCAGG + Exonic
1169554623 20:6736195-6736217 CAGAGGAAAGGGAAGGAACTAGG - Intergenic
1170089234 20:12572108-12572130 CATAAGACAGGGAAAGCAACTGG + Intergenic
1170210230 20:13840302-13840324 TAAATGACAGGGAAGGGAGCGGG + Intergenic
1170237780 20:14126871-14126893 CTGAGGACAGGGAAAGAGGCTGG - Intronic
1170757852 20:19220433-19220455 CAGAGGACAGAGAAAGGAGCAGG + Intronic
1171195910 20:23199175-23199197 CAGAAGACAGGGAGGCCAGAGGG + Intergenic
1171271795 20:23823882-23823904 GAGAAGACAGAGAAGGCTGCAGG - Exonic
1171391021 20:24801883-24801905 CAGAGGACATGGAAGGCCAGGGG + Intergenic
1172116726 20:32577357-32577379 CAGAGGTCAAGGAAGGGCGCTGG - Intronic
1172165077 20:32893957-32893979 CAGACTCCAGGGCAGGCAGCCGG - Intronic
1172306891 20:33887071-33887093 CAGAGAACAGGGAAGGCAGTGGG + Intergenic
1172692930 20:36803079-36803101 CTGAAGACAGGGAAGGGGGCCGG - Exonic
1173499504 20:43542333-43542355 CAGAGGGCAAGGAAAGCACCTGG - Intronic
1173565981 20:44039062-44039084 CAGAGGGCTGGGCAGGCAGCCGG - Intronic
1173827898 20:46058852-46058874 CAGAGCACGGAGAAGGCGGCTGG - Intronic
1173937833 20:46882628-46882650 AAGAGGACACGGAAGCCAGCAGG + Intergenic
1173970344 20:47147680-47147702 CAGAGGACAAGGATTGAAGCAGG + Intronic
1175032309 20:55967990-55968012 CAGTGGCCAAGGAAGGCATCTGG - Intergenic
1175412207 20:58777746-58777768 CCCAGGGCAGGGCAGGCAGCAGG - Intergenic
1175528833 20:59659997-59660019 CTGGGGGCAGGGAAGACAGCTGG - Intronic
1175927006 20:62475930-62475952 CAGCGGGCAGGGAGGGCGGCAGG + Exonic
1175962741 20:62645399-62645421 CAGGGGCCAGAGAAGGCAGCAGG - Intronic
1176120524 20:63452629-63452651 CAGAGGCCTGGGACTGCAGCAGG + Intronic
1176215112 20:63944283-63944305 CAGGGGACAGTGAACGCAGGGGG + Intronic
1176289783 21:5037854-5037876 CAGTGGAGAGGGAAGACAGTGGG - Intronic
1176293513 21:5058793-5058815 CAGGGAAGAGGGAAGGCAGGAGG - Intergenic
1176860329 21:14008422-14008444 GAGAGGACAGAGACGGCTGCGGG - Intergenic
1177135141 21:17299744-17299766 GAGAGGACAGGAAATGGAGCAGG + Intergenic
1177460063 21:21397596-21397618 GAGAGGTCAGGGATGGGAGCAGG + Intronic
1178310534 21:31526268-31526290 CAGGGAAGATGGAAGGCAGCGGG + Intronic
1178490452 21:33047666-33047688 CAGAAGCCAGGGAAGGCTTCAGG + Intergenic
1178941568 21:36911255-36911277 CAGAGGCCAGGGGAGGGGGCAGG - Intronic
1179116058 21:38493801-38493823 CACAGGACAGGGAAGGAAGGAGG - Intronic
1179134586 21:38668442-38668464 CAGAAGCCAGAGAAGGCAGTAGG - Intergenic
1179243697 21:39612569-39612591 CACAGGAGAGGGAAGGCTGTGGG - Intronic
1179275139 21:39885378-39885400 CAGAGCAGAGGGAGGGCAACCGG - Intronic
1179471383 21:41612995-41613017 CAGAGGGCAGGGAAGGAATCTGG - Intergenic
1179471918 21:41616430-41616452 CGGAGGGCTGGGAAGGCAGCTGG - Intergenic
1179493870 21:41759499-41759521 CACAGGCCACGCAAGGCAGCTGG + Intronic
1179568933 21:42266620-42266642 CAGAGGACAGAGATGGGAGGAGG - Intronic
1179607401 21:42525925-42525947 CAGAGGATGGGGATGGTAGCAGG + Intronic
1179863747 21:44204855-44204877 CAGGGAAGAGGGAAGGCAGGAGG + Intergenic
1179867447 21:44225733-44225755 CAGTGGAGAGGGAAGACAGTGGG + Intronic
1180638472 22:17279336-17279358 CAAGGGACAGGGAAGGCAAAGGG - Intergenic
1180785071 22:18542588-18542610 CAGAGGTCAGGGAAGCCAGCAGG - Intergenic
1180939159 22:19645509-19645531 CAGATGCCTGTGAAGGCAGCAGG - Intergenic
1181128654 22:20716621-20716643 CAGAGGTCAGGGAAGCCAGCAGG - Intronic
1181241974 22:21481942-21481964 CAGAGGTCAGGGAAGCCAGCAGG - Intergenic
1181277838 22:21697608-21697630 CAGAGGACAGGGGAAGCTGAAGG + Exonic
1181314832 22:21964362-21964384 CATAGGCCAGGGCAGGCAGCTGG - Intronic
1181319120 22:21991160-21991182 CAGAAGTCAGAGAGGGCAGCTGG - Intergenic
1181436285 22:22913101-22913123 CAGATGAGAAGGAAGGCAGATGG + Intergenic
1181513253 22:23398163-23398185 CAGAGGACGGAGGAGGCAACAGG + Intergenic
1181580349 22:23824707-23824729 GAGGGGACAGGGAAGCCTGCAGG - Intronic
1181597360 22:23925024-23925046 CAAAGGACAAGGAAGTTAGCAGG - Intergenic
1181694178 22:24584811-24584833 CAGAAGACAGGCAGGGCAGGCGG - Intronic
1182261824 22:29078427-29078449 CAGAGGAAAGCCCAGGCAGCAGG + Intronic
1182333910 22:29570502-29570524 CCAAGGACAATGAAGGCAGCTGG - Exonic
1183034449 22:35130630-35130652 CTGAAGACAGGGAATGCAGGTGG + Intergenic
1183248319 22:36710824-36710846 GAGAGGCCAGGGCAGGAAGCAGG + Intergenic
1183270584 22:36860372-36860394 CAGAGGCTGGGGAAGGCTGCAGG + Intergenic
1183353970 22:37348783-37348805 GAGAGGACATGGAGGTCAGCCGG + Intergenic
1183373421 22:37448609-37448631 CAGAGGACAGGGTGGGGTGCTGG + Intergenic
1183751492 22:39723598-39723620 GAGAGGAGAGGGAGGGCAGGAGG - Intergenic
1183784569 22:40021984-40022006 CAGAGGCCTGGGGAGGCACCAGG - Intronic
1183832576 22:40426196-40426218 CAGATGAGTGGGAAGGAAGCGGG - Intronic
1184015526 22:41783078-41783100 CAGAGGACAGGGAAGGTGGGTGG - Intronic
1184091312 22:42294434-42294456 GGGAGGCCAGGGAAGGCTGCTGG + Intronic
1184683568 22:46085827-46085849 GTGGGGACCGGGAAGGCAGCCGG + Intronic
1184769448 22:46589024-46589046 CAGAGGGCTGGGTACGCAGCAGG + Intronic
1184844604 22:47073663-47073685 CAGACCCCAGGGCAGGCAGCAGG + Intronic
1185034067 22:48461669-48461691 CGCAGGACAGGGAAGGATGCGGG + Intergenic
1185146795 22:49141522-49141544 CAGAGACCAGGGAAGGCCTCAGG - Intergenic
1185229352 22:49671166-49671188 CAGATGAAAAGGAAGGCAGGTGG + Intergenic
1185417536 22:50718560-50718582 CACAGTGCAGGGAATGCAGCAGG + Intergenic
949121258 3:387323-387345 CAGAGGGAAGGGAAGGCTGGTGG + Intronic
949396615 3:3621311-3621333 CAGAGGATAGAGAAGGCTGGAGG - Intergenic
949961341 3:9314830-9314852 CAGAGGCCAGGGAGGGGACCTGG + Intronic
950096949 3:10336033-10336055 CAGAGGACATGGGGGGCAGCCGG - Intronic
950131292 3:10548550-10548572 CAGCTGAGAGGGAAGGGAGCTGG - Intronic
950138992 3:10602130-10602152 CAGAGGCCAGGGCAGGAAGTGGG - Intronic
950654341 3:14427467-14427489 CAGAGGCCTGGGAAGGAAGGCGG - Intronic
951701295 3:25499414-25499436 CAGAAGAGAGAAAAGGCAGCAGG + Intronic
951847845 3:27103651-27103673 CAGGGGCAAAGGAAGGCAGCGGG + Intergenic
951990489 3:28671175-28671197 TGGAGGAAAGGGAAGGAAGCGGG - Intergenic
952750166 3:36818396-36818418 AAGAAGTCAGGGAAGGAAGCAGG + Intergenic
952768872 3:36978955-36978977 CAGAGGCCAGGAAAGGTATCAGG - Intergenic
952888109 3:38024285-38024307 CGGGGGAATGGGAAGGCAGCTGG - Intronic
953020338 3:39108989-39109011 CAGGGGATAGGGAAGGGAGCAGG + Intronic
953451262 3:43008375-43008397 CAGAGGACTAGGAAGGAGGCAGG - Intronic
953583847 3:44181701-44181723 CACAGGAAAGAGAAGGCAGGGGG + Intergenic
953879370 3:46683722-46683744 CAGAGGACAGGGTAGGAAGAGGG - Intronic
954110005 3:48428684-48428706 CAGAAAACAGGGCGGGCAGCGGG - Intronic
954414623 3:50387155-50387177 CTCAGCACAGGGAAGGGAGCTGG + Intronic
954456158 3:50600889-50600911 CAGAGGACAGGCCAGGGTGCAGG + Intergenic
954680557 3:52343772-52343794 CAAAGGACAGAGATGCCAGCTGG + Intronic
955044359 3:55346109-55346131 ATGAGGACAGGGACTGCAGCTGG - Intergenic
955055951 3:55456310-55456332 CAGTGAGCAGAGAAGGCAGCTGG - Intergenic
955226225 3:57062492-57062514 CAGAGAAGAGGGAAGGAAGCAGG + Intronic
955378964 3:58421684-58421706 CAGAGGGCAGAGAATGCTGCAGG - Intronic
955407311 3:58633585-58633607 CAGGCTTCAGGGAAGGCAGCCGG - Intergenic
955596317 3:60594604-60594626 GAGAGGAGAGGGAAGGGAGGAGG - Intronic
955650215 3:61186255-61186277 TGGAGTACAGGGCAGGCAGCTGG - Intronic
956789276 3:72668326-72668348 CAGAAGTCAGGGAAGGTACCAGG - Intergenic
957181734 3:76887555-76887577 AAGAGGACGGGGATGGCAGTGGG - Intronic
957228219 3:77476242-77476264 TATAGGACACGGAAGGCAGTTGG + Intronic
958017969 3:87964736-87964758 CAGAGGACTGGAAAGGAAACTGG - Intergenic
959932793 3:112001268-112001290 CAGAGGAGAAGGGAGGCAGGGGG + Intronic
960054765 3:113269266-113269288 CAGTGGACAGACACGGCAGCAGG + Intronic
960519299 3:118636869-118636891 TGGAGCACAGGGAAGGCAGTGGG - Intergenic
960690699 3:120343051-120343073 AAGTGGACAGGGAAGGTAGACGG + Intronic
960988811 3:123297284-123297306 GAGCAGACAGGGAGGGCAGCTGG - Intronic
961061630 3:123833491-123833513 CTGAGGATAGGGAGAGCAGCAGG - Intronic
961074699 3:123971485-123971507 CAGAGGAGAGGAAAGGAAGGTGG - Intronic
961142229 3:124565258-124565280 CAGAGGACAGGGGGGAAAGCAGG - Intronic
961308982 3:125980993-125981015 CAGAGGAGAGGAAAGGAAGGTGG + Intronic
961462786 3:127063226-127063248 GCGAGGACAGGGAAGGAGGCCGG - Intergenic
961657581 3:128451940-128451962 CACAGGACAGTGCAGGGAGCAGG - Intergenic
961787856 3:129358249-129358271 CCTAGGAGATGGAAGGCAGCTGG + Intergenic
962195868 3:133362943-133362965 CAGAGGGCAGGGGACCCAGCCGG + Intronic
962371348 3:134823290-134823312 CAGTGGACAGTGAAGACAGAAGG + Intronic
962405240 3:135094666-135094688 CAGAGAAGAGGGAAAGCAGGAGG - Intronic
962878487 3:139554165-139554187 CAGAGGAAAGGGACTGAAGCTGG - Intergenic
964406360 3:156352826-156352848 CAGGAAACAGGGCAGGCAGCAGG - Intronic
964627574 3:158773842-158773864 AAGAGGAAAAGGAAGACAGCAGG - Intronic
964801866 3:160565843-160565865 GAGAGGCCCGGGAACGCAGCAGG + Intergenic
965529606 3:169757899-169757921 CAGAGGACACGGCAGGGTGCGGG + Intergenic
966102539 3:176289279-176289301 CAGAGGAGAGTAAAGGGAGCAGG + Intergenic
967583476 3:191186941-191186963 AAGAGGACAGGCAAGGGTGCAGG + Intergenic
967869053 3:194214540-194214562 CAGTGCATAGGGAGGGCAGCTGG + Intergenic
967912655 3:194555245-194555267 CAGTGGACAGGGGAGGCACATGG - Intergenic
968048126 3:195635385-195635407 CAGGGGACGGGGGAGGCCGCTGG - Intergenic
968099276 3:195954235-195954257 CAGGGGACGGGGGAGGCCGCTGG + Intergenic
968195112 3:196700039-196700061 CAGTGGACAGAGCAGGCATCAGG - Intronic
968306485 3:197654536-197654558 CAGGGGACGGGGGAGGCCGCTGG + Intergenic
968461827 4:730064-730086 ATGAGGACAGGGAGGGCACCTGG - Intronic
968622506 4:1610284-1610306 CGGGGGCCAGGGGAGGCAGCTGG - Intergenic
968704772 4:2072757-2072779 CAGTGAACAGGGACGGCAGCCGG - Intronic
968717972 4:2175852-2175874 CAGAGGCCAGGGAGGGCAAAGGG - Intronic
968872240 4:3247894-3247916 CAGAGGACAGCAGGGGCAGCGGG + Exonic
968920043 4:3517789-3517811 CAGAGGGCAGTGGCGGCAGCGGG - Intronic
969523714 4:7693519-7693541 CAAAGGACAGTGCAGGGAGCAGG - Intronic
969703204 4:8779025-8779047 CAGAGGTCAGGGAGGGCACGGGG - Intergenic
969710025 4:8837468-8837490 GAGAGGACAGGGCAGGGCGCTGG - Intergenic
969927828 4:10601753-10601775 GAGTGGACAGGAAAGGCAGCTGG - Intronic
969969341 4:11029447-11029469 CAGAGGGTTTGGAAGGCAGCTGG + Intergenic
970005878 4:11410306-11410328 CAGAGGAAAGAGATGGGAGCTGG + Intronic
970456369 4:16227093-16227115 CAGAGGCCAGGGAATGTAACAGG - Intronic
970955393 4:21805063-21805085 CAGAGGGCTGAGAAGGCAGAAGG + Intronic
970979781 4:22082749-22082771 CAGAGGATAGGAAAGGAAGTAGG - Intergenic
973588983 4:52420932-52420954 CAGAAGACAGGGAAGGCAGTAGG + Intergenic
974575848 4:63720320-63720342 CACAGGACTGGGAAGGCCTCAGG - Intergenic
974838794 4:67279331-67279353 GAGAGGACAGAGAATGGAGCAGG - Intergenic
976024208 4:80667497-80667519 CAGAGGACAGGAAAGGTTGAGGG - Intronic
976873255 4:89822295-89822317 CAGAAGACAGTGGAGGGAGCAGG - Exonic
977601354 4:98937014-98937036 CAAAGGACAAGGAAGTTAGCAGG - Intergenic
977699779 4:100008072-100008094 GACAGAACAGGGAAGCCAGCAGG + Intergenic
978232479 4:106417189-106417211 CAGAGGACAGGGAAATAAGGGGG - Intergenic
978383657 4:108157976-108157998 CAGAGGACTGGACAGGGAGCAGG - Intronic
978411778 4:108433927-108433949 CGGAGGAAAAGGAAGGAAGCAGG + Intergenic
980033508 4:127857206-127857228 CCGATGACAGGCAAGGCAGGTGG - Intergenic
981022293 4:140041652-140041674 GAGAGGGCAAGGAAGGCAGGAGG + Intronic
981629411 4:146801096-146801118 CAGAGGACAGGGGAGGGAAGTGG + Intronic
981901124 4:149864968-149864990 CAGAGGCCAGGAAGGGTAGCAGG + Intergenic
982091062 4:151880454-151880476 CAGAGGAAAGGAAAGGAACCGGG - Intergenic
982105417 4:152007879-152007901 CAGAACACAGGAAAGGCGGCAGG - Intergenic
982745451 4:159101511-159101533 CAGAGGATGGGGAAGGCTGTGGG + Intergenic
982746120 4:159104611-159104633 CAGAGGCCACGGAGGGCGGCTGG - Intronic
983010070 4:162536723-162536745 TGGAGGACAGGGAACGCATCTGG - Intergenic
985096406 4:186416933-186416955 CAGGAGACAGAGAAGGAAGCTGG + Intergenic
985580982 5:694998-695020 GAGAGGAGAGGAGAGGCAGCGGG + Intergenic
985595607 5:786330-786352 GAGAGGAGAGGAGAGGCAGCGGG + Intergenic
985639355 5:1056375-1056397 CAGAGGGGAGCGAAGGCAACAGG + Intronic
985743465 5:1633656-1633678 CAGGGGACGGGGGAGGCCGCTGG + Intergenic
985857488 5:2441624-2441646 CTGAGGTCAGGGAGGGCTGCTGG - Intergenic
986133858 5:4956197-4956219 CAAAGGAAAGGGAGGTCAGCCGG + Intergenic
986263241 5:6167374-6167396 AATAGGGGAGGGAAGGCAGCAGG - Intergenic
986588440 5:9343774-9343796 CAAAGGAAAGGGAAGGAAACTGG - Intronic
986638369 5:9847530-9847552 AAGAAGAGAGTGAAGGCAGCAGG + Intergenic
987179162 5:15348276-15348298 CAGAAGACAGGGTAGCCAGTGGG - Intergenic
987447500 5:18038486-18038508 CAGAGGAGAGGGAAGACTGATGG - Intergenic
987524467 5:19030137-19030159 CAGAGGAGAGGGCAGCCAGTGGG - Intergenic
988927978 5:36008359-36008381 CAGAGAAAAAGGAAGGCAGGGGG + Intergenic
989158747 5:38370229-38370251 CAGAGGGAAGGGAAGCTAGCTGG - Intronic
989170799 5:38469060-38469082 GAAAGAACAGGGAAGGCAGCTGG + Intergenic
989272598 5:39550544-39550566 CAGAAGAGAGGGAAGGAAGGAGG + Intergenic
989510864 5:42286515-42286537 GAGAAGACAGAGAAGGAAGCAGG + Intergenic
991935431 5:71794899-71794921 CAGAGGCCAAGGCAGGCGGCTGG + Intergenic
992984357 5:82212294-82212316 CAGAGCACAAGGGAGGGAGCTGG - Intronic
993940920 5:94058041-94058063 CCAAGGACAGGGAAAGCAGCAGG + Intronic
994175650 5:96707954-96707976 GAGTGGCCAGGGAAGGTAGCAGG + Intronic
995717096 5:115091048-115091070 CAGAGGGCAGGCATGGCTGCAGG - Intergenic
996099404 5:119431421-119431443 CAGAAGACAGGCAAGGGTGCAGG - Intergenic
996583412 5:125057121-125057143 CAGAGGCCAGGGAAGGCAAGTGG - Intergenic
997284302 5:132667527-132667549 CAGGGGAGAGGGCAGGCGGCGGG - Intergenic
997591920 5:135079282-135079304 CAGAGGACTGAGAAGTCAGGAGG - Intronic
997976456 5:138444371-138444393 CAGAGTACAGGGCAGGGAGTTGG - Intronic
998133160 5:139661115-139661137 CAGAGGCCTGGGGAAGCAGCAGG + Intronic
998161379 5:139814655-139814677 GTGAGGACAGAGAAGCCAGCAGG + Intronic
998413218 5:141926851-141926873 CAGAGCACAGGGATGGCATTGGG - Intronic
998453029 5:142249496-142249518 CAGCAGACTGGGAAGGCGGCTGG + Intergenic
998500636 5:142629552-142629574 TAGAGGACAAGGAAGTCAGGAGG - Intronic
998585043 5:143418663-143418685 CAGGGGTCAGGGAAGGCTCCTGG + Intronic
999006960 5:147992118-147992140 CTGAGGACAGGGAGGACAGCAGG + Intergenic
999092634 5:148950760-148950782 CAGAGTAGAGGGAAGGAAGGGGG - Intronic
999247207 5:150161548-150161570 CAGAGGCCAGGGAAGGAAAAAGG - Intergenic
999445623 5:151636482-151636504 TAGAGGCCAGGGAAGGCTGGTGG - Intergenic
999641655 5:153678884-153678906 GGAAGGAAAGGGAAGGCAGCAGG - Intronic
999879452 5:155845290-155845312 GAGGTGACATGGAAGGCAGCAGG - Intergenic
1000080917 5:157846027-157846049 CAGAGGAGAGGGAGAGCGGCAGG - Intronic
1000085291 5:157882996-157883018 CAGAGGACAGAAAATGGAGCAGG + Intergenic
1000326333 5:160175445-160175467 GAGAGGTGCGGGAAGGCAGCTGG + Intergenic
1001017500 5:168154607-168154629 CATGGGACAAGGAAGGCAGTAGG - Intronic
1001237626 5:170043446-170043468 CAGAGGAGAGGGAGGGCTGCAGG - Intronic
1001470139 5:172006312-172006334 CCGAGGCCAGGGAAGGCTGGGGG + Intronic
1001732610 5:173971646-173971668 CAGAGGACAGGGAGGGGATTGGG - Intergenic
1001948297 5:175797741-175797763 CAGACGGCAGAGAAGGCAGGGGG + Intronic
1002089614 5:176796783-176796805 CCAAGGACAGGCAATGCAGCTGG - Intergenic
1002310411 5:178310449-178310471 CAGAGGACTGGCGAGGCAGAAGG - Intronic
1002644894 5:180648281-180648303 CAGAGGACAGGAGAGGGGGCAGG - Intronic
1002758478 6:183509-183531 AAGAGGAGCGGGCAGGCAGCTGG + Intergenic
1003427106 6:6004779-6004801 GAGAGGACAGGGAAGGAGCCAGG - Intronic
1003772202 6:9318290-9318312 CAGAGGACAGGCCAGGGAGCAGG - Intergenic
1004533572 6:16477601-16477623 CAGAGGTCAAGGGAGGCAGAAGG - Intronic
1004561819 6:16760073-16760095 CAGGGGGCAGGGAAGGGGGCCGG - Intronic
1004576962 6:16905850-16905872 CACAGAAGAGGGAAGGAAGCTGG - Intergenic
1004961187 6:20790752-20790774 CAGTGGACAGGGGATGCAGGGGG + Intronic
1005345295 6:24883452-24883474 CTGAGGCCAGGGACGGGAGCAGG + Intronic
1005821119 6:29600080-29600102 CAGGGGACATGGAAGCCTGCAGG + Intronic
1006093949 6:31644379-31644401 CAGGGGGCAGGGAGGGCAGCTGG + Intronic
1006598212 6:35208951-35208973 CAGTGGAGAGAGAAGGGAGCAGG + Intergenic
1007355685 6:41314132-41314154 CAGAGAATAGTGAAGGCAACTGG + Intergenic
1007784683 6:44272838-44272860 CAGAGGACAGGAAAGGGGACCGG - Intronic
1007959622 6:45947012-45947034 CTCAGGACAGGGAAGGTAGGTGG + Intronic
1008449391 6:51632628-51632650 CAGAGGACAGGGAAGCAGCCAGG + Exonic
1009385886 6:63083822-63083844 AAGAGGACAGAGAATGGAGCAGG - Intergenic
1009661473 6:66617552-66617574 AAGAAGACAGGCAGGGCAGCAGG + Intergenic
1011381223 6:86744129-86744151 CAAAGGAGAGGGGAGGGAGCAGG + Intergenic
1012720378 6:102735235-102735257 CAGAGGCTAGGAAAGTCAGCAGG + Intergenic
1013020025 6:106205231-106205253 CAGTGGAAAAGGAAGACAGCAGG + Intronic
1013638712 6:112053013-112053035 TATAGGATAGGTAAGGCAGCAGG + Intergenic
1014894803 6:126888824-126888846 AAGAGACCAGGGAAGGCACCAGG + Intergenic
1015174392 6:130290904-130290926 CAGAGGAAAGGGAAAACAGCAGG - Intronic
1015349644 6:132202709-132202731 CACAGGACAGAGTAGCCAGCAGG + Intergenic
1015384812 6:132609946-132609968 TAGAGGACAGGAGAGGCAGAGGG - Intergenic
1015935235 6:138402300-138402322 CTGGGGACAGGGAAGGAGGCAGG + Intergenic
1016598511 6:145828614-145828636 CAGAGAACGGGGAAGGAAGAGGG + Intergenic
1016998571 6:149978744-149978766 CAGCAGACAGGAAAGGAAGCAGG + Intergenic
1017085295 6:150707901-150707923 CAGAGGAAAGGGGAGCCAGGAGG - Intronic
1017492759 6:154958788-154958810 AAGGGGACAGGGTGGGCAGCAGG - Intronic
1017615609 6:156243725-156243747 CAAAGGACAGGAGAGCCAGCTGG - Intergenic
1017664242 6:156703787-156703809 CACAGCACAGGGAATGCTGCTGG + Intergenic
1017759051 6:157553871-157553893 GAGAGGACAGGGAAAGCAGACGG + Intronic
1017820605 6:158046385-158046407 CAGGGGGCCGGGAGGGCAGCGGG + Intronic
1018150003 6:160928794-160928816 CAGAGGACGAGGAAGGTAGTTGG - Intergenic
1018414563 6:163590169-163590191 CAGAGCAGAGGGAGGGCAGCTGG - Intergenic
1018582732 6:165321468-165321490 CAGAGAAAAGAGAAGGCAACTGG + Intergenic
1018873571 6:167801466-167801488 GGAAGGAGAGGGAAGGCAGCTGG - Intergenic
1018908448 6:168088471-168088493 CAGATGCCGGGGGAGGCAGCAGG - Intergenic
1019058896 6:169241992-169242014 CAGAGGACGGGGCCAGCAGCAGG + Intronic
1019129059 6:169860211-169860233 CAGCCGACAGGGAAGGCGGATGG - Intergenic
1019191160 6:170251693-170251715 CAGAAGCCAGGGTAGGCTGCAGG + Intergenic
1019278402 7:187937-187959 CAGAGGCCAGGGAGGGGAGCGGG - Intergenic
1019295317 7:270762-270784 CAGAGGGCAGGAGAGGCCGCTGG - Intergenic
1019493771 7:1326795-1326817 CAGAGCACAGGGCAGGCTGCAGG + Intergenic
1019598956 7:1871949-1871971 CACAGGACAGAGAAAGCAGAGGG + Intronic
1019602122 7:1889975-1889997 CACAGGGCTGTGAAGGCAGCTGG + Intronic
1020415499 7:7941230-7941252 GAGAGGAGAGGGTATGCAGCGGG - Intronic
1021738107 7:23658847-23658869 CAAAGGACAAGGAAGTTAGCAGG - Intergenic
1022847788 7:34228237-34228259 CTGAAGACAGGAATGGCAGCAGG - Intergenic
1023077908 7:36501785-36501807 CAGAGGACAGAAAATGGAGCAGG - Intergenic
1023217851 7:37884582-37884604 CAGAGGATTGGGATGGGAGCAGG - Intronic
1023462265 7:40411603-40411625 CAGAGGCCAGGAAAGGTAGCAGG + Intronic
1023528246 7:41127776-41127798 GACAGGACAGGGAAGGCATGGGG - Intergenic
1023635505 7:42205505-42205527 CAAAGAACAGAGAGGGCAGCTGG + Intronic
1023842030 7:44103517-44103539 CAGAGGACCCAGAAGGCAGGTGG - Intergenic
1023939882 7:44762677-44762699 CTGAGGCCAGGAAAGGCAGCTGG + Intronic
1023982422 7:45077792-45077814 CCCAGGCCAGGGCAGGCAGCAGG + Intergenic
1024076868 7:45825520-45825542 CAGGTGACAGGGAAGGAGGCCGG - Intergenic
1024303339 7:47904633-47904655 AGGAGGGCAGGGAAGGCAGATGG + Intronic
1024516604 7:50264748-50264770 GAGTGGACAGGGAAGGCCTCAGG + Intergenic
1024604234 7:51011535-51011557 CAGATGCCAGGGGAGGAAGCAGG + Intergenic
1024759377 7:52576187-52576209 CAGAGAACCAGGAAGGCTGCTGG - Intergenic
1024854333 7:53760129-53760151 CAGTGGATGGGGAATGCAGCAGG + Intergenic
1025099511 7:56123270-56123292 CAGAGGAGAGGCAGGGCAGGAGG + Intergenic
1025127551 7:56355903-56355925 CAGGTGACAGGGAAGGAGGCCGG + Intergenic
1025172070 7:56768127-56768149 TAGAGGACAGGAAAGGAAGTGGG + Intergenic
1025602782 7:63015461-63015483 CAGGTGACAGGGAAGGAGGCCGG + Intergenic
1025699797 7:63807428-63807450 TAGAGGACAGGAAAGGAAGTGGG - Intergenic
1025956968 7:66190304-66190326 CAGAGAGCAGGGAAGGCATTTGG - Intergenic
1025983299 7:66425775-66425797 CAGAGGATAGGAAAGGTAGTGGG + Intergenic
1026792071 7:73340615-73340637 CTGTGGAGAGGGAAGGCAGATGG - Intronic
1027130114 7:75584720-75584742 AAGAGGACTGGGATGGGAGCTGG - Intronic
1027169782 7:75863491-75863513 GAGAGGGCAGGGAAGGCATGGGG - Intronic
1028790214 7:94844842-94844864 CACAAGACTGTGAAGGCAGCTGG + Intergenic
1029127685 7:98306035-98306057 CAGAGCACAGGTCAAGCAGCCGG + Intronic
1029284496 7:99456488-99456510 CAGTGGACAGTGACAGCAGCTGG + Exonic
1029540380 7:101179288-101179310 CAGGGGACAGGCAGGGAAGCCGG + Intronic
1030524679 7:110638840-110638862 GAGAGGAAAAGGAAGGCAGAAGG - Intergenic
1030880543 7:114873067-114873089 CAGTGGAAAGGGAAGGCAGTTGG - Intergenic
1031490144 7:122377375-122377397 AAGAGTACAGAGAAGGCAGATGG - Intronic
1031924832 7:127629440-127629462 CAGAGCACTGGGTAGGCTGCAGG - Intergenic
1031989488 7:128188445-128188467 CAGGGGAGAGAGACGGCAGCAGG + Intergenic
1032015664 7:128379037-128379059 CAGAGCGAAGGGAAGGCAGAGGG + Intergenic
1032222574 7:130005891-130005913 CAGTGGAAGGGGAAAGCAGCTGG - Intergenic
1032404037 7:131642932-131642954 CAGAAAACAGGGATGGCAGGAGG + Intergenic
1032514948 7:132499875-132499897 CAGAGACCAGGGAAGGGAGTGGG + Intronic
1032587063 7:133156659-133156681 CAGAGGGCAAGGAAAGCATCAGG + Intergenic
1032653160 7:133900674-133900696 CAGGGGACAGGGAAGGAAAATGG + Intronic
1032836531 7:135680457-135680479 CAAAGGAAAGGGAAGTCGGCCGG - Intronic
1033100028 7:138461470-138461492 CAGAGGAGAGGGAAGAGAACTGG - Intronic
1033185597 7:139225228-139225250 CAGAGGCCAAGGCAGGCAGCTGG - Intergenic
1033770311 7:144543825-144543847 GAGAGGAAAGGGAAGGGAGCAGG - Intronic
1034073904 7:148213745-148213767 CAGAGGACAGGGGAGGGAGGAGG - Intronic
1034143635 7:148848585-148848607 CAGATGACAGAGAAGGCAGATGG + Intronic
1034450043 7:151132398-151132420 CAGAGGACTGGGGTGGCAGGAGG + Intronic
1034673775 7:152876901-152876923 GAGAGGACAGCGAGGGCAGTGGG - Intergenic
1035004447 7:155644769-155644791 CGGAGGACAGAGAAGGGAGGGGG - Exonic
1035221601 7:157409714-157409736 CAGAGCAGAGGGAGGGAAGCTGG - Intronic
1036001288 8:4607987-4608009 CAGTGGTCAGAGAAGGCATCAGG + Intronic
1036465400 8:8992685-8992707 CAGAGAAAAAGGAAGGAAGCAGG + Intergenic
1036620368 8:10421264-10421286 CTGAGGACAGGGAAGCCTGGGGG - Intronic
1036994021 8:13633302-13633324 CAAAGGAGAAGGAAGGCAGCCGG - Intergenic
1037728932 8:21507217-21507239 CAGGGGTCAGGCAAGGGAGCAGG - Intergenic
1037806738 8:22062105-22062127 GAGAGGACAGGGAAAGAAGTTGG - Intronic
1037886569 8:22599169-22599191 CAGAGGAGAGGGAGGGGAGAGGG - Intronic
1038658839 8:29479018-29479040 CAGAGGGCAGCGAGGGCATCTGG + Intergenic
1038737013 8:30179301-30179323 CAGAGGACAGGGGTGTCAGATGG - Intronic
1039611724 8:38924435-38924457 AGGAGGACAGGGAAGGGAGGAGG + Intronic
1039613748 8:38938658-38938680 CAGAGGTCAGGGATGTGAGCAGG - Intronic
1040021727 8:42746818-42746840 CACAGGACAGGGGTGGCAGGGGG + Intergenic
1040582263 8:48707642-48707664 CAGAGCACAGGGCAGGGTGCAGG + Intergenic
1041176766 8:55204928-55204950 TAGATGACATGGAAGGCAGCTGG + Intronic
1041931735 8:63294965-63294987 CAGAGGACAAGGTAGGGAGCAGG - Intergenic
1042014665 8:64294980-64295002 CAGAGGACAAGGCAGGCAAATGG - Intergenic
1042927691 8:73983284-73983306 CAAAGGACAGAGAAGCAAGCAGG - Intergenic
1044553802 8:93540407-93540429 AAGAAGACAGGGAAGGTAGCTGG + Intergenic
1045082437 8:98642209-98642231 CAGAGGCCAGGAAGGGGAGCGGG + Intronic
1045383552 8:101649533-101649555 CAGAGGAGAGAGAACACAGCAGG - Intronic
1045481965 8:102600141-102600163 TAAAGGACAGGGAAGGCAGAGGG - Intergenic
1046400106 8:113694088-113694110 CAGAGGTCATGGAAGCCAGAAGG - Intergenic
1048233751 8:132669624-132669646 CAGAGGACAGAGAAAGCTGAGGG + Intronic
1048286397 8:133145173-133145195 CAGAGGAAGAGGAAGGCAGAAGG + Intergenic
1048581908 8:135735821-135735843 GAAAGCACAGGGAAGGCTGCTGG - Intergenic
1048693140 8:136989867-136989889 GAGAGGCCAGGGACGGGAGCAGG + Intergenic
1048762534 8:137811538-137811560 CAGAGTACAGGAAAGGAAACAGG - Intergenic
1049283049 8:141760314-141760336 CAGCGGGCAGGGAAGGCTGCTGG + Intergenic
1049290346 8:141798357-141798379 GAGAGGAACGGGAAGGCACCTGG + Intergenic
1049389752 8:142361606-142361628 CAGGGGACAGGGGAGGCTGGGGG - Intronic
1049411897 8:142477302-142477324 CAGCGGACAGCCAGGGCAGCGGG + Intronic
1049436459 8:142588361-142588383 CAGGAGACAACGAAGGCAGCCGG - Intergenic
1049554121 8:143273830-143273852 CAGAGGGCAGGTGAGGCACCAGG + Intronic
1049620474 8:143596151-143596173 CAGAGGAGGCGGGAGGCAGCGGG + Intronic
1049704424 8:144034140-144034162 CATTGGCCAGGGAAGGCAGGAGG + Intronic
1049856672 8:144866449-144866471 CTGAGGACAGGGAATGCATCTGG - Intergenic
1050242318 9:3649907-3649929 CAGAGTACAGGAAAGGAAGATGG + Intergenic
1050513052 9:6413983-6414005 CAGAGGGCGGGGAGGGCAGAGGG + Intronic
1051668876 9:19490739-19490761 AAGAGGACAGAGAAGGCAAATGG - Intergenic
1052132822 9:24870459-24870481 CAGAGGCCAGGGGAGGCAAGGGG + Intergenic
1053288615 9:36865531-36865553 AAGAGAGGAGGGAAGGCAGCGGG + Intronic
1055783193 9:79842653-79842675 CACAGGACAAGGAAGGCTGTGGG + Intergenic
1056087735 9:83168993-83169015 CAGAGGCTAGGAAGGGCAGCAGG - Intergenic
1056118403 9:83463369-83463391 CACAGGACTGGGAAGGCCTCAGG + Intronic
1056458658 9:86788124-86788146 GAGAGGGTAGGTAAGGCAGCCGG + Intergenic
1056676594 9:88681541-88681563 CAGAGGACAGGGCTGACAGGAGG - Intergenic
1056778232 9:89529863-89529885 CAGAGGACAGGAAGGCTAGCGGG - Intergenic
1056782344 9:89560270-89560292 TAGTGGGCAGGGAAGGGAGCTGG + Intergenic
1056804618 9:89718884-89718906 CAGTGGGCAGGGCAGTCAGCTGG - Intergenic
1056824576 9:89867948-89867970 CAGAGGGCAAGGCAGGGAGCAGG - Intergenic
1056897751 9:90566691-90566713 AAGAGGTGAGGGAAGGCAGGAGG - Intergenic
1057267602 9:93629639-93629661 CAGGGGGCAGGGAAGGAAGAGGG - Intronic
1058472947 9:105299746-105299768 CAGCAGACACAGAAGGCAGCAGG - Intronic
1058666173 9:107318033-107318055 AGGAGGTCAGGGAAGGCAACTGG - Intronic
1058797360 9:108511637-108511659 CAAAGGACATGGTAGGCAGGGGG - Intergenic
1058954260 9:109930880-109930902 TAGAGGACAGGAGAAGCAGCAGG + Intronic
1059171654 9:112130468-112130490 CAGAGGAGAGGGAAAGGAGAGGG + Intronic
1059415309 9:114158518-114158540 CAGAGGCCAGGGAGGCCAGGAGG - Intronic
1059928999 9:119242265-119242287 GAGAGGACAGGGATGGGACCTGG + Intronic
1060031597 9:120219035-120219057 CTGATGAGAGGGAAGGAAGCAGG + Intergenic
1060074637 9:120580215-120580237 CAGAGGACGGGCAGGGAAGCGGG + Intergenic
1060411926 9:123405633-123405655 GACAAGACAGGGAAGGGAGCAGG + Intronic
1060496536 9:124123384-124123406 CAGAGGCCAGAGAAGGCAGATGG + Intergenic
1060557493 9:124516174-124516196 CTGAGGAATGGGAAGGCAGCTGG + Intergenic
1060992684 9:127857796-127857818 CAGAGGTCAGAGGAGGCAGGAGG + Intergenic
1061063877 9:128265556-128265578 CAGGGGACGGGGCAGGCAGTTGG + Intronic
1061746869 9:132746452-132746474 AAGGGGACAGGGATGGCAACAGG + Intronic
1061898711 9:133662138-133662160 CAGGGGACAGGGAGGGGTGCTGG + Intergenic
1061903135 9:133683214-133683236 CCCAGGAGAGGGGAGGCAGCTGG + Intronic
1061950135 9:133931499-133931521 CAGAGGACAGGGAAGGCAGCTGG - Intronic
1061991799 9:134163382-134163404 CAGCGGGCAAGGATGGCAGCGGG - Intergenic
1062140533 9:134955424-134955446 CAGAGCAGAGGGAAGGCAGCTGG + Intergenic
1062441096 9:136570205-136570227 CACAGGCCTGGGAAGGCAGGAGG - Intergenic
1062726775 9:138078576-138078598 CAGTGTACGGGGAAAGCAGCTGG + Intronic
1203785669 EBV:126178-126200 CAGAAGCCAGGGAGGGCAGACGG + Intergenic
1187765886 X:22641547-22641569 TACAGGAAAGGGATGGCAGCTGG - Intergenic
1187972529 X:24673447-24673469 CAGTTTAGAGGGAAGGCAGCTGG + Intergenic
1187993352 X:24899411-24899433 CCAGGGACAGGGAGGGCAGCAGG + Intronic
1188355189 X:29182115-29182137 CAGAGGTCAGGGAAGGCATGGGG - Intronic
1188503862 X:30859808-30859830 GAGGGGAGAGGCAAGGCAGCAGG - Intronic
1188574592 X:31631614-31631636 CGGAGGAAAGGAAAGGGAGCAGG - Intronic
1190212663 X:48460415-48460437 CAGGGGACAGGGTAGTCAGTTGG - Intronic
1192088525 X:68127090-68127112 CAGAGGACAGGAAGGGTAGGAGG + Intronic
1192127849 X:68518614-68518636 TAGGGGACAGGGAGGGCAGGTGG + Intronic
1192153209 X:68724546-68724568 AAGGGGACAGGACAGGCAGCTGG - Exonic
1192450276 X:71240491-71240513 CACAGGGCAGAGAAGGCAGCTGG + Exonic
1192482711 X:71499218-71499240 CAGAGGACAGAAAATGGAGCAGG - Intronic
1193269737 X:79515291-79515313 GAGAGGACAGAGAAGGAAGGAGG - Intergenic
1193707283 X:84837159-84837181 CAGAGGACGGGAAAGGTAGTGGG + Intergenic
1194875871 X:99187409-99187431 GAGAGGAGAGGGAAGGGAGGAGG - Intergenic
1194875878 X:99187431-99187453 GAGAGGAGAGGGAAGGGAGGAGG - Intergenic
1196810645 X:119626428-119626450 CACAGGACTATGAAGGCAGCAGG + Intronic
1197199472 X:123735210-123735232 CAGAGGAGTGGGAGGGAAGCAGG - Intergenic
1198096137 X:133381580-133381602 CTGTGGACAGGGAAGTCAGAAGG - Intronic
1198640958 X:138756252-138756274 CAGAGAAAAGAGAAGGCAGCTGG + Intronic
1199034192 X:143032083-143032105 CAGAAGACAGGGAATGCATCTGG - Intronic
1199600256 X:149537434-149537456 GAGAGGAGTGAGAAGGCAGCAGG + Intergenic
1199627594 X:149755129-149755151 CAGAGGATGGGAAAGGAAGCTGG - Intergenic
1199650328 X:149942506-149942528 GAGAGGAGTGAGAAGGCAGCAGG - Intergenic
1199850923 X:151724581-151724603 CAGAGGACAGGGAACACCCCTGG - Intergenic
1199984699 X:152942029-152942051 GTGCAGACAGGGAAGGCAGCTGG + Intronic
1200223565 X:154404388-154404410 CAGAGGGCAAGGGAGGCTGCAGG - Intronic
1200277489 X:154748391-154748413 GAGAGCAAAGGGAAGGTAGCGGG + Intronic
1200951844 Y:8905248-8905270 CAGGGGACAGGTGGGGCAGCAGG + Intergenic
1200959353 Y:8982842-8982864 GAGAGGACAGAAAATGCAGCAGG + Intergenic
1200987887 Y:9323784-9323806 CAGAGGACAGGTGGGGCAGTGGG - Intergenic
1201788919 Y:17816457-17816479 CAGAGGAGAGGGCAGGTGGCTGG + Intergenic
1201812634 Y:18089530-18089552 CAGAGGAGAGGGCAGGTGGCTGG - Intergenic
1201989692 Y:20010060-20010082 AAGAGGACAGGCAAGGGTGCAGG - Intergenic
1202257868 Y:22939985-22940007 GAGAGGACAGAAAAGGGAGCAGG + Intergenic
1202334211 Y:23789816-23789838 CAGAGGAGAGGGCAGGGGGCGGG + Intergenic
1202350525 Y:23985532-23985554 CAGAGGAGAGGGCAGGTGGCTGG + Intergenic
1202410858 Y:24573732-24573754 GAGAGGACAGAAAAGGGAGCAGG + Intergenic
1202459923 Y:25096340-25096362 GAGAGGACAGAAAAGGGAGCAGG - Intergenic
1202520254 Y:25684589-25684611 CAGAGGAGAGGGCAGGTGGCTGG - Intergenic
1202536557 Y:25880243-25880265 CAGAGGAGAGGGCAGGGGGCGGG - Intergenic