ID: 1061950910

View in Genome Browser
Species Human (GRCh38)
Location 9:133935390-133935412
Sequence GCTCCTTGTGGTCAACAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061950904_1061950910 -8 Left 1061950904 9:133935375-133935397 CCGCCCTCCACACCGGCTCCTTG 0: 1
1: 0
2: 4
3: 32
4: 378
Right 1061950910 9:133935390-133935412 GCTCCTTGTGGTCAACAAGCTGG No data
1061950899_1061950910 7 Left 1061950899 9:133935360-133935382 CCAGGCCTATCAGCCCCGCCCTC 0: 1
1: 0
2: 3
3: 28
4: 249
Right 1061950910 9:133935390-133935412 GCTCCTTGTGGTCAACAAGCTGG No data
1061950898_1061950910 19 Left 1061950898 9:133935348-133935370 CCAAGTAAGGAACCAGGCCTATC 0: 1
1: 0
2: 0
3: 3
4: 90
Right 1061950910 9:133935390-133935412 GCTCCTTGTGGTCAACAAGCTGG No data
1061950903_1061950910 -7 Left 1061950903 9:133935374-133935396 CCCGCCCTCCACACCGGCTCCTT 0: 1
1: 0
2: 3
3: 37
4: 386
Right 1061950910 9:133935390-133935412 GCTCCTTGTGGTCAACAAGCTGG No data
1061950900_1061950910 2 Left 1061950900 9:133935365-133935387 CCTATCAGCCCCGCCCTCCACAC 0: 1
1: 0
2: 4
3: 32
4: 369
Right 1061950910 9:133935390-133935412 GCTCCTTGTGGTCAACAAGCTGG No data
1061950902_1061950910 -6 Left 1061950902 9:133935373-133935395 CCCCGCCCTCCACACCGGCTCCT 0: 1
1: 0
2: 1
3: 28
4: 459
Right 1061950910 9:133935390-133935412 GCTCCTTGTGGTCAACAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061950910 Original CRISPR GCTCCTTGTGGTCAACAAGC TGG Intronic
No off target data available for this crispr