ID: 1061951416

View in Genome Browser
Species Human (GRCh38)
Location 9:133938398-133938420
Sequence GCCTGGGTACAGAGGGACGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 191}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061951416_1061951426 14 Left 1061951416 9:133938398-133938420 CCTGCGTCCCTCTGTACCCAGGC 0: 1
1: 0
2: 0
3: 18
4: 191
Right 1061951426 9:133938435-133938457 CCAATGAACTACAGCCTCCCAGG No data
1061951416_1061951427 15 Left 1061951416 9:133938398-133938420 CCTGCGTCCCTCTGTACCCAGGC 0: 1
1: 0
2: 0
3: 18
4: 191
Right 1061951427 9:133938436-133938458 CAATGAACTACAGCCTCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061951416 Original CRISPR GCCTGGGTACAGAGGGACGC AGG (reversed) Intronic
900731384 1:4263673-4263695 ATCAGGGTACAGAGGGAGGCAGG + Intergenic
904697416 1:32338057-32338079 GGCTGGGCTCAGAGGGACGGAGG + Intergenic
905854374 1:41298294-41298316 GCTTAGGTACAAAGGGACACAGG + Intergenic
906241982 1:44247868-44247890 GCCTGGGGACTGGGGCACGCGGG + Intronic
908393996 1:63708316-63708338 GACTGGGCACAGAGTGAAGCTGG - Intergenic
910087964 1:83426731-83426753 GCCAGGGTGCAGAGAGACCCTGG - Intergenic
911127071 1:94350722-94350744 GCCAGGGTAGAGAGGGAGGGAGG - Intergenic
912492091 1:110068068-110068090 GCCTGGGTTCAGAGCAAGGCTGG + Intronic
912827369 1:112917921-112917943 GCCAGAGTACAGAGGAACACAGG + Exonic
915164301 1:153940126-153940148 GCCTGGGTGGGGAGGGAGGCTGG - Intronic
915356054 1:155255624-155255646 GCCAGGGTCCAGAGCGAGGCAGG - Intergenic
915739173 1:158105331-158105353 GGCTGGGTAGAGTGGGACACTGG + Intergenic
916715340 1:167442736-167442758 GCCAGGGGACAGAGGGATTCAGG - Intronic
917273385 1:173303393-173303415 GCTTGGGCACAGAGGGAGGTGGG - Intergenic
921089532 1:211830329-211830351 GCCTGCGGACAGAGGGACGGCGG + Intronic
921391854 1:214623583-214623605 GCCTGGCTAGAGAGGTAGGCTGG - Intronic
923900788 1:238324021-238324043 GCCTGTGTACAGAGGAAAGGAGG - Intergenic
1063669336 10:8087393-8087415 GCCTGGGGACACAGGGCCTCAGG - Intergenic
1067328592 10:45293181-45293203 ACCTGAGCACAGAGGGAAGCAGG + Intergenic
1068557384 10:58474197-58474219 GTCTAGGTACAGAAGGACGCTGG - Intergenic
1069604913 10:69732862-69732884 GACTGGGGACAGAGGAACTCGGG + Intergenic
1069849704 10:71396945-71396967 GGCTCGGGAGAGAGGGACGCGGG + Intronic
1072898009 10:99383703-99383725 GACTGGGTAGAGAGAGAAGCTGG + Intronic
1073999818 10:109359553-109359575 GCTTTGGTACAGAGGAACACTGG + Intergenic
1074692258 10:116016722-116016744 GCATGGGTGCAGATGGAAGCGGG - Intergenic
1075871020 10:125772967-125772989 GCCTGGGAGCAGAGGGGAGCGGG + Intronic
1076874877 10:133211086-133211108 CCATGGGTACCGAGGGAGGCTGG - Intronic
1076911530 10:133392441-133392463 TGCTGGCTACAGAGGGAGGCTGG - Intronic
1078050439 11:7961018-7961040 GCCTGGGTACAGAGTACCGGTGG + Exonic
1081011083 11:37812735-37812757 GCCTGGGTCCAGAGCCAAGCTGG + Intergenic
1081578457 11:44334565-44334587 GCCTGGGTCCAGGGGGCCCCTGG - Intergenic
1083153679 11:60809640-60809662 GCCTGGCTACAAAAGGATGCAGG + Intergenic
1083475500 11:62912602-62912624 GCCTGGGTAAAGAGAAAGGCCGG + Intronic
1084147700 11:67273809-67273831 GCCTGGGAACAGCAGGAAGCAGG - Intronic
1084581881 11:70029268-70029290 GCCTGTGTGCAGAGGGAAGAGGG - Intergenic
1089300851 11:117497839-117497861 GCCTGGGTGCTGAGTTACGCTGG - Intronic
1089439643 11:118504709-118504731 GGCTGGGGACAGTGGGACTCCGG - Exonic
1090135177 11:124190484-124190506 GCTTGGGCACAGAGGGAGGGGGG + Intergenic
1202814012 11_KI270721v1_random:39063-39085 GCCTGGGCTCAGATGGACCCTGG - Intergenic
1096486243 12:51983521-51983543 GGCTGTGTTCAGAGGGTCGCTGG + Intronic
1096534205 12:52260534-52260556 GCTTGGGCACAGAGGGAAGTAGG - Intronic
1099861147 12:88227571-88227593 GCCTGGGTACAGATGGGCTGAGG - Intergenic
1102650649 12:114439959-114439981 GCCTGCGTTCAGAGGGCCGGGGG - Intergenic
1104546134 12:129714424-129714446 GCCAGGGCACAGATGGACACTGG + Intronic
1110407779 13:75169864-75169886 GCCAGGGAACAGAGTGAGGCAGG + Intergenic
1110917452 13:81040121-81040143 GGCTGGGAACAGAGGGACAAGGG + Intergenic
1113634321 13:111909551-111909573 CCCTGGGCACAGAGGGGCCCAGG + Intergenic
1113902457 13:113804585-113804607 GCCTGGGTATAAACGCACGCCGG + Intronic
1113902468 13:113804624-113804646 GCCTGGGTATAAACGCACGCCGG + Intronic
1113902479 13:113804663-113804685 GCCTGGGTATAAACGCACGCCGG + Intronic
1113902490 13:113804702-113804724 GCCTGGGTATAAACGCACGCCGG + Intronic
1113902499 13:113804741-113804763 GCCTGGGTATAAACGCACGCCGG + Intronic
1114075060 14:19157425-19157447 GCCTGGGTACCCACGGACGAAGG + Intergenic
1114087209 14:19242552-19242574 GCCTGGGTACCCACGGACGAAGG - Intergenic
1115499433 14:34036153-34036175 GCCTGGCAACAGTGGGAGGCAGG - Intronic
1121472959 14:94170546-94170568 ACCTGGGTTCAGAGGGACACTGG + Intronic
1121603963 14:95226987-95227009 TCCTGGGTACAGGGGAAGGCTGG + Intronic
1122648795 14:103213569-103213591 GCCTGTGTACAGAGTGACCAAGG - Intergenic
1122659952 14:103288343-103288365 GCCTGGGGTCAGTGGGACCCAGG - Intergenic
1123000333 14:105290506-105290528 GCCTAGGTACAGTGGGCTGCAGG + Intronic
1202921539 14_KI270723v1_random:33461-33483 AGCTGGGGACAGAGGGACGAAGG + Intergenic
1202923377 14_KI270724v1_random:4119-4141 AGCTGGGGACAGAGGGACGAAGG - Intergenic
1124554057 15:30709207-30709229 GCCCGGGTGCAGAGGCACACAGG + Intronic
1124677188 15:31696464-31696486 GCCCGGGTGCAGAGGCACACAGG - Intronic
1125750689 15:42025630-42025652 GCTTGGGTACAGAGGGAGGTAGG - Intronic
1128090908 15:64918335-64918357 GCCTGGGAGCAGAGAGAAGCCGG - Intronic
1131533861 15:93217410-93217432 TCCTGGGTCCTGAGGGAAGCTGG + Intergenic
1132726480 16:1341108-1341130 GCCTGTGGACAGAGGGGCGTGGG - Exonic
1135198713 16:20418193-20418215 GCCTGGGGACAGAATGATGCTGG + Exonic
1141094485 16:81153404-81153426 ACCTGGGAACAGAGGGAAGGAGG - Intergenic
1141552514 16:84815623-84815645 GCCTGGCTGCAGAGGGAGACGGG + Intergenic
1142126567 16:88413538-88413560 GCCTGGGTTCACAGGCAGGCAGG - Intergenic
1142363011 16:89636136-89636158 GCCTGGGCACCGAGGGACCCTGG - Intronic
1142363478 16:89638031-89638053 GCCTGGGGACAGACAGACACGGG - Exonic
1142921388 17:3190150-3190172 GCTTGGGCACAGAGGGAGGCGGG - Intergenic
1143102582 17:4512553-4512575 CCCAGGGTACAGAGGGAAGCAGG - Intronic
1146624032 17:34422522-34422544 TCCTGGGGACAGAGGGATGAGGG - Intergenic
1149366709 17:55952558-55952580 GCTTGGGCACAGAGGGAGGTGGG + Intergenic
1150656740 17:67044489-67044511 GCCTTGGGGCCGAGGGACGCGGG - Intergenic
1150979851 17:70128838-70128860 GCCTGGGTACAGACGGGCTGAGG + Intronic
1152103410 17:78315643-78315665 CCCTGGGTAGAGAGTGACTCAGG + Intergenic
1152484159 17:80578844-80578866 GCCTGGGAGCAGAAGGAAGCAGG + Intronic
1154127382 18:11703876-11703898 GACTGGGGACAGATGGAGGCAGG + Intronic
1156731442 18:40197981-40198003 GCTTGGGGACAGAGGGAGGCGGG - Intergenic
1157556768 18:48617917-48617939 GCCTGGGGTCCGAGGGAGGCTGG + Intronic
1160014089 18:75127602-75127624 GCCTCAGCACAGAGGGACACGGG - Intergenic
1160710337 19:548521-548543 TCCTGGGGACAGAGGGAATCAGG - Exonic
1160722190 19:602635-602657 GCCGGGGTGCAGAGGGGCACTGG - Intronic
1161137682 19:2629734-2629756 GCATGGGGTCAGAGGGAGGCGGG - Intronic
1161384575 19:3984106-3984128 GCCTGGGTACAGAGGGCACAGGG + Intronic
1161426918 19:4208743-4208765 GGCTGGGGAGAGAGGGAAGCAGG - Exonic
1161981891 19:7634187-7634209 CCCTGGGGACAGAGGCAGGCGGG + Intronic
1163374704 19:16923017-16923039 GCCTGGGGACAGAGGGCTGTGGG - Intronic
1163699982 19:18782111-18782133 GCCTGGGCACAGAGGAGCACAGG - Exonic
1165386128 19:35511653-35511675 GCCTGGGTGGAGAGGGAGGGAGG - Intronic
1165454208 19:35901252-35901274 TACTGGGTCCAGAGGGAGGCAGG + Intronic
1166257744 19:41618581-41618603 GCCTGGGTGAAGAGGGCAGCAGG + Intronic
1166965878 19:46529095-46529117 GCCTGGGGACACAGGGCCCCAGG + Intronic
1167101151 19:47404923-47404945 GGCTGGGCACAGAGGGGCTCAGG + Intronic
1167431060 19:49454619-49454641 GCCTGGGTGCTGGGGGACCCTGG - Intronic
1168468936 19:56625484-56625506 GCCTGGGGACACAGGGACACAGG - Exonic
925824831 2:7837492-7837514 GCCTGGGGAGAGTGGGAAGCTGG - Intergenic
925945920 2:8863586-8863608 GCGAGGGCACAGAGGGATGCGGG - Intronic
928135436 2:28684360-28684382 GCCGGGTTACAGAGGGTAGCAGG - Intergenic
929158795 2:38811389-38811411 GCCTGGGAAGAGAGGGGCCCAGG + Intronic
929757387 2:44778895-44778917 GCCTCGGTAGAGAGGGGCGGGGG - Intergenic
929789792 2:45014066-45014088 GCCTGGGTGCGGAGGGGCGCGGG + Intergenic
929933282 2:46275145-46275167 GCCTGGGGGCAGAGGTATGCTGG + Intergenic
933102180 2:78274583-78274605 GCTTGGATACAGAGGGAGGTGGG + Intergenic
935050711 2:99522792-99522814 GCTTGGGCACAGAGGGAGGTGGG - Intergenic
941230517 2:162906126-162906148 GCCTGGGTAAAGATGGCCGAGGG - Intergenic
941548000 2:166877956-166877978 GCCTGGGTAGAGAGGGTTGAAGG + Intergenic
944149133 2:196538605-196538627 GGCTGGGTATAGAGGGGCACTGG - Intronic
946121906 2:217523490-217523512 GCCTGGGAAGGGAGGGAAGCTGG + Intronic
946554103 2:220835820-220835842 TCATGGGTACAGTGGGAGGCTGG - Intergenic
948763887 2:240209670-240209692 GCCCGGGTGCAGTGGGAGGCTGG + Intergenic
1170549982 20:17468453-17468475 GCCTGTCTACAGCAGGACGCTGG - Intronic
1170900529 20:20457960-20457982 GCCTGGATGCTGAGGGAGGCAGG + Intronic
1171188263 20:23138906-23138928 CCCTGGGTAAGGAGGGAAGCCGG + Intergenic
1171301126 20:24061249-24061271 GCTTGGGTTGAGAGGCACGCAGG - Intergenic
1171374463 20:24682685-24682707 GCCTGGGCACAGAGGAAGGAGGG - Intergenic
1172470727 20:35192672-35192694 GCTTGGGTACAGAGGGAGGTGGG - Intergenic
1172527062 20:35606287-35606309 GCCTGGGGAGACAGGGATGCAGG - Intergenic
1172584113 20:36070641-36070663 GTCTGAGCACAGAGGGACCCTGG - Intergenic
1174081027 20:47970823-47970845 GCCTGGGGGCAGAGCGATGCAGG - Intergenic
1176021669 20:62965359-62965381 GCCTGGGCCCAGAGGGGCACAGG - Intronic
1178544296 21:33480083-33480105 GGCTGGGCGCAGCGGGACGCCGG + Intergenic
1179193154 21:39140463-39140485 GCCTGGGGACACAGGAAGGCAGG + Intergenic
1180290708 22:10850339-10850361 GCCTGGGTACCCACGGACGAAGG + Intergenic
1180493509 22:15879761-15879783 GCCTGGGTACCCACGGACGAAGG + Intergenic
1181321053 22:22006487-22006509 GTCTGGATACAGAGGAAAGCAGG + Intergenic
1181409739 22:22710591-22710613 GGCTTGGTACTGAGGGATGCAGG - Intergenic
1182415868 22:30221166-30221188 GCCTGGAGACAGAGGGACCGAGG + Intergenic
1182445178 22:30385850-30385872 CCCTGGGTACAGAGAGCCCCTGG - Intronic
1183177286 22:36233283-36233305 TCCTGTGTACAGAGGGAGGCTGG + Intronic
1185161443 22:49232326-49232348 GGTTGGGGACAGAGTGACGCAGG + Intergenic
950068666 3:10134700-10134722 GCTTGGGCACAGAGGGAAGTAGG + Intergenic
953921274 3:46953713-46953735 CCCAGGCTGCAGAGGGACGCTGG - Intronic
953996669 3:47524986-47525008 GCCTGGGTAAAGGGGAAGGCCGG + Intergenic
954394579 3:50286739-50286761 GCCTGGGCACACAGTGACGGCGG - Exonic
954622376 3:52003485-52003507 GGCTAGGTACAGAGGGCCACAGG + Intergenic
954664652 3:52245505-52245527 CCCTGGCTACTGTGGGACGCTGG + Intergenic
954872052 3:53774728-53774750 GCGTGGGTCCAGAGGGACGGAGG + Intronic
955411659 3:58659381-58659403 CCCTGTGTACAGAAGGCCGCAGG - Intronic
959546135 3:107598953-107598975 GCCTGGGGCCAGAGGGCCCCAGG - Intronic
961317654 3:126051483-126051505 ACCTGGGGGCAGAGGGAGGCAGG - Intronic
962714501 3:138115179-138115201 GCCGGGGTGCAGCGGGGCGCGGG - Intronic
962780878 3:138715275-138715297 GCCTGGGGCCAGAGTGATGCAGG + Intronic
963247861 3:143079263-143079285 GCCTGGGTGCAGAGGAGCCCAGG + Intergenic
966969549 3:185030600-185030622 GCCAGGGTTCAGAGGGACAAAGG + Intronic
967098136 3:186194048-186194070 GCCTGGGTTCAGACGGACTCCGG - Intronic
969509373 4:7608969-7608991 GCCTGGGCACAGAGGGATTTGGG - Intronic
969691261 4:8705407-8705429 GCCTGGGGAGAGAGGGAAGCTGG + Intergenic
974207101 4:58719615-58719637 GCCTTGGTACAGTGGCACTCTGG + Intergenic
974863550 4:67552474-67552496 GCTTGGGCACAGAGGGAGGTGGG - Intergenic
980994211 4:139764938-139764960 GCCTGGGTTCACGGGGAAGCAGG + Intronic
981055202 4:140353167-140353189 GTCTGGGTACAGAGAGAAGGAGG + Intronic
983680471 4:170347509-170347531 GCTTGGGCACAGAGGGAGGTGGG - Intergenic
984506125 4:180621291-180621313 GCCTGGAGACAGAGGGAACCTGG - Intergenic
991031970 5:62091739-62091761 GCCCTGGTTCAGAAGGACGCTGG - Intergenic
992089572 5:73304954-73304976 TCTTGAGTACAGAGGGAGGCAGG + Intergenic
992990423 5:82278106-82278128 GTCGGGGTACCGAGGGACGCAGG - Intronic
994947747 5:106417395-106417417 GCCTGGGTACAGCAGGAAGAAGG + Intergenic
995276799 5:110286490-110286512 GCCTGTCTTGAGAGGGACGCTGG + Intergenic
996803897 5:127433378-127433400 GCGTGTGTGCTGAGGGACGCTGG + Exonic
998116716 5:139543433-139543455 ACGTGGGTATAGAGGGAAGCTGG - Intronic
998509107 5:142696601-142696623 TCCTGGAAACAGAAGGACGCAGG + Intronic
1001710072 5:173771445-173771467 GCCTTGCTACAGAGGAAGGCTGG + Intergenic
1002001286 5:176197587-176197609 GCTTGGGCACAGAGGGAGGTGGG - Intergenic
1002253053 5:177941382-177941404 GCTTGGGCACAGAGGGAGGTGGG + Intergenic
1002578834 5:180194983-180195005 GCCTCGGTACAGGAGGGCGCTGG - Intronic
1003608874 6:7590547-7590569 GCCTGGGACCCGAGGGGCGCCGG + Intronic
1005979934 6:30829057-30829079 GCCTGGGGCCAGAGAGAGGCTGG - Intergenic
1006822946 6:36913149-36913171 GCATGGTAACAGAGGGAAGCTGG + Intronic
1014542947 6:122698438-122698460 AGCTGGGTACAGAGGGTCACAGG + Intronic
1016780281 6:147950541-147950563 GCCTGGGTACAGGGTGAGGGTGG - Intergenic
1019315076 7:380548-380570 GCAGGGGGACAGAGGGAGGCAGG + Intergenic
1019365890 7:632587-632609 GCCTTGGTACAGATGGATCCAGG + Intronic
1019517024 7:1444623-1444645 GCGTGGGGACCGAGGGACCCCGG - Intronic
1019565458 7:1676638-1676660 AGCAGGGCACAGAGGGACGCAGG - Intergenic
1019710794 7:2517375-2517397 TCCTGGCTACAGAGAGACGCGGG + Intronic
1019712747 7:2524944-2524966 GCCTGGGCTCAAAGGGACCCGGG - Intronic
1022752691 7:33247432-33247454 GACTGGGTGCAGAGAGACACTGG - Intronic
1023014603 7:35954916-35954938 GCCTGGCGACAGAGGGACAGAGG + Intergenic
1023709287 7:42974748-42974770 GCGTGGGCACAGAGGGAGGTTGG + Intergenic
1024359975 7:48458283-48458305 GCCTGTGTACACAGGGAGTCAGG - Intronic
1024765107 7:52648683-52648705 GCCTGGGTACAATGGGAGGTGGG - Intergenic
1027304842 7:76883165-76883187 GCCAGGGTGCAGAGAGACCCTGG - Intergenic
1032396226 7:131592012-131592034 TCCTGGGCACAGAGGGGCCCTGG + Intergenic
1034241973 7:149617675-149617697 GCCTGGGCTCAGATGGAGGCAGG + Intergenic
1035583427 8:754417-754439 GCATGGGCACAGAGGAAGGCAGG - Intergenic
1036684183 8:10898257-10898279 CCCTGGGTACCGGGGGACCCAGG - Exonic
1045480277 8:102586265-102586287 GCCTGGGTACTGAGAGAGGAAGG + Intergenic
1048256477 8:132908772-132908794 GCCTTGCTTGAGAGGGACGCTGG + Intronic
1049216026 8:141408804-141408826 GCTGGGGAACAGAGGGATGCTGG + Intronic
1053270466 9:36746050-36746072 CTCTGGATACAGAGGGACACCGG + Intergenic
1056069295 9:82969274-82969296 TGGTGGGTACAGAGGGACGTGGG - Intergenic
1057440182 9:95077371-95077393 GCCCGGGTCCACAGGGAGGCCGG + Intronic
1060793082 9:126498628-126498650 GCCTGGGCCCAGAGAGGCGCAGG - Intronic
1061151276 9:128829622-128829644 GCCTGGGATCAGCGGGAAGCAGG + Intronic
1061951416 9:133938398-133938420 GCCTGGGTACAGAGGGACGCAGG - Intronic
1186410819 X:9342951-9342973 GCCTGGGTGGAGAGGGACTTGGG + Intergenic
1189308799 X:40006115-40006137 GCCTGGGGGCAGAGGGAAGTGGG + Intergenic
1189664174 X:43335001-43335023 CCCAGGGTACAGAGGCAGGCAGG - Intergenic
1190732962 X:53236599-53236621 GCCTGGGGACAGAGGGAGGGAGG - Intronic
1192564681 X:72153870-72153892 GCCTGGGGAGACAGGGATGCTGG - Intergenic
1195674334 X:107496336-107496358 GCCTGGGTACATAGGGGCCTGGG + Intergenic
1198376978 X:136050126-136050148 GCATGGGGACAGAAGGACTCAGG - Intergenic
1200384983 X:155881398-155881420 GGCTCGGGACGGAGGGACGCGGG - Exonic
1201905731 Y:19084170-19084192 AGCTGGGTACAGAGGGACAGTGG - Intergenic