ID: 1061956127

View in Genome Browser
Species Human (GRCh38)
Location 9:133962141-133962163
Sequence TGCCCAGGAGGGTCCCATAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 147}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061956127_1061956141 30 Left 1061956127 9:133962141-133962163 CCTCTATGGGACCCTCCTGGGCA 0: 1
1: 0
2: 0
3: 19
4: 147
Right 1061956141 9:133962194-133962216 ATCTCAAGATGAGGCCACCCAGG No data
1061956127_1061956135 -7 Left 1061956127 9:133962141-133962163 CCTCTATGGGACCCTCCTGGGCA 0: 1
1: 0
2: 0
3: 19
4: 147
Right 1061956135 9:133962157-133962179 CTGGGCACAGAGGGGGATGAAGG No data
1061956127_1061956137 -5 Left 1061956127 9:133962141-133962163 CCTCTATGGGACCCTCCTGGGCA 0: 1
1: 0
2: 0
3: 19
4: 147
Right 1061956137 9:133962159-133962181 GGGCACAGAGGGGGATGAAGGGG No data
1061956127_1061956139 7 Left 1061956127 9:133962141-133962163 CCTCTATGGGACCCTCCTGGGCA 0: 1
1: 0
2: 0
3: 19
4: 147
Right 1061956139 9:133962171-133962193 GGATGAAGGGGTAACAGGTAAGG No data
1061956127_1061956140 21 Left 1061956127 9:133962141-133962163 CCTCTATGGGACCCTCCTGGGCA 0: 1
1: 0
2: 0
3: 19
4: 147
Right 1061956140 9:133962185-133962207 CAGGTAAGGATCTCAAGATGAGG No data
1061956127_1061956136 -6 Left 1061956127 9:133962141-133962163 CCTCTATGGGACCCTCCTGGGCA 0: 1
1: 0
2: 0
3: 19
4: 147
Right 1061956136 9:133962158-133962180 TGGGCACAGAGGGGGATGAAGGG No data
1061956127_1061956138 2 Left 1061956127 9:133962141-133962163 CCTCTATGGGACCCTCCTGGGCA 0: 1
1: 0
2: 0
3: 19
4: 147
Right 1061956138 9:133962166-133962188 GAGGGGGATGAAGGGGTAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061956127 Original CRISPR TGCCCAGGAGGGTCCCATAG AGG (reversed) Intronic
900242389 1:1623342-1623364 TGACCGGGAGTGTCCCATGGTGG + Intronic
900332473 1:2142851-2142873 TGAGCAGGAGAGTCCCGTAGAGG + Intronic
900469858 1:2848413-2848435 TGCCCAGGAGGTACCCAGAGAGG + Intergenic
900477717 1:2883719-2883741 TGCCCAGGAGGGCCCCTCAGAGG - Intergenic
900667517 1:3825207-3825229 TGCCCAGGAGTGCTCCAAAGGGG - Intronic
901935251 1:12622171-12622193 TGCCCTGGAGGGTCTCTTCGTGG + Intergenic
902804827 1:18854497-18854519 TGCCCAGGAAGGTGCCCAAGTGG + Exonic
903817379 1:26074495-26074517 TGCCCAAGAGGGTCCCAGCTGGG + Intergenic
904081945 1:27877745-27877767 GGCCCAGGGAGGTCCCAGAGAGG - Intronic
904970835 1:34418347-34418369 GGCCCAGGGGGTTCCCAGAGGGG - Intergenic
905345509 1:37308652-37308674 TCCCAAGGAGGCTCCCAGAGTGG - Intergenic
906643747 1:47458113-47458135 GATCCAGGAGGGTCCCAGAGGGG + Intergenic
913170597 1:116228754-116228776 TGCCCAGGCAGATCTCATAGGGG + Intergenic
916294769 1:163205643-163205665 TGCCCTGGAGGATGCCACAGTGG + Intronic
920267218 1:204733117-204733139 TGACCAGGGAGGGCCCATAGAGG + Intergenic
920379357 1:205526801-205526823 TGCTCATGAGGTTCCCACAGTGG - Exonic
920958814 1:210645776-210645798 TGCACAGGAGGGACCCAAACTGG - Intronic
1064006398 10:11702659-11702681 TGGCCAGGAGGGTCCCCTGGAGG + Intergenic
1066272207 10:33835002-33835024 TGCCCAGGAAGGTGCCATCTTGG - Intergenic
1069442576 10:68442119-68442141 TGCCCAGGCGGGTCTCAAACTGG + Intronic
1070444534 10:76483388-76483410 TGCCAGGCAGGGCCCCATAGGGG + Intronic
1070500783 10:77070747-77070769 TGCCAAGGAGGGTGCCATTATGG + Intronic
1070978197 10:80622619-80622641 GGCCCTGGAGGGTCTCATGGTGG + Intronic
1076887319 10:133268657-133268679 TGCCCAGCACGGGCCCATGGTGG - Intronic
1077155609 11:1089607-1089629 CGCCCAGGAGTGTACCAAAGAGG + Intergenic
1077393409 11:2309988-2310010 GGCCCAGAAGGATCCCAGAGGGG + Intronic
1080086393 11:28287944-28287966 TGCCATGCAGGGTCACATAGGGG - Intronic
1083014887 11:59443255-59443277 TGCCCAGGAAGGTCACAAAGAGG - Exonic
1083627374 11:64078573-64078595 TGCCCCACAGGGTCCCATGGGGG + Intronic
1083926558 11:65810743-65810765 GGCACAGGAGGGCCCCATGGTGG + Intergenic
1084401030 11:68942969-68942991 TGCCCAGAGGGATCCCAGAGTGG + Intergenic
1084401294 11:68944977-68944999 TGCCCAGAGGGATCCCAGAGTGG - Intergenic
1089754335 11:120675233-120675255 CCCCTGGGAGGGTCCCATAGGGG + Intronic
1090806246 11:130204097-130204119 TGACAAGAAGGGTCCCACAGAGG - Intronic
1091011672 11:132006987-132007009 TGCCCAGGAGGGTCTCGCACTGG - Intronic
1094170499 12:27486253-27486275 TGCCCAGCAGAGTGCCAAAGAGG - Intronic
1096865554 12:54560722-54560744 GGCCCAGGAGGGGCCAAAAGAGG - Intronic
1097222094 12:57456982-57457004 TGCCCATTTGGGTCCCATAGGGG - Exonic
1097378000 12:58861022-58861044 GGCCTAGGAGGGACCCCTAGGGG - Intergenic
1100329388 12:93570546-93570568 CGGCCAGGAGGGTCGCATCGAGG + Intronic
1103051422 12:117783266-117783288 TGACCCCAAGGGTCCCATAGTGG + Intronic
1103573548 12:121860222-121860244 GGCCCAGAAGGTTCCCATGGAGG + Intronic
1105455434 13:20536444-20536466 TGCCCAGGCTGGTCTCATACTGG - Intergenic
1105804829 13:23946767-23946789 TCCCCAGGTGGGTCCCATCCTGG - Intergenic
1106086998 13:26551637-26551659 TGCCCAGGAAGGCTCCAGAGAGG + Intergenic
1106474049 13:30082130-30082152 TTCCCATGAGGGTCCCCAAGTGG + Intergenic
1107772894 13:43807369-43807391 GGCCTAGGAGGGCTCCATAGGGG - Intergenic
1108066797 13:46586291-46586313 TGCCCAGGAAGGTCTCACAGAGG + Intronic
1111950494 13:94705554-94705576 TGCCCTGGAGGCGTCCATAGAGG - Intergenic
1113518359 13:110920211-110920233 TCCCCATGTGGGTACCATAGAGG + Intergenic
1113652235 13:112042172-112042194 TGCCCAGAAGAGTCCCAGAGAGG + Intergenic
1114345548 14:21790660-21790682 TCCCCAGGACAGTCTCATAGAGG + Intergenic
1118786233 14:69047573-69047595 TCCCCAGGAGGGACACATAGAGG + Intergenic
1121214231 14:92234844-92234866 TGGCCAAGAGGATCCCATATAGG + Intergenic
1121251741 14:92504893-92504915 TGGCCAGGAGGGTCAGAGAGAGG + Intergenic
1122974756 14:105166497-105166519 TGACCAGGGGGGCCCCAGAGAGG - Intronic
1123026559 14:105427024-105427046 TGCCCTGGAGGGTCCCGGACAGG + Intronic
1124354366 15:28984151-28984173 TGCCCTGGAGGGGCTCACAGTGG + Intronic
1127774327 15:62253616-62253638 TGCCCAGGAGGGGCCCAGTTAGG - Intergenic
1130969684 15:88722104-88722126 AGCCCTGGAGGGGCCCAGAGAGG + Intergenic
1134218223 16:12332914-12332936 TGGCCATGAGGGTCTCAAAGCGG - Intronic
1136615482 16:31395770-31395792 GACCCAGGAGGGTTCCATGGAGG + Intronic
1137674828 16:50299067-50299089 TGCCCAGGAGGGTCCGCCACAGG - Intronic
1138417165 16:56878094-56878116 TGGCCATGAGGGTCCCCTTGGGG - Exonic
1139834881 16:69830296-69830318 TGCCCAGGCTGGTCCCAAACTGG + Intronic
1141992829 16:87620306-87620328 TGACCAGGAGTCACCCATAGGGG + Intronic
1142335958 16:89489974-89489996 TGGCCGTGAGGGGCCCATAGGGG - Intronic
1203092528 16_KI270728v1_random:1225574-1225596 TGCCCAGGGGGGGCCCAGAGAGG + Intergenic
1143070735 17:4290823-4290845 TGCCCAGGCTGGTCCCAAACTGG + Intronic
1147228894 17:39002758-39002780 AGCCCAGAAGGGACCGATAGAGG - Intergenic
1149680554 17:58504169-58504191 TGGCCAGGAAGGTGCCGTAGAGG + Exonic
1150410933 17:64940144-64940166 TGACCAGGAGGGTCCCAGGTGGG - Intergenic
1151954342 17:77373150-77373172 TGCCCAGGACTGTCCCCCAGCGG + Intronic
1157713061 18:49863255-49863277 TGACCAGGAGGATGCCATTGAGG - Exonic
1161197345 19:2994132-2994154 TGCCCAGGCTGGTCCCTTTGGGG - Intronic
1161391830 19:4025143-4025165 TGCCCAGGACGGCCCCACCGAGG - Intronic
1163615033 19:18322155-18322177 TAACCAGGAGGGTCCCCCAGGGG - Intronic
1163830040 19:19543251-19543273 TGTCCAGCAGGGTCCCATTGTGG - Exonic
1164288869 19:23849367-23849389 TGCCAATTAGGGTCCCATAAAGG + Intergenic
1167587847 19:50384921-50384943 TGCACTTGAGGGTCCCAGAGCGG - Intronic
1167784955 19:51629131-51629153 GGCCCAGGAGGTACCCAAAGAGG + Intronic
925259343 2:2516506-2516528 TGCCCAGGAGGGTGCCAGGCAGG + Intergenic
927811001 2:26180093-26180115 TTCCCAGGAGGGTCCCAGGGCGG + Intronic
929960020 2:46489418-46489440 TGGCCAGGAGGGTCTTCTAGGGG + Intergenic
930033475 2:47071952-47071974 TGCCCAGGAGGGAGCCACACAGG - Intronic
932615108 2:73226666-73226688 TCCTCAGGAGGGACACATAGTGG + Exonic
935196920 2:100821374-100821396 TGTTCAGGAGGGTCCCGGAGAGG + Intronic
938501625 2:131833731-131833753 GGCCCAGGAGGGACCCATGAGGG - Intergenic
940176646 2:150884960-150884982 TGCCCAGGATAGTCACAGAGTGG + Intergenic
940919058 2:159287210-159287232 TGCCCGGGAGAGACCCCTAGGGG - Intergenic
944227230 2:197360037-197360059 GGCCCAGCAGGGGCCCCTAGGGG - Intergenic
945082753 2:206102751-206102773 TGCCCAGGCTGGTCTCAAAGTGG + Intergenic
945452826 2:210013519-210013541 TGCCCAGGATGGTCTCAAACTGG + Intronic
948757368 2:240167435-240167457 GGCCAAGGAGGGACCCAGAGGGG - Intergenic
948837311 2:240631990-240632012 TGCCCAGGAGAGCCCCATAAGGG + Intergenic
948984076 2:241509259-241509281 AGCCCAGGTGGGTCCCACAACGG - Intronic
1172122653 20:32607943-32607965 TGCCCAGGAGGGGCACAGTGAGG + Intronic
1172205547 20:33160447-33160469 TTCCCAGGAGCCTCCCATAGTGG - Intergenic
1173181470 20:40809452-40809474 TGTCCAGGACTGGCCCATAGTGG + Intergenic
1174427050 20:50439249-50439271 TGCACAGGAGGCTCCCACTGGGG - Intergenic
1180198864 21:46213123-46213145 CACTCAGGAGGGTCCCAGAGAGG + Intronic
1180995437 22:19963087-19963109 TCCCCAGGCAGGTCCCATGGTGG - Intronic
1182263331 22:29092276-29092298 TGCTGAGGAGGGTCCATTAGAGG + Intronic
1182508715 22:30803477-30803499 TGCCCAGGCTGGTGCCACAGGGG + Intronic
1183300632 22:37057372-37057394 TGGGCAGAAGGGTCACATAGAGG - Intronic
1183899844 22:40996775-40996797 AGGCCAGGAGGCTCCCACAGTGG + Intergenic
1185097273 22:48817619-48817641 TTCCCAGGAAGGACCCATAGGGG + Intronic
1185335252 22:50268357-50268379 GGCCCAGGAGGCTCACAGAGGGG + Intronic
1185412165 22:50688500-50688522 TGCCCACTGGGGTCCCAGAGTGG + Intergenic
956733249 3:72216016-72216038 GGCCAAAGAGGGTCCCATAAAGG - Intergenic
963046653 3:141107462-141107484 TGCCCTGGATGGACACATAGTGG - Intronic
963836117 3:150059654-150059676 TGCCATGGAGGGTCCCAAAAGGG + Intergenic
968543019 4:1177913-1177935 TGCGCAGCAGGGTCCCTTGGGGG - Intronic
969111462 4:4846938-4846960 TCCCCAGGAGAGTCCCAGGGAGG + Intergenic
972256266 4:37358976-37358998 TTCCCAGGACACTCCCATAGTGG - Intronic
975526135 4:75352598-75352620 TGCCCAGTGGTGTCCCAGAGAGG + Intergenic
986808784 5:11333863-11333885 TGACCAGTAGGATGCCATAGGGG - Intronic
988397587 5:30714516-30714538 AGCCCAGAATGGTCTCATAGTGG + Intergenic
990187289 5:53222238-53222260 TGCCCAGGAGGATCTTCTAGAGG - Intergenic
990205468 5:53424406-53424428 TGACCAGCTGTGTCCCATAGAGG - Intergenic
991204858 5:64038814-64038836 TGCCCAGTAGGGTCTCTGAGTGG - Intergenic
994965883 5:106670236-106670258 TGCCCAGGAAGTTACCATAAGGG - Intergenic
996747324 5:126856627-126856649 TGCCCAGGTTGGTCTCAAAGTGG - Intergenic
996759845 5:126976205-126976227 CACCCAGGTGTGTCCCATAGAGG - Intronic
1001677822 5:173533074-173533096 TGCCCAGGACTATCCCGTAGCGG - Intergenic
1002905499 6:1445623-1445645 ACCCCAGGAAGGTCCTATAGCGG - Intergenic
1004572324 6:16859258-16859280 TGCCCATGAGTGTTCCTTAGGGG + Intergenic
1006864985 6:37202108-37202130 TGCCCAGGAAGGTACATTAGAGG + Intergenic
1007173415 6:39880032-39880054 TGCTCATGGGAGTCCCATAGAGG - Intronic
1011416183 6:87122482-87122504 TGCCCAGGAAGGCCTCATGGCGG + Intergenic
1013651419 6:112198958-112198980 TGCCCGGGTGGGTCACAAAGTGG + Intronic
1013826423 6:114216122-114216144 TGCCTAGTAGGGTCCCAGAGAGG + Intronic
1017101309 6:150852026-150852048 TGCCCAAGATGGTCTCTTAGAGG + Intergenic
1019501333 7:1366341-1366363 GGCCCAGGAGGGTCCGACTGAGG + Intergenic
1019505259 7:1387325-1387347 TGGCGAGGAGGGTCCCAGCGTGG + Intergenic
1019550879 7:1601984-1602006 GACCCAGGAGGGTCCCGTCGGGG + Intergenic
1019984766 7:4647680-4647702 TGCCCCTGATGGCCCCATAGTGG - Intergenic
1020035457 7:4960501-4960523 TTCCCGGGCAGGTCCCATAGGGG - Intergenic
1020351333 7:7222005-7222027 CACCAAGGAAGGTCCCATAGAGG - Intronic
1021401941 7:20219535-20219557 GGACCAGGAGAATCCCATAGAGG - Intergenic
1023106999 7:36772295-36772317 TGCCAAGAAGAGCCCCATAGTGG - Intergenic
1029575064 7:101397954-101397976 TGCCCAGGTAGGCCCCCTAGAGG + Intronic
1032456697 7:132078641-132078663 TGCCTGGGAGTGTCCCAAAGAGG + Intergenic
1034414925 7:150959373-150959395 GGCCCAGGATGGACACATAGGGG - Intronic
1035244556 7:157553933-157553955 TGCTCAGGAGGGCACCAGAGCGG - Intronic
1035244574 7:157553988-157554010 TGCCCAGGAGGGCACGAGAGCGG - Intronic
1035244610 7:157554098-157554120 TGCCCAGGAGGGCACGAGAGCGG - Intronic
1035244628 7:157554153-157554175 TGCCCAGGAGGGCACGAGAGCGG - Intronic
1035244646 7:157554208-157554230 TGCCCAGGAGGGCACGAGAGCGG - Intronic
1035244664 7:157554263-157554285 TGCCCAGGAGGGCACGAGAGCGG - Intronic
1035244682 7:157554318-157554340 TGCCCAGGAGGGCACGAGAGCGG - Intronic
1035822370 8:2607182-2607204 AGCACAGGAGGGTCCCAGAGAGG + Intergenic
1038012130 8:23483591-23483613 TGCCCAGCAGCGTCGCAGAGCGG - Intergenic
1038882797 8:31633478-31633500 TTCCCAAGAGGGTCCCAAGGAGG + Intergenic
1045111719 8:98942840-98942862 TTGCCTGGTGGGTCCCATAGGGG - Intergenic
1053470545 9:38343250-38343272 GGCCCAGGAGGGTGGCAGAGAGG + Intergenic
1055290433 9:74777480-74777502 TGGCCAGGAGGCTCACAAAGAGG + Intronic
1058915383 9:109559686-109559708 TGCCCTGGAGGGCCACATTGAGG - Intergenic
1060503565 9:124181107-124181129 TGCCCAGGAGGGGACTATACGGG - Intergenic
1061064494 9:128268904-128268926 TGCCCAGTAGGGGCCCAGTGAGG - Intronic
1061956127 9:133962141-133962163 TGCCCAGGAGGGTCCCATAGAGG - Intronic
1186881420 X:13870443-13870465 TCCCCAGGAGGTTCTGATAGTGG + Intronic
1195291808 X:103437226-103437248 GGCCCAGGAAGGTCATATAGTGG + Intergenic
1197150757 X:123217651-123217673 TCCCCAGCAGGGTCACATATTGG + Intronic
1200967990 Y:9118771-9118793 TGACCAGGAGGGTCCCTGAGTGG + Intergenic
1202142770 Y:21745320-21745342 TGACCAGGAGGGTCCCTGAGTGG - Intergenic
1202144088 Y:21760298-21760320 TGACCAGGAGGGTCCCTGAGTGG + Intergenic