ID: 1061959068

View in Genome Browser
Species Human (GRCh38)
Location 9:133978912-133978934
Sequence CCTGAGCCTGGGGCTGGCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061959054_1061959068 30 Left 1061959054 9:133978859-133978881 CCAGGCAAAGAGTCCTTCAGAAC No data
Right 1061959068 9:133978912-133978934 CCTGAGCCTGGGGCTGGCCCCGG No data
1061959055_1061959068 17 Left 1061959055 9:133978872-133978894 CCTTCAGAACACGAAGCTTCAGG No data
Right 1061959068 9:133978912-133978934 CCTGAGCCTGGGGCTGGCCCCGG No data
1061959061_1061959068 -9 Left 1061959061 9:133978898-133978920 CCAAAAACCGGGCACCTGAGCCT No data
Right 1061959068 9:133978912-133978934 CCTGAGCCTGGGGCTGGCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061959068 Original CRISPR CCTGAGCCTGGGGCTGGCCC CGG Intronic