ID: 1061959461

View in Genome Browser
Species Human (GRCh38)
Location 9:133980546-133980568
Sequence GGCCATGCCCCATGGCTGGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 180}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061959461_1061959468 12 Left 1061959461 9:133980546-133980568 CCGACCAGCCATGGGGCATGGCC 0: 1
1: 0
2: 0
3: 10
4: 180
Right 1061959468 9:133980581-133980603 CCTTCTATCACGCATCTCCCTGG No data
1061959461_1061959469 13 Left 1061959461 9:133980546-133980568 CCGACCAGCCATGGGGCATGGCC 0: 1
1: 0
2: 0
3: 10
4: 180
Right 1061959469 9:133980582-133980604 CTTCTATCACGCATCTCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061959461 Original CRISPR GGCCATGCCCCATGGCTGGT CGG (reversed) Intronic
900967194 1:5966918-5966940 GGCAAGGCCCCATGGCTGAGAGG - Intronic
901209123 1:7514689-7514711 GCTCATGCCCCTTGGCTGGTTGG - Intronic
901647802 1:10726066-10726088 GGCCCTGCCCCATAGGTGGTTGG - Intronic
902553034 1:17230484-17230506 TGCCCTGCCCCAGGCCTGGTGGG + Intronic
902642916 1:17778251-17778273 GGCCCTGCACCAAGGCTGGAGGG - Intronic
906330117 1:44877406-44877428 TGCCATGTCCCTTGGCTGGGAGG + Intronic
911091863 1:94023563-94023585 GGCAATGTCCCAGGGCTGGGCGG - Intronic
911853965 1:102854001-102854023 AGCCCTGCCCCATGGCGGGGTGG - Intergenic
912483932 1:110008882-110008904 GGCCTTCCCCCATTTCTGGTGGG + Intronic
912719962 1:112011827-112011849 GGCCACCTCCCATTGCTGGTAGG + Intergenic
918126565 1:181589104-181589126 GGCCCTGCCCCAGATCTGGTGGG + Intronic
919784743 1:201252041-201252063 GGCCAAGCAGCAAGGCTGGTGGG + Intergenic
921885513 1:220301035-220301057 GGCCTAGCCCCATGTCTGGAAGG + Intergenic
1063862492 10:10326663-10326685 GGCCATGCCCCACGTGTGGATGG - Intergenic
1064259557 10:13774294-13774316 GGCCATGCCTCCTGCCTGCTGGG + Intronic
1065200141 10:23304677-23304699 GGCCATGGACCATGGCTGACAGG - Intronic
1067290578 10:44936713-44936735 GATCGTGCCCCATGGCTGATGGG + Exonic
1067793006 10:49301856-49301878 GGCCATGACACATGGCAGATGGG + Intronic
1068699671 10:60006591-60006613 GGCCTTGTCCCATGGCTTCTAGG + Intergenic
1069868872 10:71521216-71521238 GGCAGTGCCCCATGCCTGGGAGG - Intronic
1070053778 10:72914561-72914583 GGACATGCCACATGGTAGGTTGG + Intronic
1070728993 10:78812104-78812126 GACTTTGCCCCATGGCTGATAGG - Intergenic
1070779541 10:79129585-79129607 GGGCATGACTCATGCCTGGTGGG + Intronic
1071328060 10:84535915-84535937 GGCCATGCCCCATGGCCACATGG - Intergenic
1072414256 10:95233636-95233658 AGCAATTCCCCATGGCTGATGGG - Intergenic
1073361791 10:102905306-102905328 GGCCCTGCCACATGGAAGGTGGG - Intergenic
1073688636 10:105783425-105783447 GGCATTGCCAAATGGCTGGTGGG + Intergenic
1074164065 10:110859341-110859363 GGCCAAGCCCTGGGGCTGGTTGG + Intergenic
1074504767 10:114059889-114059911 GGCACTGCCTCATGGCAGGTTGG - Intergenic
1076086250 10:127634648-127634670 TGCCATGTCCCAAGGCTGGACGG + Intergenic
1076176809 10:128374532-128374554 TGCCCTGCCCAGTGGCTGGTGGG + Intergenic
1076509048 10:130999353-130999375 GGCTCTGCTCCATGGCTGCTGGG - Intergenic
1076651799 10:131994707-131994729 GGCCATGCCCTAAGGCAGGATGG + Intergenic
1076713079 10:132349784-132349806 GCCCCTGCCCCATGGTTGGGTGG + Intronic
1078668452 11:13344863-13344885 GGCCATCTGCCATGGCTGTTTGG + Intronic
1081589880 11:44414732-44414754 GGACATGGCTCATGGGTGGTGGG + Intergenic
1082883266 11:58058852-58058874 GGCCAGGACTCAAGGCTGGTGGG + Intronic
1083280186 11:61622151-61622173 GGTCCTGCCCCATACCTGGTGGG - Intergenic
1083293654 11:61703569-61703591 GGCCAGGCCACAGGGCTGGCAGG + Intronic
1083714741 11:64568794-64568816 GGCCATGCCCCAGGGCCAGCAGG + Intronic
1084565447 11:69926006-69926028 GGTCACACCTCATGGCTGGTTGG + Intergenic
1084779307 11:71398054-71398076 TCCTCTGCCCCATGGCTGGTTGG + Intergenic
1088194019 11:107256345-107256367 GGCGATGCCCCATGGGTCCTTGG - Intergenic
1088881209 11:113975007-113975029 GGCCAAGCCCCCTGGCTGAATGG + Intronic
1089682097 11:120124289-120124311 GGCCATCCCCCAGGCCTGGCCGG + Intronic
1089849989 11:121487573-121487595 AGCCATGTCCCATAGCTGCTTGG + Intronic
1092644184 12:10551465-10551487 GGCCCTGCCCCGTGGCTCGGAGG + Intergenic
1096514395 12:52148163-52148185 CGCCAGGCCCCATGCCTGGGAGG - Intergenic
1098465823 12:70784345-70784367 GGCCATGCCCCCTGGCAGCCTGG + Intronic
1098861000 12:75709811-75709833 GCTTATGCCCTATGGCTGGTGGG + Intergenic
1104210733 12:126685851-126685873 GGCCATGCTCCAGGGCTCCTGGG - Intergenic
1104739786 12:131164182-131164204 GGACCTGCCCCAGGGCTGGCGGG - Intergenic
1105284489 13:18993301-18993323 GGCCATGCCACATGGCCAGAAGG + Intergenic
1108043994 13:46365709-46365731 TGCCATTCCCCTTGGCTGGATGG - Intronic
1110399240 13:75070639-75070661 GGCCAGGCCCCATGGGTTGGTGG - Intergenic
1113047351 13:106170194-106170216 ATCCATGCTCCGTGGCTGGTTGG - Intergenic
1113577198 13:111403044-111403066 GTCCATGCCCCAGGGATTGTGGG + Intergenic
1114267578 14:21081851-21081873 GGCCGTGGCCCAGGGCTGCTGGG - Exonic
1114313325 14:21487633-21487655 GGGCATGACCCATGGCTTGATGG + Exonic
1115779650 14:36755490-36755512 TGCCATGCCCCATGGGAGTTTGG - Intronic
1118224936 14:63889993-63890015 GGCCCTGCCCCATACCTGGATGG - Intronic
1118571011 14:67195456-67195478 GGATATGCCACATGGCTGCTGGG - Intronic
1121635925 14:95453834-95453856 GACGCTGCCCCATGGCTGGGTGG + Intronic
1122971813 14:105155257-105155279 GCCCATGCCCCATCTCTGGGTGG + Intronic
1123101282 14:105803294-105803316 GGCTATGCTCTATGCCTGGTGGG - Intergenic
1123834394 15:24173455-24173477 GGTCATGCACCCTGGCAGGTGGG + Intergenic
1123854080 15:24389007-24389029 GGTCATGCACCCTGGCAGGTGGG + Intergenic
1123870040 15:24561630-24561652 GGTCATGCACCCTGGCAGGTGGG + Intergenic
1125731300 15:41894079-41894101 GGCCACGCCCTGTGGCAGGTGGG - Intergenic
1126103708 15:45134659-45134681 GGCATTGCCCCATGGCTTCTAGG + Intronic
1128108306 15:65060202-65060224 AGCCAGGCCCCATGCCTGGGGGG - Intronic
1130650399 15:85759236-85759258 GGCCTTGAGCCTTGGCTGGTGGG + Intergenic
1130728026 15:86461184-86461206 TACCATGCCCCATCGGTGGTAGG + Intronic
1132481663 16:169358-169380 GGTCATGCCCCCTGCCTGCTGGG + Intergenic
1132504005 16:297782-297804 GACCTTGCCCCATGGCTGTGTGG + Exonic
1133979406 16:10622317-10622339 GCCCAGGCCCCATGCCTGGTAGG - Intergenic
1134174784 16:11996847-11996869 TGAGATGCCTCATGGCTGGTGGG + Intronic
1135490664 16:22906525-22906547 GGCTCTGCCCTGTGGCTGGTGGG - Intronic
1136103719 16:28013803-28013825 GGCCATGCCTCCTGTCTGGGAGG - Intronic
1138349445 16:56338688-56338710 AGCCCAGCCCCATGGCCGGTGGG - Intronic
1139101885 16:63777610-63777632 GCCCACACCCCATGACTGGTGGG - Intergenic
1139959931 16:70711601-70711623 GGCCAGGCCACATGGCTGTCAGG - Intronic
1141109440 16:81260004-81260026 AGCCCTCCCACATGGCTGGTGGG + Intronic
1142033533 16:87850264-87850286 GGCCCTGCCTCAGGGCTGGGAGG - Intronic
1143868772 17:9943084-9943106 TGCCAGGCCCCAGGGCTGGGAGG + Intronic
1146827545 17:36036237-36036259 GGCCGGGCACGATGGCTGGTTGG - Intergenic
1147988148 17:44318262-44318284 GTCCATGGCCCCTGGCAGGTGGG - Exonic
1150663022 17:67102051-67102073 AGCCATGGCCCTTGGCTGCTTGG - Intronic
1151368508 17:73632097-73632119 GGCCATGCCTTAAGGGTGGTGGG - Intronic
1152092026 17:78252430-78252452 GGCCATGGCCCAGGGTAGGTGGG - Intergenic
1152225806 17:79092122-79092144 GGCCATGGCACGGGGCTGGTCGG + Intronic
1158516617 18:58135926-58135948 GGCCATACCCCTTGTGTGGTTGG + Intronic
1160404073 18:78632504-78632526 AGCTGTGCCCCATGGCTGGGCGG - Intergenic
1160943599 19:1631099-1631121 GGCCCTGCCCAATGCCAGGTGGG - Intronic
1161200999 19:3014703-3014725 AGTCATGCCCCAGGGCTGGCTGG - Intronic
1161466378 19:4432958-4432980 GGCCATGCCCCAAGCCTCGGTGG + Intronic
1161470661 19:4455475-4455497 GGGCAGGGTCCATGGCTGGTTGG - Intronic
1164907445 19:31978717-31978739 GGCCAGGGCCCCTGGCTGATAGG - Intergenic
1166366026 19:42278985-42279007 GGTCATGCCCTCTGGCAGGTGGG - Intronic
1168233498 19:55047659-55047681 GGCTCTGCCACATGGCTGCTGGG + Intronic
1168547643 19:57266826-57266848 GGAAAAGCCCCATGGCAGGTGGG - Intergenic
925979567 2:9165925-9165947 GGTCATGCCCTGTGGCTGGATGG - Intergenic
926938161 2:18106917-18106939 GCCCATGCTACAAGGCTGGTTGG + Intronic
928176127 2:29035471-29035493 TGCAATGGCCCAAGGCTGGTGGG + Exonic
929301328 2:40306761-40306783 GGCCAGGCTCCACGGCTGGTTGG + Intronic
929996382 2:46828726-46828748 AGACATGCCCTGTGGCTGGTGGG - Intronic
930888420 2:56355141-56355163 GGCCATTCCCCACGGCTCCTAGG + Intronic
931236228 2:60414506-60414528 ATCCAGGCCCCATGGCTGTTGGG + Intergenic
932779855 2:74553396-74553418 GGCCAGGCCTCAAGGCTGGGCGG + Intronic
936021888 2:109001445-109001467 GGGCCAGCCCCATGGCTGGCTGG + Intergenic
939909508 2:147962909-147962931 GGTCATGGCTCATGGCTGCTCGG - Intronic
940544279 2:155063259-155063281 GGCCATGGCCAATGGTTGGCTGG - Intergenic
946339133 2:219057200-219057222 GGCCCTGTCCCAGGGCTGCTGGG - Intronic
946791619 2:223306495-223306517 CGCAATGCCGCATGGCTGGGGGG + Intergenic
947133694 2:226955685-226955707 GGCCTTGCCCCTTGGCTTGCAGG + Intronic
947734640 2:232448274-232448296 GCCCAGGCCCCAAGGCAGGTGGG - Intergenic
947933800 2:233985904-233985926 GGCCAAGCCCCATGCCAGGCTGG + Intronic
948027393 2:234789122-234789144 GGCCAAGTCCCAGGACTGGTTGG - Intergenic
948237478 2:236401445-236401467 GGCCAGGCCCCAGGGCTGGCGGG - Intronic
948809503 2:240467492-240467514 GGCCCTGCCCCAGGCCTGGACGG + Exonic
1168758296 20:330884-330906 GGTCATGCCCCTTGCCTGGGTGG + Intergenic
1168911071 20:1447333-1447355 GCCCATGAGCCATGGGTGGTTGG - Intronic
1171195511 20:23194520-23194542 AGCCATGGCCCAGTGCTGGTGGG - Intergenic
1171428616 20:25064456-25064478 GGCCTTGCCACATGGCAGGTTGG - Intergenic
1172474405 20:35226558-35226580 GCCCCTGCCCCAGGGCTGGTCGG + Intergenic
1172900027 20:38327948-38327970 GGCCAGTCCTCATGGCTGGGAGG + Intronic
1172905619 20:38366994-38367016 GGCCACGCCCCATATCTTGTGGG + Intronic
1174537230 20:51260611-51260633 TGCCATGCCCCAGGGCTCATAGG - Intergenic
1176978648 21:15353627-15353649 GGCCATGAGTCATGGCTTGTGGG + Intergenic
1178360448 21:31944713-31944735 GGACATGCAGCATGCCTGGTTGG + Intronic
1181475553 22:23165796-23165818 GGCCTTGCCACATGGCAGCTTGG + Intergenic
1182346646 22:29671150-29671172 GGCTCTGCCCCATGGCCGATGGG - Intronic
949947609 3:9202774-9202796 GTCCATGCCCCATGCCAGGAGGG + Intronic
952154725 3:30630437-30630459 GGTCATTCCCCATGGATGGAAGG + Intronic
952902874 3:38121357-38121379 GTCCCTGCACCCTGGCTGGTTGG - Intronic
954453861 3:50586450-50586472 AGCCATGCCCCGTGGCAGGCAGG + Intergenic
954660503 3:52224455-52224477 TCCCATCCCCCATGGCTTGTGGG + Intronic
958743874 3:98109900-98109922 GGCCATGCACCCAGGCTGGTAGG - Intergenic
960986800 3:123286216-123286238 GGCCAGGGCCCTTGGCTGCTGGG + Intronic
961165859 3:124763434-124763456 GGCCATGTCACCTGGCTGCTAGG - Exonic
961735056 3:128996121-128996143 GGCCATTTCACATGGCTGCTTGG - Intronic
962879376 3:139561772-139561794 GTCCAAGGCCCATGGCTTGTTGG - Intronic
964931447 3:162030024-162030046 GGCTGTGCACCATGTCTGGTGGG - Intergenic
966620187 3:181954991-181955013 GGCCCTGCCCCATTTCAGGTGGG + Intergenic
970695975 4:18677624-18677646 GTCCTTGCCCTGTGGCTGGTTGG + Intergenic
971325753 4:25642352-25642374 GGTCATTCCCCAGGGCTGGCTGG - Intergenic
978462399 4:108970713-108970735 GGTGGTGACCCATGGCTGGTGGG - Intronic
978770963 4:112456182-112456204 GGGCATGACCCATGGCTTGATGG + Intergenic
982126721 4:152190047-152190069 AGCCAGTCCCCAGGGCTGGTGGG - Intergenic
984930757 4:184845184-184845206 TGCCATGCCCCATCACGGGTGGG + Intergenic
985626472 5:991565-991587 GGCTGTGGGCCATGGCTGGTGGG - Intergenic
985908832 5:2863572-2863594 GTCCACGTCTCATGGCTGGTAGG + Intergenic
987148626 5:15017052-15017074 TGCCATGCCCCAGCACTGGTAGG + Intergenic
988604625 5:32668767-32668789 GGCCATGCACCCCAGCTGGTAGG + Intergenic
993870736 5:93251300-93251322 GTCAAGACCCCATGGCTGGTGGG + Intergenic
994250664 5:97533148-97533170 GGCCATGAACCATGGAAGGTAGG - Intergenic
997969785 5:138391780-138391802 GGCCATTCCCCATGGCAGAGAGG - Exonic
1001415328 5:171541585-171541607 GTCCCTGCCCCAGGGCTGCTCGG + Intergenic
1008594307 6:53025955-53025977 GGCAATGCCACATAGCGGGTAGG + Intronic
1013294815 6:108749579-108749601 TGCTTTCCCCCATGGCTGGTGGG - Intergenic
1018026240 6:159808587-159808609 GGCCCTGCCACATGGCTCATGGG + Intronic
1018922970 6:168188576-168188598 GGCCATGCCCCATGGAGGGCGGG - Intergenic
1022837313 7:34130632-34130654 CACCATGCCCCAGGGCTGGCAGG - Intronic
1027229618 7:76264632-76264654 GCCTAAGCCCCATGGCTGGCGGG - Intronic
1033135053 7:138777208-138777230 AGCCATGCCCCAAGTCTGCTGGG + Intronic
1033556489 7:142492488-142492510 GGCCCTGCCCCAGGGCCTGTCGG - Intergenic
1037281481 8:17246965-17246987 GGCCAGGCTCCCTGGCTGGCCGG + Exonic
1037559517 8:20060234-20060256 GGCAATACCCAATGGCAGGTTGG + Intergenic
1037833771 8:22204343-22204365 GGCCAGGCACTATGACTGGTGGG - Intronic
1040408820 8:47134514-47134536 ATCCATGACCCATAGCTGGTGGG - Intergenic
1040418132 8:47214517-47214539 GGCATTTCCCCAAGGCTGGTGGG + Intergenic
1041477540 8:58282822-58282844 TGCCATGCCCCATTACTGGCTGG + Intergenic
1043807659 8:84692919-84692941 GGCCATGAGCCAAGGGTGGTAGG + Intronic
1045341021 8:101254571-101254593 GGCCCTGCCCCATACCTAGTAGG + Intergenic
1047021057 8:120775470-120775492 GGCCAACCTCCATTGCTGGTAGG + Intronic
1047492102 8:125383645-125383667 GGGACTGACCCATGGCTGGTGGG - Intergenic
1047701052 8:127449783-127449805 GGCCTTGTCCCAGGGCTGGGAGG - Intergenic
1048387058 8:133921757-133921779 ATCCATGCCCCATGGCTTCTTGG + Intergenic
1049269158 8:141685007-141685029 AGCCATGGCCCAGAGCTGGTGGG - Intergenic
1049300721 8:141868012-141868034 AGCCAGCCCCGATGGCTGGTGGG - Intergenic
1049578543 8:143400537-143400559 GACTATGCCCCAGGGCTGGAGGG - Intergenic
1049587669 8:143439688-143439710 GGCCCTGCCCCAGGGCTGGCAGG + Intronic
1050277770 9:4017956-4017978 GGCCTGCCCCCTTGGCTGGTAGG - Intronic
1054712476 9:68525082-68525104 GACCATGCCTCATGGTGGGTGGG - Intronic
1056790689 9:89623563-89623585 GGCCAGCCCCCATGGCTCTTGGG + Intergenic
1057275535 9:93674303-93674325 GGGCATGACCTGTGGCTGGTGGG - Intronic
1061959461 9:133980546-133980568 GGCCATGCCCCATGGCTGGTCGG - Intronic
1062036043 9:134383013-134383035 GGCTATGCCCCTGGGCTGCTGGG + Intronic
1187277404 X:17828097-17828119 GGGCCTGTCCCATGGCTTGTAGG - Intronic
1192211833 X:69132749-69132771 GGCCCAGCCCCAGGGCTTGTAGG + Intergenic
1193685053 X:84567794-84567816 ACCCATGCCCCATGGCAGGAAGG - Intergenic