ID: 1061961783

View in Genome Browser
Species Human (GRCh38)
Location 9:133992398-133992420
Sequence CGGCGGCGCAGCGGGGGACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 267}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061961783_1061961795 12 Left 1061961783 9:133992398-133992420 CCAGGTCCCCCGCTGCGCCGCCG 0: 1
1: 0
2: 3
3: 16
4: 267
Right 1061961795 9:133992433-133992455 TCTTCCTCCTCCTACTCCTCGGG 0: 1
1: 1
2: 47
3: 169
4: 864
1061961783_1061961800 23 Left 1061961783 9:133992398-133992420 CCAGGTCCCCCGCTGCGCCGCCG 0: 1
1: 0
2: 3
3: 16
4: 267
Right 1061961800 9:133992444-133992466 CTACTCCTCGGGCTCCTCTCGGG 0: 1
1: 0
2: 1
3: 11
4: 152
1061961783_1061961794 11 Left 1061961783 9:133992398-133992420 CCAGGTCCCCCGCTGCGCCGCCG 0: 1
1: 0
2: 3
3: 16
4: 267
Right 1061961794 9:133992432-133992454 CTCTTCCTCCTCCTACTCCTCGG 0: 1
1: 2
2: 40
3: 221
4: 1120
1061961783_1061961799 22 Left 1061961783 9:133992398-133992420 CCAGGTCCCCCGCTGCGCCGCCG 0: 1
1: 0
2: 3
3: 16
4: 267
Right 1061961799 9:133992443-133992465 CCTACTCCTCGGGCTCCTCTCGG 0: 1
1: 0
2: 0
3: 18
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061961783 Original CRISPR CGGCGGCGCAGCGGGGGACC TGG (reversed) Intronic
900685223 1:3944030-3944052 TGGCGGGGCAGCGGAGGACAAGG - Intergenic
900707718 1:4090796-4090818 CGGCAGCACAGCTGGGGACAAGG - Intergenic
901086327 1:6614180-6614202 GGGCGGCGCTCCGGGCGACCGGG - Intronic
901088354 1:6625480-6625502 CGGAGGGGCAGCGGCGCACCTGG + Intronic
901279843 1:8025908-8025930 CGGCGGCGCAGCCCGGGCCTGGG - Intronic
901930796 1:12595403-12595425 GGGCGGGGCCGCGGGGGTCCCGG + Intronic
902397448 1:16140071-16140093 CAGAGGTGCAGAGGGGGACCAGG + Intronic
902570055 1:17341607-17341629 CAGGGGCACAGCAGGGGACCAGG - Intronic
904618951 1:31764146-31764168 GGGCGGGGGAGCGGGGGAGCGGG - Intronic
905548576 1:38818392-38818414 CCGCCGCGCAGCCGCGGACCCGG - Intergenic
906202673 1:43970207-43970229 CGGCGCTGCAGCGAGAGACCGGG + Exonic
907905704 1:58782654-58782676 CGGCGGCGCAGCCGGTCAACGGG - Exonic
908477776 1:64505875-64505897 CGGGGACGAAGCGGGGGACCCGG - Intronic
911440570 1:97921040-97921062 CGGCGGCGCGGGGGCGGAGCGGG + Intronic
911664728 1:100539671-100539693 CGGCGGCGCAGCCGGGCAACTGG - Exonic
914197347 1:145454447-145454469 CGGCGGCGGAGAGCGGGCCCGGG - Intergenic
915246278 1:154558448-154558470 GGGCGGCCCAGGGGGGGGCCCGG - Exonic
916048772 1:161020595-161020617 CGGCTGCGCAGCGGGGTTCGTGG + Intronic
916414036 1:164576388-164576410 CGGCGCCGCGCCGGCGGACCGGG - Intronic
917920256 1:179744311-179744333 CCGCGGCCCAGAGGGGGGCCTGG + Intronic
918064412 1:181089577-181089599 CGGCGGCCCAGCGGGCTGCCCGG + Exonic
918151095 1:181798745-181798767 CGGCGGAGGCGCGGGGGGCCTGG + Exonic
919075511 1:192808663-192808685 CGGCGGCCCGGCGGGGGCGCCGG - Intergenic
922704138 1:227780153-227780175 CAGTGGGGCAGCTGGGGACCTGG - Intronic
923744412 1:236686838-236686860 CGGGAGCCCCGCGGGGGACCCGG - Intronic
924225376 1:241917628-241917650 CGGCGGAGCACCTCGGGACCTGG - Intergenic
1063418287 10:5890442-5890464 GGGTGGGGCAGCGGGGGCCCCGG + Intronic
1064764762 10:18659564-18659586 CCGCGCCGCGGTGGGGGACCCGG + Exonic
1065099867 10:22321790-22321812 CGGCGGCGCGGCCGGGGCGCGGG - Intronic
1066180545 10:32957810-32957832 TGCCGGAGCTGCGGGGGACCGGG - Exonic
1066994750 10:42553207-42553229 CCGCGGCGCAGCGGGGCCACAGG - Intergenic
1067251041 10:44587437-44587459 GGGAGGGTCAGCGGGGGACCGGG - Intergenic
1068783327 10:60944282-60944304 CGGCGGCGGAGCGAGGTGCCGGG - Intronic
1070327954 10:75400224-75400246 CGGCGGTGCTGCGGGCGACAAGG - Exonic
1070768282 10:79068648-79068670 TGGTGGCGTAGCGGGGAACCAGG + Intergenic
1070800829 10:79243551-79243573 CGGCGGCGGCGCGGGGGCCCGGG - Intronic
1072169926 10:92848905-92848927 CGGGGCCGCAGCGCGGGGCCCGG - Intronic
1072654321 10:97319710-97319732 CAGCGGCACCGCCGGGGACCTGG - Exonic
1073242053 10:102065522-102065544 CGGCGGCGCGGCGCGGCTCCGGG + Exonic
1075106392 10:119542674-119542696 CGGCGGCGCGGCGGCTGAGCCGG + Exonic
1075144711 10:119873015-119873037 AGGCTGCGCAGCGCGGGGCCCGG + Intronic
1075645152 10:124092270-124092292 GGGCGGCGAAGCTGGGGAGCCGG - Intronic
1077224723 11:1435001-1435023 CCGAGGCGCGGAGGGGGACCGGG + Intronic
1079459758 11:20669465-20669487 CGCAGCCGCAGCGGGGGGCCGGG + Intergenic
1080503833 11:32893349-32893371 CGGCGGGGTCGCGGTGGACCAGG + Intronic
1080668815 11:34358022-34358044 CGGCAGCACAGCTGGGTACCCGG + Intergenic
1081969240 11:47186524-47186546 CGGCGGGGCAGCGGGGCTGCAGG + Intergenic
1083397205 11:62400151-62400173 CTGGGGGGCAGTGGGGGACCCGG - Intergenic
1083554437 11:63614467-63614489 CGGCGGCGCGGGGAGGGGCCGGG - Intronic
1083670865 11:64299413-64299435 CGGCGGCGGGGCGGCGGGCCCGG - Exonic
1083936640 11:65872938-65872960 TGGCGGCGCCGCGGGGGACCGGG - Intronic
1083970452 11:66070860-66070882 CGGCGGGGCGCCGGGGGAGCGGG + Intronic
1087014620 11:93543227-93543249 CGGCGGCGGGGCGGGCGAGCCGG - Intronic
1090227082 11:125078131-125078153 CGGCGGTGCAGATGGAGACCTGG + Intronic
1090375166 11:126283163-126283185 GGGCGGGGTCGCGGGGGACCGGG + Intronic
1090699148 11:129279151-129279173 CGGCGGCGCGGCGGGGCCGCGGG - Intronic
1091823256 12:3491746-3491768 CGGCGGCGGCGCGGTGGTCCGGG - Intronic
1094680919 12:32666387-32666409 CGGCGGGGCGAGGGGGGACCAGG + Intergenic
1095261660 12:40105616-40105638 CGGCGGCGGCGTCGGGGACCTGG - Exonic
1096073565 12:48788930-48788952 GGGCGGCGGGGCGGGGGCCCAGG - Intronic
1096365485 12:51025886-51025908 CGTCGGCGCCGCAGGGGGCCGGG - Intronic
1102646240 12:114405685-114405707 CGGCGGTGAGGCGGGGGAGCAGG + Intronic
1102962059 12:117099339-117099361 CGGCTGCGCAGCGGCGGGACTGG + Exonic
1103649684 12:122422777-122422799 CGGCGGGGCGGCGCGGGGCCGGG - Intergenic
1105409560 13:20160796-20160818 CGGCGGCGCAGCGGAGCTGCCGG - Intronic
1113799446 13:113078692-113078714 CCGCGGCTCAGCGGGGGAGGAGG + Exonic
1117549093 14:56816747-56816769 GGGCGGCGCAGCTCGAGACCCGG - Intergenic
1118992638 14:70809718-70809740 CGGCGGCGCAGGGGGTGAGAGGG - Intergenic
1119500894 14:75126780-75126802 CGGCGGCGGCGCGGCGGAGCAGG - Exonic
1119848456 14:77847956-77847978 CTGGGGCTCAGCTGGGGACCAGG + Intronic
1120788018 14:88554710-88554732 CGGCCGCGCGGCGGGGCCCCGGG - Exonic
1122183492 14:99971975-99971997 CGGCGGCGGGGCGCGGGACGCGG - Intronic
1122436713 14:101705989-101706011 CCGCGGCGGACCGGGGGAACTGG - Intergenic
1122558127 14:102592439-102592461 GGGCGGCGGGGCGGGGGAGCGGG - Intergenic
1122657663 14:103273294-103273316 GGGCGAGGCCGCGGGGGACCCGG - Intergenic
1122942040 14:104985842-104985864 CGGCGGGGCCGCGCGGGACCAGG - Exonic
1122978564 14:105181092-105181114 CGGCGGGGGCGCGGGGGACGCGG + Intronic
1123004604 14:105315142-105315164 CGGGGGCGCGGGGGGCGACCTGG - Exonic
1124100551 15:26689139-26689161 AGGCGGGGCACTGGGGGACCTGG - Intronic
1124848009 15:33310695-33310717 CGGGGGCGGTGCGGGGGCCCTGG - Intergenic
1125541191 15:40471042-40471064 CGGCGCCGCAGCCCGGGAGCCGG + Exonic
1127789886 15:62390435-62390457 CCGCGGCGCCGCGCGGCACCGGG - Intergenic
1128139221 15:65286886-65286908 CGGCGGCGCGGCGGGAGGCGGGG - Intronic
1128153679 15:65378266-65378288 CCGCGGGCCAGCCGGGGACCTGG + Intergenic
1128547750 15:68579231-68579253 CCGCGGCGGAGCGGGGGCGCGGG - Exonic
1129082480 15:73052677-73052699 TGGCGGCGGAGCGGGGAGCCCGG + Exonic
1129336191 15:74853565-74853587 AGGCGGCGCAGTGGAGCACCAGG + Intronic
1130639287 15:85655726-85655748 CGGAGGCACAGCTGGGGGCCTGG + Exonic
1131144434 15:90002030-90002052 CGGCGGCGGCGCGGGAGGCCCGG + Intronic
1132099885 15:99015460-99015482 CGGGGGCGCAGAGGTGGAGCGGG + Intergenic
1132163694 15:99565485-99565507 CGGCGGCTGAGCGGCGGAGCGGG + Intronic
1132652226 16:1026688-1026710 CTGCCGCGGTGCGGGGGACCTGG - Intergenic
1132851505 16:2026929-2026951 CGGCGGCGGCGCTGGGCACCCGG - Exonic
1133040748 16:3058783-3058805 CGGCGGGGCGGGGAGGGACCGGG + Intronic
1136399795 16:30011068-30011090 CGGCGCGGCGGCGGGGGACGGGG + Exonic
1136625323 16:31458760-31458782 GGGCGGGGCGGCGGGGGAGCGGG - Intronic
1137655263 16:50153569-50153591 CGGCGGCCCTGCGGGCGGCCGGG + Intronic
1138105624 16:54285951-54285973 CGGCGGCAGCGCGGGGGCCCGGG - Exonic
1138619104 16:58197781-58197803 CGGCGGCGCGGCGGGGGACGCGG + Exonic
1138683840 16:58707268-58707290 CAGCGGCGCAGGGTGGTACCAGG - Exonic
1139433789 16:66925067-66925089 CGGCGGTGCAGCGGCGGGGCGGG + Exonic
1139534413 16:67562686-67562708 CGGCGGCGGAGCGGGCGCCGCGG + Exonic
1140663990 16:77212429-77212451 CGGGGGCGGAGCGGGGGACCTGG - Intronic
1142118930 16:88376497-88376519 CGGCGGCAGAGCGAGGGCCCCGG - Intergenic
1142671218 17:1488224-1488246 CGGCGGCGCGGCCCGGGAACTGG - Intronic
1142688856 17:1592858-1592880 CAGGGGAGCAGCGGGAGACCAGG + Intronic
1142711157 17:1724798-1724820 CGGCGGCGAAGAGGCGGACGGGG - Intronic
1143063325 17:4222102-4222124 CGGCGGTGCGGCGGGCGGCCAGG + Intronic
1143202653 17:5123034-5123056 CGGCTGCGCAGGGCTGGACCTGG + Exonic
1144828797 17:18120815-18120837 CGGCGGCGCGGGCGGGGGCCCGG - Exonic
1144870047 17:18363627-18363649 CTGCGGCGCAGCGGCGGGCAGGG + Intergenic
1146058703 17:29593551-29593573 CGGCGCCGGAGCCGGGGCCCGGG - Exonic
1147987510 17:44315026-44315048 CTGCGGCGGGGCGGGGGACGGGG + Intronic
1148755767 17:49972239-49972261 CGGTGCCGCCGCGGGGGATCTGG - Intronic
1149610532 17:57955335-57955357 CGGCGGCGCGGCTGGGGCGCGGG + Intergenic
1151370016 17:73641985-73642007 GAGCGGAGCAGCAGGGGACCTGG + Intronic
1152628649 17:81399793-81399815 CAGCGGCGCTGCGGTGGCCCAGG - Exonic
1153773399 18:8433098-8433120 CGGCGGCGGGGTGGGGGTCCAGG + Intergenic
1157794254 18:50560049-50560071 CGGCGGCGCAGGCTGGGGCCGGG + Intergenic
1157867267 18:51197438-51197460 AGGCGGCGGGGCTGGGGACCCGG + Intronic
1159914583 18:74177042-74177064 CGGCCGTGCAGCGGGGGCTCTGG - Intergenic
1160444230 18:78914589-78914611 CGGAGGCGCAGCGGGGAGCTTGG - Intergenic
1160706279 19:531693-531715 CGCAGGCGCAGCGGGGGGCGGGG + Exonic
1160717460 19:582767-582789 CGGCGGCGCAGACGTGGAGCAGG - Exonic
1160814442 19:1028688-1028710 CGGCCGGGCAGCGGGGGGGCGGG + Intronic
1160873122 19:1285959-1285981 CGGCGGCGGGGCGGGGCGCCGGG - Intergenic
1160933335 19:1581057-1581079 GGGTGGAGCAGCAGGGGACCAGG + Intronic
1161473397 19:4472460-4472482 GGGGGGGGCAGCGGGGGCCCCGG + Intronic
1161494747 19:4580943-4580965 CGGCTGCGCCGCTGGGGAGCTGG - Intergenic
1161594911 19:5146231-5146253 CGGCGGAGCGGGGGGGGTCCTGG - Intronic
1162036569 19:7943381-7943403 GGGCGGCGATGCGCGGGACCTGG - Intronic
1162041713 19:7974934-7974956 GGGCGGCCCAGCAGGGGAACAGG + Intronic
1162374429 19:10296361-10296383 GGGCGGCGCGGCGGGGGGCGCGG + Exonic
1162535835 19:11262466-11262488 CGGCGGCGGGGCCGGGGCCCGGG - Intronic
1163158155 19:15449971-15449993 CGGCGGCGCGCCGGGGGGGCGGG - Intergenic
1163708707 19:18832650-18832672 CGCGGCCGGAGCGGGGGACCCGG - Intronic
1164746831 19:30622680-30622702 CAGCTGCGTAGCGGGGAACCAGG - Intronic
1165419983 19:35717882-35717904 CAGCGCCGCCGCGGGAGACCGGG - Intergenic
1165721410 19:38082116-38082138 CGGGGGAGCCGCGGGGGGCCCGG + Exonic
1166304257 19:41928598-41928620 CGGCGGCGGCGCGGGGGAGGGGG + Intronic
1167139163 19:47637841-47637863 CGCCGCAGCAGCGGTGGACCTGG - Intronic
1167268247 19:48493874-48493896 CGGCGGGGCCGCGGGGCCCCGGG - Exonic
1167463853 19:49640040-49640062 CGGCCCCGGGGCGGGGGACCTGG - Exonic
1167561109 19:50226664-50226686 GGGAGGAGCAGCTGGGGACCAGG + Intronic
1167601728 19:50458875-50458897 AGGGGGCTCAGCGGGGGGCCGGG - Intronic
1167631747 19:50629977-50629999 CGGCGGAGCGGTGGGGGCCCAGG - Exonic
1168414477 19:56159788-56159810 CGGTGGCGCAGCAGGTGAGCTGG - Exonic
1168458942 19:56538424-56538446 CGCAGGCGCAGCGGCAGACCGGG - Intergenic
925927800 2:8682526-8682548 CGGCGGCGGGGCGGGGACCCCGG - Intronic
927159230 2:20242397-20242419 CCGCGGCGCAGGGGAGGGCCGGG + Intergenic
927180991 2:20446813-20446835 CTGCGGCGAAGGAGGGGACCCGG + Intergenic
927943317 2:27119064-27119086 CGCGGGCGCAGCGGGGGCGCTGG - Exonic
930089460 2:47521169-47521191 CGGCGGCGCAGCCGGGAGCCTGG + Exonic
930358213 2:50346856-50346878 CGGCGGCGCAGGGGGGCGCCTGG - Intronic
932180748 2:69643825-69643847 GGGCGGCGCGGCGAGGGACCGGG + Intronic
932231495 2:70087548-70087570 CGGCGGCGGAGGGGGCGAGCGGG - Exonic
932447216 2:71788274-71788296 TGGCGGCGCAGCAGCGGGCCTGG + Intergenic
934566971 2:95346583-95346605 CGGCGCGGCGGCGGGGGTCCCGG - Intronic
934728032 2:96637869-96637891 CTGCGGGGCAGCCGGGGTCCTGG - Intronic
937241749 2:120466382-120466404 CGGGGGCGTGGCTGGGGACCTGG + Intergenic
940300988 2:152176048-152176070 CGGCGGCGCGGCAGGGGGCGCGG + Intergenic
941666279 2:168246922-168246944 GGGCGGTGGAGCGGAGGACCAGG - Intronic
944413476 2:199463086-199463108 CGGCCGCGGGCCGGGGGACCGGG + Intronic
946702141 2:222424574-222424596 CGGCGGCGGAGCGCGGCCCCGGG + Exonic
948759878 2:240183878-240183900 GGGCGGGGCAGGGGGGGAGCAGG + Intergenic
1169065600 20:2692885-2692907 CGGCGGGGCGGCGCGGGAACCGG + Exonic
1170756806 20:19212488-19212510 CGGCGGCGCGGCGGGGGCGGCGG - Intergenic
1171458246 20:25283796-25283818 CGGCGGAGCAGCGCGGGAGCGGG - Intronic
1172978805 20:38926112-38926134 CGGCCGCGCAGCGGGGCGACCGG + Intergenic
1174045445 20:47729673-47729695 CGCCGGGGAGGCGGGGGACCAGG + Intronic
1174317284 20:49713145-49713167 CGGGCGCGCCGCGGGGGACTGGG + Intronic
1175267075 20:57709591-57709613 CGGCGGCGCGGCGCGGGGCGCGG + Exonic
1175887917 20:62302828-62302850 CGCCGGCGCGGGGGCGGACCGGG + Intronic
1176128965 20:63488219-63488241 CGGGGGCGGGGCGGGGGCCCGGG + Exonic
1176382581 21:6120656-6120678 CGGCGGCGCAGCCGGCAGCCGGG + Exonic
1176547642 21:8208534-8208556 CGGCGGCACCGCGCGGCACCCGG - Intergenic
1176555539 21:8252742-8252764 CGGCGGCACCGCGCGGCACCCGG - Intergenic
1176566593 21:8391581-8391603 CGGCGGCACCGCGCGGCACCCGG - Intergenic
1176574468 21:8435768-8435790 CGGCGGCACCGCGCGGCACCCGG - Intergenic
1176611081 21:8987060-8987082 CGGCGGCACCGCGCGGCACCCGG - Intergenic
1178334642 21:31732197-31732219 GGGCGGCGCAGGGCGGGACGAGG - Intergenic
1178351165 21:31873728-31873750 CGGCGGCGGCGCGGAGGACGCGG + Exonic
1178680702 21:34670162-34670184 CGGCGTAGAAGCGGGGGTCCCGG + Exonic
1178948440 21:36966759-36966781 CGGCGGGGGAGGCGGGGACCCGG + Intronic
1179661523 21:42879086-42879108 CCGCGGCGCCGGCGGGGACCGGG - Intronic
1179740888 21:43417583-43417605 CGGCGGCGCAGCCGGCAGCCGGG - Exonic
1180614766 22:17120221-17120243 CGGCGGCGCGGGGGGCGGCCTGG - Exonic
1182123248 22:27800114-27800136 CGGCGGCGCAGCCGGAGGCCTGG - Exonic
1183683774 22:39350215-39350237 CGGCGGCGCGGCGGCGGGCGAGG + Intronic
1184347746 22:43923884-43923906 CGGCGGCGGGGCGGGGGCGCGGG - Exonic
1185296781 22:50058520-50058542 CGGGGCCGCAGCGCGTGACCCGG - Intergenic
1203252516 22_KI270733v1_random:124819-124841 CGGCGGCACCGCGCGGCACCCGG - Intergenic
1203260572 22_KI270733v1_random:169905-169927 CGGCGGCACCGCGCGGCACCCGG - Intergenic
950484823 3:13266916-13266938 CAGGGGTGCAGCGGGGGCCCAGG - Intergenic
954076833 3:48187913-48187935 CGGCGGCGGTGCGGGGGCTCCGG + Exonic
954421217 3:50420008-50420030 CCGCGTCTCCGCGGGGGACCTGG - Intronic
956678078 3:71753871-71753893 CGGCGGCACAGCGGCGGCTCGGG + Intronic
960702543 3:120451485-120451507 CAGCAGGGCAGCGGGGCACCGGG + Intergenic
961013168 3:123449019-123449041 GGGCGGCTCGGCGGGGGTCCCGG + Exonic
966866521 3:184261479-184261501 CGGCGGCGGTGGCGGGGACCGGG + Intronic
967880358 3:194297256-194297278 CGTGGGCGCAGCGGGGGCCCGGG - Intergenic
968885868 4:3331852-3331874 CTGCGGCAGAGCTGGGGACCTGG + Intronic
972960473 4:44447508-44447530 CGGCGGCTCAGCAGGGGGCGAGG + Intronic
973774854 4:54233386-54233408 CGGCTGCGCTGTCGGGGACCAGG + Intronic
973996829 4:56467300-56467322 CGGCCCCGCACCGTGGGACCAGG + Exonic
975883607 4:78939397-78939419 CGCCAGCGCCGCGGCGGACCCGG + Exonic
976184110 4:82428981-82429003 CGCAGGCGCCGCGTGGGACCCGG - Intronic
976897416 4:90128273-90128295 CGGCGGCGAAGAGGGGGAAGGGG + Intronic
978384635 4:108167722-108167744 TGGCGGCGGCGGGGGGGACCCGG - Exonic
982157212 4:152535268-152535290 CGGCGGGGCCGGGGGGGACCCGG - Exonic
982157337 4:152535581-152535603 CGGCGGCAAGGCGAGGGACCCGG + Exonic
985629855 5:1008750-1008772 CGGGGGCGCTGCGGGGGCCGCGG + Intergenic
986315325 5:6583118-6583140 CCGCGGCGCCGCGCAGGACCCGG + Intergenic
987373802 5:17217140-17217162 AGGCGGCGCGGCGGGGGAAGGGG + Intronic
989011387 5:36876617-36876639 CGGCCGCGCCGCGCGGCACCCGG - Intergenic
992118501 5:73565689-73565711 CGGCGGCGCAGAGGCGGGTCAGG - Intronic
995733013 5:115265486-115265508 TGCCGGTGCAGCGGGGGACCTGG - Intergenic
998282326 5:140823491-140823513 CGGCGGCGCAGTGAGCGAGCTGG + Exonic
999366451 5:151026807-151026829 CAGCGGCACAGCGGGTGAGCCGG + Intronic
1001734904 5:173989595-173989617 CAGCGGGGCAGGGCGGGACCGGG + Intronic
1002160721 5:177312526-177312548 CGGCGGAGGGGCGGCGGACCCGG + Intronic
1002591053 5:180291926-180291948 CGGCGGCGGAGCCGGGGCCGCGG - Exonic
1002632629 5:180591346-180591368 CGGGGGCGCAGCGGGCGCCGAGG + Intronic
1002927248 6:1611576-1611598 CGGCGGCGGCGCGGGGGCCGCGG + Exonic
1004441923 6:15662553-15662575 CGGCGGCGCAGCGGAGCGCCCGG - Intronic
1005999744 6:30955695-30955717 CGGAGTCGCAGCGGGGGCTCCGG + Intergenic
1006606217 6:35259603-35259625 CCGCGGCGAAGCGGGGGGCGGGG + Intronic
1006770301 6:36547422-36547444 CGTCTCCGCGGCGGGGGACCGGG - Exonic
1007072835 6:39049175-39049197 CCGCGGGGCAGCGGGTGCCCGGG - Intronic
1007669473 6:43539576-43539598 CGGGGTCGCAGCCGTGGACCGGG - Intronic
1010142157 6:72623263-72623285 CGGGGAGGCAGCGGGGAACCTGG + Intronic
1016937253 6:149456612-149456634 GGGCGGCGGGGCGGGGGGCCGGG - Intronic
1016982237 6:149864098-149864120 CGGCCGCGCAGGAGGGGCCCAGG - Intergenic
1019198372 6:170295640-170295662 CGGCTGCGCCGCTGGAGACCCGG + Intronic
1019268073 7:130039-130061 CGGCGGGGCAGCCGGGGAAGCGG - Intergenic
1019343644 7:519695-519717 GGGCGGCGCAGCGAGGCCCCGGG - Intronic
1019473374 7:1232908-1232930 CGGCGGCGGAGACAGGGACCCGG - Exonic
1020023476 7:4883168-4883190 GCGGGGCGCAGCGGGGGAGCGGG - Intronic
1020023483 7:4883186-4883208 GGGGCGCGCAGCGGGGGAGCGGG - Intronic
1020275491 7:6622251-6622273 GGGCGGCGGAGCGGCGGTCCCGG + Exonic
1022427951 7:30285543-30285565 CGGCGGCGCCGCGGCGGCCGCGG + Exonic
1022698029 7:32728753-32728775 GGGCGGCGCCGCGGTGGCCCCGG + Intergenic
1025069676 7:55887590-55887612 CGCCGCCGCCGCGGTGGACCCGG - Intronic
1025929405 7:65982188-65982210 CGGTGGCCGAGCGGGGGACCGGG - Exonic
1026896575 7:74013163-74013185 AGGCGGCCCAGACGGGGACCAGG + Intergenic
1029123184 7:98281702-98281724 CGGCGGGGACGCGGCGGACCGGG - Exonic
1033200006 7:139360237-139360259 CGGCGGCGTAGCGGGCGGACGGG - Exonic
1033288591 7:140062661-140062683 GGGCGGCGCAGCCGCGGCCCCGG - Exonic
1034412246 7:150947667-150947689 CGGCGGCTCTCCGGGGGGCCTGG + Exonic
1034434760 7:151058146-151058168 CGGCGCCGCGGCGGGGCGCCCGG - Exonic
1034491546 7:151395714-151395736 CGGCAGTGCAGGGGGTGACCTGG + Intronic
1034560621 7:151877322-151877344 CCGCGGCGCGGCGGGGGGCGAGG - Intergenic
1034578932 7:152025942-152025964 CGGCGGCGGCGCGCGGGGCCTGG + Intronic
1038540385 8:28385960-28385982 CGGCGCGGCAGCCGGGGACGGGG - Intronic
1038554118 8:28494548-28494570 GGGCTGCGGAGCGGGGGCCCGGG + Intronic
1039476563 8:37841953-37841975 CGGGGGCGCGGCGGGGGCGCTGG + Exonic
1039921468 8:41896797-41896819 CGGCGGCGAAGCGGGGGGGCGGG + Intergenic
1041201118 8:55452567-55452589 AGGCGGTGCAGCGGGAGAACCGG - Intronic
1041355242 8:56993426-56993448 CGGCGGCGCGGCGGGGCCCGCGG - Exonic
1046044026 8:108942549-108942571 CGGGGGCACTGCAGGGGACCAGG - Intergenic
1048799732 8:138184690-138184712 CGGCATGGCAGAGGGGGACCAGG + Intronic
1049585216 8:143429866-143429888 CGGCGGCGGAGCGGACGACATGG - Exonic
1049635210 8:143684553-143684575 CGGAGGGGCGGCGGGGGACACGG - Intronic
1049762756 8:144338387-144338409 CGGCCGCGCCGCGCGGGTCCTGG + Intergenic
1050472375 9:6007414-6007436 GGGCCGCGCAGCGGGGGCCGGGG - Exonic
1052888831 9:33676994-33677016 CGGCGGCACATGGAGGGACCCGG - Intergenic
1053306108 9:36985988-36986010 CGGACGCGCAGCGTGGAACCGGG - Intronic
1057234266 9:93346331-93346353 CGGAGGCGGAGGCGGGGACCGGG - Exonic
1058413845 9:104764399-104764421 CGGCGGCGGCGCGGGGCCCCAGG - Intronic
1059145550 9:111896681-111896703 CGGCGCCGCAGCGGGCGCGCGGG + Intergenic
1060209096 9:121699477-121699499 GGGCGGCGGCGCGGGGGACCGGG - Intronic
1060811650 9:126614023-126614045 GCGCGGCGCAGCGGGGTCCCGGG - Intergenic
1061961783 9:133992398-133992420 CGGCGGCGCAGCGGGGGACCTGG - Intronic
1062261167 9:135663925-135663947 CTGGGGGGCAGCGGGGGCCCTGG + Intronic
1062421513 9:136484620-136484642 CGCCGGCCCAGCTGGGGACAAGG - Exonic
1062656340 9:137605976-137605998 CGGCGGCGCCGGGGAGGTCCGGG + Intronic
1062696335 9:137877978-137878000 CGGCGGCGGAGAGCGGGCCCGGG + Exonic
1203468919 Un_GL000220v1:107970-107992 CGGCGGCACCGCGCGGCACCCGG - Intergenic
1203476740 Un_GL000220v1:151942-151964 CGGCGGCACCGCGCGGCACCCGG - Intergenic
1185458646 X:323324-323346 CGCCGGGGCAGCGCGGGACGAGG + Intergenic
1186426087 X:9465193-9465215 CGGCGGCGGGGCGGGGGCGCTGG - Exonic
1186463350 X:9765626-9765648 CGGGGACGTCGCGGGGGACCCGG + Exonic
1190108409 X:47574409-47574431 CGGCGGCGCGGCCTGGGACGCGG + Exonic
1192265982 X:69538459-69538481 CGGAGGCGCAGCCGCGGAACTGG + Intergenic
1195668347 X:107449909-107449931 CGGCGGCGCAGCGGCGGCGGCGG - Intergenic
1197774237 X:130109748-130109770 CGGCGGCCCAGGAGGGAACCCGG + Intronic
1200746849 Y:6910823-6910845 CGGCGGGGCAGAGGCGGCCCAGG + Exonic