ID: 1061964295

View in Genome Browser
Species Human (GRCh38)
Location 9:134004454-134004476
Sequence CATGGGAGCTTGGACCATTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061964295_1061964304 -2 Left 1061964295 9:134004454-134004476 CCTGAATGGTCCAAGCTCCCATG No data
Right 1061964304 9:134004475-134004497 TGGGCTTACTCGGCAGAGGGTGG No data
1061964295_1061964309 25 Left 1061964295 9:134004454-134004476 CCTGAATGGTCCAAGCTCCCATG No data
Right 1061964309 9:134004502-134004524 GCTTCTCTCAAACACCAGTGGGG No data
1061964295_1061964303 -5 Left 1061964295 9:134004454-134004476 CCTGAATGGTCCAAGCTCCCATG No data
Right 1061964303 9:134004472-134004494 CCATGGGCTTACTCGGCAGAGGG No data
1061964295_1061964301 -6 Left 1061964295 9:134004454-134004476 CCTGAATGGTCCAAGCTCCCATG No data
Right 1061964301 9:134004471-134004493 CCCATGGGCTTACTCGGCAGAGG No data
1061964295_1061964308 24 Left 1061964295 9:134004454-134004476 CCTGAATGGTCCAAGCTCCCATG No data
Right 1061964308 9:134004501-134004523 CGCTTCTCTCAAACACCAGTGGG No data
1061964295_1061964307 23 Left 1061964295 9:134004454-134004476 CCTGAATGGTCCAAGCTCCCATG No data
Right 1061964307 9:134004500-134004522 CCGCTTCTCTCAAACACCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061964295 Original CRISPR CATGGGAGCTTGGACCATTC AGG (reversed) Intergenic
No off target data available for this crispr