ID: 1061964298

View in Genome Browser
Species Human (GRCh38)
Location 9:134004464-134004486
Sequence CGAGTAAGCCCATGGGAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061964298_1061964309 15 Left 1061964298 9:134004464-134004486 CCAAGCTCCCATGGGCTTACTCG No data
Right 1061964309 9:134004502-134004524 GCTTCTCTCAAACACCAGTGGGG No data
1061964298_1061964311 25 Left 1061964298 9:134004464-134004486 CCAAGCTCCCATGGGCTTACTCG No data
Right 1061964311 9:134004512-134004534 AACACCAGTGGGGCCACCCAGGG No data
1061964298_1061964308 14 Left 1061964298 9:134004464-134004486 CCAAGCTCCCATGGGCTTACTCG No data
Right 1061964308 9:134004501-134004523 CGCTTCTCTCAAACACCAGTGGG No data
1061964298_1061964310 24 Left 1061964298 9:134004464-134004486 CCAAGCTCCCATGGGCTTACTCG No data
Right 1061964310 9:134004511-134004533 AAACACCAGTGGGGCCACCCAGG No data
1061964298_1061964307 13 Left 1061964298 9:134004464-134004486 CCAAGCTCCCATGGGCTTACTCG No data
Right 1061964307 9:134004500-134004522 CCGCTTCTCTCAAACACCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061964298 Original CRISPR CGAGTAAGCCCATGGGAGCT TGG (reversed) Intergenic
No off target data available for this crispr