ID: 1061964300

View in Genome Browser
Species Human (GRCh38)
Location 9:134004471-134004493
Sequence CCTCTGCCGAGTAAGCCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061964300_1061964308 7 Left 1061964300 9:134004471-134004493 CCCATGGGCTTACTCGGCAGAGG No data
Right 1061964308 9:134004501-134004523 CGCTTCTCTCAAACACCAGTGGG No data
1061964300_1061964310 17 Left 1061964300 9:134004471-134004493 CCCATGGGCTTACTCGGCAGAGG No data
Right 1061964310 9:134004511-134004533 AAACACCAGTGGGGCCACCCAGG No data
1061964300_1061964307 6 Left 1061964300 9:134004471-134004493 CCCATGGGCTTACTCGGCAGAGG No data
Right 1061964307 9:134004500-134004522 CCGCTTCTCTCAAACACCAGTGG No data
1061964300_1061964311 18 Left 1061964300 9:134004471-134004493 CCCATGGGCTTACTCGGCAGAGG No data
Right 1061964311 9:134004512-134004534 AACACCAGTGGGGCCACCCAGGG No data
1061964300_1061964309 8 Left 1061964300 9:134004471-134004493 CCCATGGGCTTACTCGGCAGAGG No data
Right 1061964309 9:134004502-134004524 GCTTCTCTCAAACACCAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061964300 Original CRISPR CCTCTGCCGAGTAAGCCCAT GGG (reversed) Intergenic
No off target data available for this crispr