ID: 1061964309

View in Genome Browser
Species Human (GRCh38)
Location 9:134004502-134004524
Sequence GCTTCTCTCAAACACCAGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061964300_1061964309 8 Left 1061964300 9:134004471-134004493 CCCATGGGCTTACTCGGCAGAGG No data
Right 1061964309 9:134004502-134004524 GCTTCTCTCAAACACCAGTGGGG No data
1061964295_1061964309 25 Left 1061964295 9:134004454-134004476 CCTGAATGGTCCAAGCTCCCATG No data
Right 1061964309 9:134004502-134004524 GCTTCTCTCAAACACCAGTGGGG No data
1061964298_1061964309 15 Left 1061964298 9:134004464-134004486 CCAAGCTCCCATGGGCTTACTCG No data
Right 1061964309 9:134004502-134004524 GCTTCTCTCAAACACCAGTGGGG No data
1061964302_1061964309 7 Left 1061964302 9:134004472-134004494 CCATGGGCTTACTCGGCAGAGGG No data
Right 1061964309 9:134004502-134004524 GCTTCTCTCAAACACCAGTGGGG No data
1061964294_1061964309 26 Left 1061964294 9:134004453-134004475 CCCTGAATGGTCCAAGCTCCCAT No data
Right 1061964309 9:134004502-134004524 GCTTCTCTCAAACACCAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061964309 Original CRISPR GCTTCTCTCAAACACCAGTG GGG Intergenic
No off target data available for this crispr