ID: 1061964452

View in Genome Browser
Species Human (GRCh38)
Location 9:134005124-134005146
Sequence AAGCCAGCAGGTCCCTCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061964452_1061964458 3 Left 1061964452 9:134005124-134005146 CCCCAGGAGGGACCTGCTGGCTT No data
Right 1061964458 9:134005150-134005172 GGCCCTGCCGCCTCTTCTCCAGG No data
1061964452_1061964462 11 Left 1061964452 9:134005124-134005146 CCCCAGGAGGGACCTGCTGGCTT No data
Right 1061964462 9:134005158-134005180 CGCCTCTTCTCCAGGTGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061964452 Original CRISPR AAGCCAGCAGGTCCCTCCTG GGG (reversed) Intergenic
No off target data available for this crispr