ID: 1061964756

View in Genome Browser
Species Human (GRCh38)
Location 9:134006915-134006937
Sequence AATGGCTATGTCTATGGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061964756_1061964761 -9 Left 1061964756 9:134006915-134006937 CCCACACCATAGACATAGCCATT No data
Right 1061964761 9:134006929-134006951 ATAGCCATTGAATTCTTTTGGGG No data
1061964756_1061964762 -8 Left 1061964756 9:134006915-134006937 CCCACACCATAGACATAGCCATT No data
Right 1061964762 9:134006930-134006952 TAGCCATTGAATTCTTTTGGGGG No data
1061964756_1061964769 25 Left 1061964756 9:134006915-134006937 CCCACACCATAGACATAGCCATT No data
Right 1061964769 9:134006963-134006985 AAACCCCAGAGACTTTCACTGGG No data
1061964756_1061964768 24 Left 1061964756 9:134006915-134006937 CCCACACCATAGACATAGCCATT No data
Right 1061964768 9:134006962-134006984 GAAACCCCAGAGACTTTCACTGG No data
1061964756_1061964760 -10 Left 1061964756 9:134006915-134006937 CCCACACCATAGACATAGCCATT No data
Right 1061964760 9:134006928-134006950 CATAGCCATTGAATTCTTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061964756 Original CRISPR AATGGCTATGTCTATGGTGT GGG (reversed) Intergenic
No off target data available for this crispr