ID: 1061968806

View in Genome Browser
Species Human (GRCh38)
Location 9:134032138-134032160
Sequence GCCATATGGTCTTTGAGTAC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 72}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061968806 Original CRISPR GCCATATGGTCTTTGAGTAC GGG (reversed) Exonic
906294560 1:44641492-44641514 GCCATCTTGCCTCTGAGTACTGG + Intronic
907804077 1:57801176-57801198 GCCATATGGACTGTAAGTAAAGG + Intronic
912422817 1:109557364-109557386 ACCATATGGTCTTTTAGGGCAGG + Intronic
1063000727 10:1918752-1918774 GCCCTATGGTGTTTCAGTGCAGG - Intergenic
1064585249 10:16833531-16833553 GGCATATGGTCTTTGCATATGGG - Intronic
1067400331 10:45967449-45967471 TCCATATGGTGTTTGAGGAGAGG - Intergenic
1070389517 10:75957273-75957295 GCCATGTGGTCTTTGAACCCAGG + Intronic
1080722883 11:34867017-34867039 ACCGTATGATGTTTGAGTACCGG - Intronic
1092735798 12:11581279-11581301 TCTATATGGTTTTTGATTACAGG - Intergenic
1096037210 12:48482862-48482884 GCCAAAGGGTCTTTGAGTTCAGG - Intronic
1100328693 12:93566099-93566121 GCCATAAGGTCTGTCAATACTGG - Intergenic
1101439256 12:104691110-104691132 GCCATCTGTTCTTCGAGGACAGG - Intronic
1103222330 12:119256199-119256221 ACCATAAGGTCTTTGAGGGCAGG - Intergenic
1105659049 13:22472701-22472723 GCCAGATGGACTTTCAGCACTGG - Intergenic
1112487714 13:99834747-99834769 GCCACATGGTCTTTTAATACTGG - Intronic
1120238756 14:81924982-81925004 GCCACATGGTCTATGAGTTTAGG + Intergenic
1126408759 15:48350141-48350163 TCCATATGTTATTTGGGTACAGG - Intergenic
1128939791 15:71778680-71778702 GCCATATGGACTGTGAGTCATGG - Exonic
1134911118 16:18027351-18027373 GTCAAATGGTCTTTGAGGAAAGG + Intergenic
1136161541 16:28422879-28422901 GCCATATGGTTTTTAACTCCGGG - Intergenic
1136217768 16:28806302-28806324 GCCATATGGTTTTTAACTCCGGG + Intergenic
1140157070 16:72441618-72441640 TCCATATGGTCTTAGGGAACAGG + Intergenic
1140407529 16:74720834-74720856 GACATATGGTCTTTTATGACCGG + Intronic
1143974795 17:10821761-10821783 GCCCTCTGATCTTTGAGTGCAGG + Intergenic
1144230411 17:13197484-13197506 GTCATTTGGTCTACGAGTACTGG - Intergenic
1151807048 17:76412268-76412290 GGAATCTGGTCTTTGAGTCCTGG - Intronic
1156913413 18:42437858-42437880 GCCACATGGTTGGTGAGTACTGG + Intergenic
1159170250 18:64756927-64756949 GCCATATTGTCTATAAATACAGG - Intergenic
1165778944 19:38420959-38420981 GCCTTCTGGTATTTGAGTTCTGG + Exonic
925685676 2:6470551-6470573 GGCATGTGCTCTTTGAGTAGGGG + Intergenic
935899283 2:107773332-107773354 ACCATAGGCTCTTTGAGGACAGG - Intergenic
939111859 2:138018045-138018067 GCCATGTGGTCTTAGACTCCTGG - Intergenic
943560124 2:189451514-189451536 GCTATAAGGACTTTGTGTACAGG - Intronic
944360516 2:198850183-198850205 TCCATATGTTATTGGAGTACAGG - Intergenic
1169977439 20:11345927-11345949 GCCATGAGTTCTTTGAGTAAAGG + Intergenic
1173022739 20:39281756-39281778 GCCAGATACTCTTTGAGTACTGG + Intergenic
1173674775 20:44824172-44824194 GGCAGATGGTCTTAGACTACAGG - Intergenic
1173682729 20:44897539-44897561 ACCATAAGGTCTTTGAGATCAGG - Intronic
1174394394 20:50237673-50237695 GCCAAAGGGTCCTAGAGTACTGG + Intergenic
1179318490 21:40268370-40268392 GCCATATGGTCCTTGACTGTGGG - Intronic
1181635584 22:24172898-24172920 GCCACATGGTCCTAGAGTCCTGG - Intronic
1181955120 22:26582765-26582787 GGCAGATGGGCTTTGAGTCCTGG + Intronic
1182155546 22:28069027-28069049 TCCTTTTGGTCTCTGAGTACTGG - Intronic
956890425 3:73607767-73607789 GCCCTGTGGTCATTGAGTCCTGG - Intronic
958875887 3:99616779-99616801 ACCATATGCTCTTTGGGTAACGG + Intergenic
961667707 3:128504059-128504081 GCCATGTGGTATCTGGGTACAGG - Intergenic
964463391 3:156962566-156962588 GCCATGTGATCTTTGATCACTGG + Intronic
964793478 3:160474120-160474142 GCCATATGGTCAGTGAGTAATGG - Intronic
966094347 3:176180732-176180754 TCCATATGTTATTGGAGTACAGG + Intergenic
966169929 3:177068106-177068128 GCCATAAGCTCTTTGAGGGCAGG - Intronic
966765974 3:183463135-183463157 GCCATTGGGTATTTGAGTCCAGG - Intergenic
976401918 4:84616718-84616740 GCCATTTGCTCTTTGAGTCTTGG + Intronic
990728193 5:58779739-58779761 GGTAGATGGTCTTTGTGTACTGG + Intronic
991487477 5:67152600-67152622 GCCACATGGGCTTTGATGACTGG + Intronic
993337188 5:86675043-86675065 GCCATATGTTCCTTGAGAACAGG + Intergenic
995648621 5:114342431-114342453 GCCATATGGTGTGTGCGTATTGG + Intergenic
998969233 5:147573387-147573409 GCGCTATGGTCTCTGAGAACAGG + Intergenic
999299061 5:150479317-150479339 ACCGTATAGTCTTTGAGGACAGG + Intergenic
1005972613 6:30773211-30773233 GCCAGATGGTATGAGAGTACAGG + Intergenic
1014563712 6:122922218-122922240 GCCATATGCTCTTTGAGAGCAGG - Intergenic
1016389248 6:143558754-143558776 CCCAACTGGCCTTTGAGTACAGG + Intronic
1018701841 6:166433357-166433379 GACATATGGTTTCTGAGGACAGG + Intronic
1023407656 7:39852041-39852063 ACCATATGATATTTGAGTAAAGG - Intergenic
1024929064 7:54650714-54650736 GCCAGATGGCCTTTGTGTAGGGG + Intergenic
1024937295 7:54723236-54723258 GCCCTGTTGTGTTTGAGTACTGG - Intergenic
1026498142 7:70921068-70921090 GCCAGATGGTCTTTGACTTAAGG - Intergenic
1027864743 7:83631588-83631610 ACCATATAGTCTTTGAATATAGG + Intronic
1032563829 7:132919817-132919839 GCTATATGGTCTTTTAGAAGTGG - Intronic
1040447630 8:47511692-47511714 GGCAAATGGTCTTGGTGTACTGG + Intronic
1042989667 8:74624972-74624994 TCCATATGGTTTGTGAATACGGG - Intronic
1047785580 8:128151129-128151151 ACGATATGATCTTTGAGGACAGG + Intergenic
1050786501 9:9410214-9410236 TCCATATGGTATTTCAGTAATGG + Intronic
1052042861 9:23759427-23759449 GCCAGATGGTTAATGAGTACAGG + Intronic
1055631744 9:78231712-78231734 ACCATATGGTCCTTGAGGAAGGG - Intergenic
1059799293 9:117733728-117733750 GCCATGTGATCTTTGAGCAAGGG + Intergenic
1061883030 9:133577507-133577529 GCCATTTCGTTTTTGAGTAAGGG + Intergenic
1061968806 9:134032138-134032160 GCCATATGGTCTTTGAGTACGGG - Exonic
1194436150 X:93870673-93870695 CCCATATGGTTTTGGAGCACAGG + Intergenic
1195526224 X:105892996-105893018 GCAATATTTTCTTTGAGTACAGG - Intronic
1197419098 X:126215712-126215734 GCCATAGGCTCTTTGATTTCAGG + Intergenic