ID: 1061969511

View in Genome Browser
Species Human (GRCh38)
Location 9:134036310-134036332
Sequence TGCCCCAGACAGCTGAAGAA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 209}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061969511_1061969515 23 Left 1061969511 9:134036310-134036332 CCTTTCTTCAGCTGTCTGGGGCA 0: 1
1: 0
2: 0
3: 8
4: 209
Right 1061969515 9:134036356-134036378 AGTCTCCGTCTACCTGCCGTGGG 0: 1
1: 0
2: 0
3: 4
4: 36
1061969511_1061969513 -5 Left 1061969511 9:134036310-134036332 CCTTTCTTCAGCTGTCTGGGGCA 0: 1
1: 0
2: 0
3: 8
4: 209
Right 1061969513 9:134036328-134036350 GGGCAGGAGACAGAGCAACGTGG 0: 1
1: 0
2: 6
3: 48
4: 489
1061969511_1061969514 22 Left 1061969511 9:134036310-134036332 CCTTTCTTCAGCTGTCTGGGGCA 0: 1
1: 0
2: 0
3: 8
4: 209
Right 1061969514 9:134036355-134036377 GAGTCTCCGTCTACCTGCCGTGG 0: 1
1: 0
2: 0
3: 6
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061969511 Original CRISPR TGCCCCAGACAGCTGAAGAA AGG (reversed) Exonic
900087520 1:905442-905464 CTCCCCAGAGAGCTGAAGACTGG + Intergenic
900395753 1:2452614-2452636 TGCCCCAGAGAGCAGCAGATGGG + Intronic
902535727 1:17118507-17118529 TGTCCGAGACAGCTGAAGGTAGG - Intronic
903066771 1:20704121-20704143 TGCCACAGACAGCAGCAGACGGG + Intronic
903392319 1:22973055-22973077 TGCTCCAGGCTGGTGAAGAAAGG + Intergenic
907923350 1:58933194-58933216 TGTCCCAGGCAGCTGGAGGAAGG - Intergenic
908817822 1:68051881-68051903 TGCCCCAGCCAGCTGAGGCCAGG + Intergenic
909035265 1:70589310-70589332 TGCCCCAGAAAAGTGGAGAAGGG - Intergenic
909450737 1:75795727-75795749 TGCCCCAGCCTGGGGAAGAAAGG - Intergenic
909562712 1:77024047-77024069 GGCCCCAGGCAGCAGAGGAAAGG + Intronic
913975592 1:143452075-143452097 TGGCCCAGACACCTGCAGCATGG + Intergenic
914069987 1:144277692-144277714 TGGCCCAGACACCTGCAGCATGG + Intergenic
914109168 1:144688662-144688684 TGGCCCAGACACCTGCAGCATGG - Intergenic
914991239 1:152501290-152501312 TGCCCCAGGCAGCTGCATGAGGG - Intergenic
915969596 1:160344571-160344593 TGCCCAAGAAATCAGAAGAATGG + Intronic
916937183 1:169641451-169641473 TTCCCCATACAGCTTTAGAAAGG + Intergenic
917171930 1:172186317-172186339 TGACCTAGAGAGCTGAACAAGGG + Intronic
919184346 1:194125612-194125634 TGCCCCAGTCATCTGTAGATAGG - Intergenic
919854962 1:201698935-201698957 GGCCCCAGAAACCTGAAGACGGG + Intronic
920812748 1:209302694-209302716 CTTCCCAGACAGGTGAAGAAAGG - Intergenic
922176489 1:223201865-223201887 AGGCCCAGACAGCTGAACCATGG + Intergenic
923230845 1:231984800-231984822 TGGCCAAGACAGCTGAGGAAAGG + Intronic
923857980 1:237864973-237864995 TTCCCCAGACAGCAGGAGATGGG - Intergenic
924362491 1:243255765-243255787 TGGTCCAGGCAGCTGAAGAGTGG + Intergenic
924903947 1:248432467-248432489 TGCCCCAGAGGTTTGAAGAACGG + Intergenic
924923924 1:248659534-248659556 TGCCCCAGAGGTTTGAAGAACGG - Intergenic
1063445513 10:6112192-6112214 TGCCCCTGGCAGGAGAAGAAGGG - Exonic
1068587675 10:58817447-58817469 TGCCCTATTCAGCTGAACAATGG + Intronic
1068707688 10:60094989-60095011 ATCCCCAGACAGCTGGAGAGAGG + Intronic
1069970425 10:72163273-72163295 TGCCCAAGAGAACTGAAAAAGGG + Intronic
1072276688 10:93830152-93830174 TGCCCCAGTCAGCTGAACATTGG + Intergenic
1074697737 10:116065687-116065709 TGCCCTAGACAGCTGACTGATGG - Intronic
1075333615 10:121593413-121593435 TGCCCGAGAGAGCTGTGGAAGGG - Intronic
1076539717 10:131206387-131206409 GGCCCCAGACAGCCAAGGAAGGG + Intronic
1077300415 11:1844114-1844136 TGGCCCAGGCAGCTGGAGCAGGG + Intergenic
1077866849 11:6229511-6229533 TACCTCAGTCAGCTGAAGAAAGG + Intronic
1078728862 11:13957761-13957783 TGCTCCAGAGAGCAGAAGGAAGG + Intergenic
1082902937 11:58275849-58275871 TCCCCCAGAGAGATGATGAATGG - Intergenic
1084232080 11:67760600-67760622 TCCCCCAGAAAGGTGGAGAAGGG - Intergenic
1084500369 11:69531482-69531504 TGCCCCAGGCAGGTGCAGACAGG - Intergenic
1084646356 11:70460925-70460947 TGCCCCAGTCAACTGAGGATGGG + Intergenic
1084879009 11:72156306-72156328 AGCCCTAAACAGCTCAAGAAAGG + Intergenic
1084884195 11:72192705-72192727 AGCCCTAAACAGCTCAAGAAGGG + Intronic
1084958848 11:72705741-72705763 AGACCCAGACAGCTGTTGAATGG + Intronic
1085499979 11:77011348-77011370 TGCCCCTGAGAGCTGAAGATTGG + Intronic
1087127589 11:94642510-94642532 CCCCCCAGAAAGGTGAAGAAGGG - Intergenic
1090331837 11:125938789-125938811 TGACCCAGACATCTGAGGAGGGG - Intergenic
1091848536 12:3676960-3676982 TGCCCCAGATTTCTGGAGAAGGG + Intronic
1093519913 12:20036744-20036766 TGCCTTAGTCACCTGAAGAAAGG - Intergenic
1096771894 12:53940395-53940417 TGCCCCAGACACAGAAAGAAGGG + Intronic
1097037615 12:56134098-56134120 TACCCACCACAGCTGAAGAAGGG + Exonic
1099116772 12:78636434-78636456 TGCCTCAGACAACAAAAGAATGG - Intergenic
1099547115 12:83998173-83998195 TGTCCAAGGCAGCAGAAGAAAGG + Intergenic
1100207243 12:92363935-92363957 TCCCCCCGACAGCTGAATCAGGG - Intergenic
1102006013 12:109589748-109589770 GGCCCGAGACAGCTGGAGACGGG - Intronic
1102231560 12:111265995-111266017 TGCCCCAGACAGAGGAACAGTGG - Intronic
1104682214 12:130759931-130759953 TCACCCAGTCAGCTGAAGGAAGG - Intergenic
1108327486 13:49348202-49348224 TGCCCGAGACATCAGAGGAAAGG - Intronic
1110920638 13:81079872-81079894 TGACCCAGACAGATGAAAGAAGG - Intergenic
1113029950 13:105982360-105982382 TACCCCAGTCAGCTGCAGCAGGG - Intergenic
1113792527 13:113036697-113036719 TATCGCAGACACCTGAAGAAAGG - Intronic
1114403936 14:22436372-22436394 TGGCCCAGACAGATGAGGATGGG - Intergenic
1116059150 14:39898785-39898807 TGACCCAGACACCTCAGGAATGG + Intergenic
1117464126 14:55975427-55975449 TGTCCCAGAAAGGTCAAGAAGGG + Intergenic
1119187060 14:72650544-72650566 TGCACCTGACAGCTGAGGATAGG + Intronic
1121647167 14:95526320-95526342 TGCCCCCGAGAACTGGAGAAGGG - Intergenic
1122088759 14:99324176-99324198 TGCCACAGACAGCTGAAAGGTGG - Intergenic
1124222742 15:27864107-27864129 TGCCCCGGACAGGTGCACAATGG - Intronic
1126895789 15:53255926-53255948 TGCCTGAGACAGCTGCAGAGTGG + Intergenic
1127363834 15:58268558-58268580 GGCCTCACACAGCTGCAGAAAGG - Intronic
1128182911 15:65620815-65620837 TGGCCCAGAAAGATGAAAAAAGG - Intronic
1128291207 15:66479764-66479786 TGCCCCAATCAGCTGCAGGAGGG - Intronic
1128547252 15:68576692-68576714 TGCCCAAGACAGCTGAGACAGGG + Intergenic
1129754107 15:78085594-78085616 TGCTCATGACAGCTGGAGAAGGG - Intronic
1135322623 16:21507374-21507396 AGCCCCAGCCAGCTGCAGAGGGG - Intergenic
1135863139 16:26075664-26075686 TACCCCAGCCAGCTGAGAAAAGG - Intronic
1136297491 16:29311986-29312008 TGCCCCAGCCATCTGCAGAGCGG - Intergenic
1136334100 16:29600511-29600533 AGCCCCAGCCAGCTGCAGAGGGG - Intergenic
1136346558 16:29679595-29679617 TCCCCCACCCAGCTGCAGAAGGG - Intronic
1142034868 16:87856603-87856625 AGCCCCAGCCAGCTGCAGAGGGG - Intronic
1142059045 16:88018063-88018085 TGCCCCAGCCACCTGCAGAGCGG - Intronic
1142310224 16:89307852-89307874 TCCACCAGACATCTGAAGAGAGG + Intronic
1142716119 17:1747888-1747910 TGGCCCAGACTGAGGAAGAAAGG - Intronic
1147359853 17:39923739-39923761 TGCTCCTGAGAGCTGAACAAAGG - Intronic
1148159327 17:45441216-45441238 TGCCCCAGACATCTGGGGACAGG + Intronic
1148912781 17:50951997-50952019 TGCCCCTGAAAGCAGAGGAAGGG - Intergenic
1149197449 17:54138043-54138065 AGACCCAAACAGCTGATGAAAGG + Intergenic
1149678998 17:58491319-58491341 TGCCCCAAACAGCAATAGAAAGG - Exonic
1150390664 17:64788300-64788322 TGCCCCAGACATCTGGGGACAGG + Intergenic
1152535533 17:80948574-80948596 GGCTCCAGACAGCAGTAGAAGGG + Intronic
1153315344 18:3715896-3715918 TGCCTCTGACATCTGAAGAGGGG + Intronic
1155014608 18:21820739-21820761 TGCCCCAAAAAGCTGTTGAAAGG - Intronic
1157393188 18:47320162-47320184 TGCTGCAGACAGTTGAAAAAAGG - Intergenic
1161674159 19:5633932-5633954 AGCCAAAGACAGCTTAAGAAAGG + Intronic
1165217764 19:34288784-34288806 TGTCCCTGTAAGCTGAAGAAGGG + Intronic
1165592286 19:36979430-36979452 TACCTCTGACAGCTAAAGAAGGG - Intronic
1166738703 19:45101407-45101429 AGCCCCAGAGGGCTTAAGAAGGG + Intronic
1167442396 19:49515952-49515974 TGCCCTACAGAGCTGAGGAAAGG - Intronic
926010201 2:9400917-9400939 TGCCCCAGCCAGGGGAAGAGGGG - Intronic
926448933 2:12978696-12978718 TGCCCCAGGCAACTGAAGTTAGG - Intergenic
927384918 2:22521817-22521839 GGCTCCAGACAGCTTTAGAATGG - Intergenic
928996986 2:37303260-37303282 TCCCCCAGACACTTGAAGGATGG - Intronic
929134367 2:38608998-38609020 TGCTTCAGAAAGCTGAAGATAGG - Intergenic
929597570 2:43185977-43185999 TGCCACAGACAGCTGTGAAATGG - Intergenic
932135193 2:69222701-69222723 TGCCTCAGACTCCTGCAGAAGGG + Intronic
932271475 2:70413788-70413810 TTCCCCAGAGAGCTGAGGACTGG + Intergenic
932680682 2:73822128-73822150 TGCCCCAAGCAACTGAAAAATGG - Intergenic
932705367 2:74020534-74020556 TGCCCCAGACAGCTCCATCAAGG - Intronic
932971998 2:76555176-76555198 TGTGCCAGACAGCAGAAGCAAGG + Intergenic
934180292 2:89613047-89613069 TGGCCCAGACACCTGCAGCATGG + Intergenic
934290591 2:91687310-91687332 TGGCCCAGACACCTGCAGCATGG + Intergenic
934706335 2:96484254-96484276 TGCCCATGGCAGCTGTAGAAAGG - Intergenic
934904931 2:98191780-98191802 TGCTCCAGAGATCTGCAGAAGGG - Intronic
937818935 2:126286537-126286559 TGCACCTGACATCTGAAGCAGGG - Intergenic
938768578 2:134480662-134480684 TGGTGCAGACAACTGAAGAACGG + Intronic
939199915 2:139020720-139020742 AGCCACAGACACCTGAAGCAAGG - Intergenic
940015589 2:149100912-149100934 TGCCACAGACAGCTGACGGCAGG - Intronic
942493296 2:176511220-176511242 TGCCCCAGTCATCTAAAGTAAGG - Intergenic
942735255 2:179103184-179103206 TGCCCCAGACAGCTCCTCAAGGG - Exonic
944514270 2:200496214-200496236 TGCCTTAGAAAGCTGAAGGAGGG - Intronic
944672677 2:202008166-202008188 AGAATCAGACAGCTGAAGAAAGG + Intergenic
947770737 2:232668304-232668326 TACCCCAGCCAGTTAAAGAAGGG - Intronic
948369987 2:237482795-237482817 TCCCCCACCCAGCTGAACAACGG + Intergenic
948756815 2:240164897-240164919 TTCCCCAGCCAGAGGAAGAAGGG + Intergenic
1168874916 20:1164765-1164787 TACCCAAGACTGCTGAAGAAAGG - Intronic
1170381250 20:15761936-15761958 TGTCCCACACAGCTGTTGAAAGG - Intronic
1171993912 20:31717753-31717775 TGAGCCATACAGCTTAAGAAAGG + Intronic
1172939759 20:38646200-38646222 GACCCCAGACAGGTGGAGAAGGG + Intronic
1174304396 20:49604806-49604828 TCCCCCATGCAGATGAAGAACGG - Intergenic
1176789402 21:13302016-13302038 TGCCTCAGAAAACTGCAGAACGG - Intergenic
1181823572 22:25494765-25494787 TGGGCAAGCCAGCTGAAGAAAGG - Intergenic
1182535843 22:31002404-31002426 TTTCCCAGACAGCTAATGAAGGG + Intergenic
1183023544 22:35046606-35046628 TCCCCCAGAAACCTGGAGAAAGG - Intergenic
1183538695 22:38417489-38417511 AGCCCCAGACACCTGGAGACTGG + Intergenic
1184549632 22:45197574-45197596 TGCGCCAGAAAGGTGAACAAAGG + Intronic
949455209 3:4230760-4230782 GCCCCCAGACAGCTTCAGAATGG - Intronic
951771177 3:26259268-26259290 TGCCATAGACAGCTGAAACATGG - Intergenic
953339057 3:42118587-42118609 AGCCCCAGTCAGGTGGAGAATGG + Intronic
960223186 3:115141332-115141354 TCCCCCAAACAGCTCAGGAATGG + Intronic
960704413 3:120468387-120468409 TGAGGCAGACAACTGAAGAAAGG + Intergenic
963048669 3:141123876-141123898 TGCCCCAGGGAGCTGCACAATGG - Intronic
963456894 3:145555974-145555996 CCCCCCAGAAAGGTGAAGAAGGG + Intergenic
964051065 3:152394585-152394607 TGCCACAGAGTGCTGAATAAAGG - Intronic
964529049 3:157647368-157647390 TGCCCAAGACAGCTCAGAAATGG + Intronic
967525443 3:190487407-190487429 TGCCCAAGAGAGCTGAAAATAGG - Intergenic
969828989 4:9780590-9780612 TGGCCCAGACACCTGCAGCATGG - Intronic
971327547 4:25656504-25656526 TCCCCAAGACGGCTGAAGGACGG - Intronic
972410003 4:38784116-38784138 TGCCCCACCCAACTGATGAAAGG - Intergenic
972973631 4:44607187-44607209 AGCCCCAGAAAACTGAAGGATGG - Intergenic
976178568 4:82377930-82377952 TGCCCCAAACAGTAGAAGGAAGG + Intergenic
976322588 4:83732749-83732771 TGCCCCTCATGGCTGAAGAATGG + Intergenic
982257745 4:153466708-153466730 TGCCCCGTACAGCTGGAGAGCGG + Intronic
985552671 5:541407-541429 TGCCCCGGACAGGTCAAGGAAGG + Intergenic
985629400 5:1006918-1006940 TGCCCCAGCCAGGTGGGGAAGGG - Intergenic
985764123 5:1768017-1768039 GGCCCCAGACTGGTGAAGGAGGG - Intergenic
986309639 5:6542768-6542790 GGCCCCATGCAGCTGGAGAAGGG - Intergenic
986696331 5:10359196-10359218 TGCTCCAGGAAGCTGAAAAAAGG + Intronic
993464707 5:88230855-88230877 GGCCCCAGATAGCTGCAGGATGG + Intronic
995567650 5:113448261-113448283 TGCACCAGAAAGGAGAAGAATGG - Intronic
999720359 5:154394791-154394813 TGCCTCGGACAGCTGCAGCATGG + Intronic
1001819413 5:174698380-174698402 GGCCACAGACAGCTGAACAAAGG - Intergenic
1002976770 6:2086547-2086569 TCCCCGAGTCAGCTGCAGAACGG - Intronic
1003967967 6:11271361-11271383 TGCCAAAGGCAGCTGAAGCAGGG - Intronic
1004250749 6:14021498-14021520 TGCCCAAGACATTTGATGAAAGG + Intergenic
1004575008 6:16886894-16886916 TCCCCCAGAAAGGTGGAGAAGGG - Intergenic
1006719839 6:36142965-36142987 TGCCCCCCACAGCAGGAGAATGG - Intronic
1007947634 6:45840303-45840325 TGACCCAGCCTGCTGAGGAATGG + Intergenic
1012247664 6:96943782-96943804 TGCCCCAGCCATCTGGGGAAGGG + Intronic
1012322633 6:97869140-97869162 TTCCCCAAACAGCTGAAGGTTGG - Intergenic
1017667254 6:156732230-156732252 TTCCCCAATCAGCTCAAGAAAGG - Intergenic
1023135086 7:37043400-37043422 TGCCCCAGAAAGCAGAGGAGTGG + Intronic
1024155866 7:46624547-46624569 TGCCCCAAACATGTGAAGATAGG + Intergenic
1024259100 7:47560556-47560578 TGCCCCTGACAGCAGCAGAGAGG - Intronic
1025995205 7:66523434-66523456 TGCCCCAGATAGATGGAGGAAGG + Intergenic
1026535151 7:71233057-71233079 AGGTCCAGAGAGCTGAAGAAGGG + Intronic
1027687108 7:81292275-81292297 TGACCCAATCAGCTGAACAAAGG + Intergenic
1028756652 7:94442778-94442800 TGCCCCAGACAGCTGCATTGGGG - Intergenic
1028830599 7:95323221-95323243 TGACCCAGACAGAGGAAGGAAGG - Intronic
1029523186 7:101077484-101077506 TGTGCCAGGCAGCTGGAGAAGGG - Intergenic
1030078053 7:105753634-105753656 TACAGCAGACAGCTGAAGACAGG + Intronic
1031539824 7:122980802-122980824 TGCCTCAGACACCTGAATACTGG + Intergenic
1032515470 7:132503372-132503394 TGCCCCAGGAAGGTGAAGAAAGG + Intronic
1033928128 7:146489075-146489097 GGCCCCAAACTGCTGAAAAATGG - Intronic
1034075009 7:148222885-148222907 TGCCCAAGACAACTGACAAAAGG - Intronic
1034972007 7:155425047-155425069 TGCCTCATACAGCTGCAGCATGG + Intergenic
1036290525 8:7485499-7485521 GCCTCCAGAGAGCTGAAGAAAGG - Intronic
1036330962 8:7826038-7826060 GCCTCCAGAGAGCTGAAGAAAGG + Intronic
1040518850 8:48158128-48158150 TGTCCCAGACATCAGAGGAAAGG - Intergenic
1041008970 8:53523081-53523103 TGCTTCAGGGAGCTGAAGAAAGG - Intergenic
1042102212 8:65285618-65285640 TCCCACAGACAGCAGAAAAAGGG + Intergenic
1042227015 8:66522101-66522123 TGACTCAGGCAGCTGAAGACAGG + Intergenic
1044144574 8:88695944-88695966 TGCCCCAAACAGACGAAGCAAGG - Intergenic
1051428677 9:16960319-16960341 TGCCCAAGTCAGCTGACAAATGG - Intergenic
1053130098 9:35609711-35609733 TGCCCCAGGCAGCTGCAGGCTGG - Exonic
1053296215 9:36914760-36914782 TGCCCCAAAAAGCAGAGGAAAGG + Intronic
1055130752 9:72771440-72771462 TGACACTCACAGCTGAAGAAGGG - Intronic
1056712965 9:89006218-89006240 TGCACCAGACAGATCATGAAGGG + Intergenic
1058185367 9:101848368-101848390 AACCCCAGAAAGGTGAAGAATGG - Intergenic
1059532281 9:115046600-115046622 TGTCCTGGACAGCTGATGAAGGG - Exonic
1060521394 9:124296068-124296090 TGCCCCAGGGAGCTGAAGATCGG - Intronic
1060662421 9:125412085-125412107 TGCCCCAGACAGCAGAGAGATGG + Intergenic
1061151197 9:128829287-128829309 TGCCCCAGAAAGCGGCAGGAGGG + Intronic
1061517600 9:131098533-131098555 AGCCACAGACAGCTGGAGATGGG + Intronic
1061526712 9:131171251-131171273 TGCCTCAGAAAGGTGAAGGAAGG + Intronic
1061781588 9:132999458-132999480 TGGCCCAGAGAGCGGGAGAAAGG + Intergenic
1061969511 9:134036310-134036332 TGCCCCAGACAGCTGAAGAAAGG - Exonic
1185572853 X:1147672-1147694 GGCCCCAGAGAGCTGGTGAATGG - Intergenic
1186920110 X:14269495-14269517 TGTCTCAGTCAGCTGAAGCATGG - Intergenic
1188944738 X:36285492-36285514 TTGTCAAGACAGCTGAAGAAAGG - Intronic
1189862930 X:45291885-45291907 TGGCCCAGAAAGCTGAAAACAGG + Intergenic
1190063928 X:47227424-47227446 TCCCCCAGACTGAGGAAGAATGG - Exonic
1195106016 X:101601816-101601838 TGCCACAGACAGCACTAGAACGG - Intergenic
1195106867 X:101611951-101611973 TGCCACAGACAGCACTAGAACGG + Intergenic
1197159355 X:123306623-123306645 AGCCTCAGCCAGCTGAAGATAGG + Intronic
1198202646 X:134437231-134437253 GGCAGCAGACAGCTGAAAAATGG + Intergenic
1199267270 X:145843341-145843363 TGCCTCACACAGCAGCAGAAAGG + Intergenic
1200072221 X:153534912-153534934 TGGCCCAGAGCCCTGAAGAAAGG - Intronic
1201703641 Y:16911390-16911412 TGCCGCAGCCATGTGAAGAAGGG + Intergenic