ID: 1061971890

View in Genome Browser
Species Human (GRCh38)
Location 9:134049576-134049598
Sequence GAAACAGCCCCCACTGGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061971884_1061971890 1 Left 1061971884 9:134049552-134049574 CCGTGGCAAATGGGACATGCTCC 0: 1
1: 0
2: 0
3: 13
4: 244
Right 1061971890 9:134049576-134049598 GAAACAGCCCCCACTGGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061971890 Original CRISPR GAAACAGCCCCCACTGGGGG AGG Intronic
No off target data available for this crispr