ID: 1061972657

View in Genome Browser
Species Human (GRCh38)
Location 9:134053349-134053371
Sequence CTGCATGTACTGCAGCTGGT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 140}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061972653_1061972657 1 Left 1061972653 9:134053325-134053347 CCAGAGCGTCTTCACCACCACAT 0: 1
1: 0
2: 0
3: 7
4: 95
Right 1061972657 9:134053349-134053371 CTGCATGTACTGCAGCTGGTTGG 0: 1
1: 0
2: 2
3: 11
4: 140
1061972652_1061972657 19 Left 1061972652 9:134053307-134053329 CCAGGCGAACTGGTGTTTCCAGA 0: 1
1: 0
2: 0
3: 5
4: 79
Right 1061972657 9:134053349-134053371 CTGCATGTACTGCAGCTGGTTGG 0: 1
1: 0
2: 2
3: 11
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061972657 Original CRISPR CTGCATGTACTGCAGCTGGT TGG Exonic
900106220 1:982238-982260 CCTCATGTACTGTAGCTGGAGGG - Intergenic
901323819 1:8355523-8355545 ATGCATGGCCTGCAGCTGGTGGG + Exonic
904983428 1:34525508-34525530 CTGCATGGCCTGTAGCAGGTAGG + Intergenic
906247938 1:44290180-44290202 GTGCCTGTCCTGGAGCTGGTGGG - Intronic
908034309 1:60035351-60035373 ACCCATTTACTGCAGCTGGTAGG + Intronic
910456999 1:87408399-87408421 CTGCTTGTACTTCAGCAAGTGGG + Intergenic
916422048 1:164646780-164646802 CTGCATGTACTGAAATTGGGTGG - Intronic
919752791 1:201048674-201048696 CTCCCTGTACAGCGGCTGGTGGG - Exonic
920009879 1:202859998-202860020 TTGCCTGTACTGCAGTTGGCAGG - Intergenic
920053948 1:203179571-203179593 CTTCAGGTACTGCACCTGGCAGG + Exonic
1066656925 10:37705103-37705125 CTGCATGTCTTGTGGCTGGTGGG + Intergenic
1067041456 10:42955341-42955363 CTACATGTCCTGTGGCTGGTGGG + Intergenic
1071427292 10:85571669-85571691 CTGCTTTTACAGAAGCTGGTTGG - Intergenic
1071451288 10:85793292-85793314 CTGGATGGACAGCAGCTGCTAGG - Intronic
1071498608 10:86188131-86188153 CTACATGGACTGCAGCAAGTTGG + Intronic
1072615501 10:97046692-97046714 CCGGATGGACTCCAGCTGGTTGG + Exonic
1075701560 10:124473123-124473145 CTGCAGGTGCTGCCTCTGGTTGG + Intronic
1076629453 10:131843426-131843448 TTGCAGGGGCTGCAGCTGGTTGG - Intergenic
1081549799 11:44100651-44100673 CCGCATCTCCTGCAGCTGGAGGG + Intronic
1081777760 11:45687754-45687776 CTGCCTGTGTTGCAGCTGGCTGG + Intergenic
1083985379 11:66211159-66211181 CAGCATGATCTGCAGCTTGTTGG - Exonic
1084087541 11:66861514-66861536 CTGCATGTTCTGGGGCTGGGAGG - Intronic
1088746077 11:112806102-112806124 CAGCAGGTGCTGCAGCAGGTGGG + Intergenic
1090770063 11:129912124-129912146 CTGGATGTGCTGCACCTGGATGG + Exonic
1090839591 11:130476517-130476539 CTCCATGTACTGCAGAAGGATGG + Exonic
1092004647 12:5059086-5059108 CTGCATGTGCGGAACCTGGTAGG - Intergenic
1092524637 12:9302244-9302266 CTCCATGTACTGCAGCAGCTGGG - Intergenic
1092542628 12:9429568-9429590 CTCCATGTACTGCAGCAGCTGGG + Intergenic
1092934272 12:13346089-13346111 CTGCATCTACTTCTGCTGGGAGG + Intergenic
1094510384 12:31092862-31092884 CTCCACGTACTGCAGCAGCTGGG - Exonic
1095981144 12:47975483-47975505 CCGCATGTACTGCAGGGGGTCGG + Exonic
1099051169 12:77783276-77783298 CTCCATGTACTCCATCTGGGAGG - Intergenic
1104082123 12:125438397-125438419 CTGCATGTATAGCAGATCGTGGG - Intronic
1107632253 13:42354587-42354609 CTACATGTACTGCAGAAGGTTGG - Intergenic
1108682345 13:52790804-52790826 CGGCATGTAGTGCAGCGGGGAGG - Intergenic
1113387019 13:109858212-109858234 CTGCATGTTTTGCAGCTTGCGGG + Intergenic
1113596339 13:111536832-111536854 CGGGTTGTACTGCAGATGGTGGG - Intergenic
1119171008 14:72536507-72536529 CTGCATGTTCTGCCCATGGTGGG + Intronic
1121380068 14:93457377-93457399 ATGCATGTAATGCAGTTTGTGGG + Intronic
1122249367 14:100427277-100427299 ATGCATCTAATGCAGCTGGGGGG - Intronic
1122475831 14:102008275-102008297 CTGTATGCACTGCACCTGCTGGG - Exonic
1124180526 15:27469029-27469051 CTGAATCTACTGCTGTTGGTTGG - Intronic
1125081655 15:35681160-35681182 ATGCATGTGCTGCTGCTGTTTGG + Intergenic
1125729217 15:41883348-41883370 CTGCAGCTCCTCCAGCTGGTGGG + Exonic
1126583995 15:50265528-50265550 CTGCAGGAACGGCTGCTGGTGGG - Intronic
1129526737 15:76222601-76222623 CAGCAGGTACTACAGCTGGGTGG - Intronic
1130314185 15:82781266-82781288 CTCCATGTTCTGCATATGGTGGG + Intronic
1132479039 16:157042-157064 CTGCATGTACTCCGGATGTTGGG - Intronic
1136176535 16:28520931-28520953 CTGCAGGTGATGCAGCTTGTGGG + Intergenic
1136622223 16:31436776-31436798 CTGCCGGTGCTGCAGCAGGTAGG + Exonic
1140171877 16:72613395-72613417 CTGCATGCACAGCATCTGGAAGG + Intergenic
1142913734 17:3116661-3116683 CTGCATGTTCTGCAGCAATTTGG - Intergenic
1142946488 17:3433584-3433606 CTGCATGTTCTGCAGCAATTTGG + Exonic
1143697574 17:8631284-8631306 CGGCATGTACCGCAGCGGGACGG + Intergenic
1144519103 17:15942620-15942642 CTGCACGCCCTGCAGCTGCTGGG - Intergenic
1144676399 17:17165049-17165071 GTGCATGCTCTGCAGCTGGCTGG - Intronic
1148703974 17:49611532-49611554 CTGAATGTACTACAGCAGTTAGG - Intronic
1149731299 17:58948972-58948994 ATGCATATTCTGCAGCTGTTGGG + Intronic
1151381712 17:73730243-73730265 CTGCATCAACTGCATCTGGGTGG - Intergenic
1152746572 17:82043045-82043067 GTGCATGCACTGCAGCTGACAGG + Intergenic
1153104444 18:1510989-1511011 GTGCATGCACTGCTGATGGTAGG + Intergenic
1157599846 18:48887204-48887226 CTGCATCTGCTGCTGCTGGCAGG + Intergenic
1161735549 19:5990234-5990256 CTGCAGATACCGCAGATGGTGGG - Intergenic
1163713502 19:18860927-18860949 CTGCATGTACTGCACCAGGTAGG - Exonic
1166941239 19:46367384-46367406 CTGCATGTAATGTTGCTGCTTGG + Intronic
1167503521 19:49860128-49860150 CTGCAGGACCTGCTGCTGGTTGG - Exonic
925197656 2:1939788-1939810 CTGCAGGTACTCCAGCTGGATGG - Intronic
928965738 2:36973542-36973564 CTTCATGTCCTGCAGCTGAGGGG - Intronic
934788162 2:97031470-97031492 CTGCATGCACGGCAGTTGGCAGG + Intergenic
935075237 2:99736100-99736122 ATGCATATTCTGCAGCTGTTGGG + Intronic
936838237 2:116734702-116734724 ATGCATATTCTGCAGCTGCTGGG - Intergenic
937092867 2:119218115-119218137 CTGCATGGACTGCCCCTGCTGGG + Intergenic
938644447 2:133316706-133316728 CTGCCTCTACTGCCGCTGGGTGG + Intronic
938929935 2:136077797-136077819 GTCCATGTACTGCAGCTACTAGG + Intergenic
940857090 2:158737965-158737987 CTGCAGGTCCTGCAGCAGGGAGG - Intergenic
941752349 2:169146572-169146594 CTGCATTTAATTCAGCAGGTGGG + Intronic
1170986761 20:21266090-21266112 CTGCATGTGCTGCAGATGAAGGG - Intergenic
1171983691 20:31644810-31644832 CAGCATGCGCTGCAGCTGCTGGG - Exonic
1172035130 20:32005222-32005244 CTGGCTGGACTGCAGCTGGGTGG + Intergenic
1172518813 20:35554358-35554380 CAGCATGTACTGCAGCATGGGGG - Exonic
1173295353 20:41750415-41750437 CTGTATGGGCTGCAGCTGGACGG + Intergenic
1179189710 21:39113437-39113459 CTGCATATACTACATCTGTTTGG + Intergenic
1181087805 22:20450764-20450786 CTGCATATACTGTAGCAGGCTGG - Intronic
1181104630 22:20566636-20566658 ATGCATCTGCTGCAGCTGCTGGG - Exonic
1181324308 22:22032927-22032949 ATGCATGCACTGCAGGTGGCTGG - Intergenic
951094063 3:18608087-18608109 CTGCATAAAATGCAGCTGATGGG - Intergenic
953147821 3:40295032-40295054 ATGGATGTGCTGCAGCTGGTGGG - Intergenic
954218479 3:49137821-49137843 CTGGATTTGCTGCAGCTGGTGGG + Intergenic
954590337 3:51777293-51777315 CTGCAGCTACTGCAGATGATGGG + Intergenic
955949413 3:64227002-64227024 CTTCAGGAACTGCAGCTGGAAGG - Intronic
960687410 3:120307888-120307910 CTGCAGGACCTGCTGCTGGTAGG - Intergenic
961726222 3:128932754-128932776 CTGCAGGTACTTCTCCTGGTGGG + Exonic
963852660 3:150223941-150223963 CTTCATCTCCTGCAGCTGGAAGG + Intergenic
964199713 3:154105464-154105486 CTGCAAGCACTGCAGCTGGCAGG - Intergenic
964260174 3:154826439-154826461 CTCCATGATCTGCAGTTGGTGGG + Intergenic
966197242 3:177325699-177325721 GTGCATATACTGCATCTCGTAGG + Intergenic
966881431 3:184353328-184353350 CTGCATGTGCTGCCGCCGGCGGG + Exonic
967480644 3:189969296-189969318 CTTCATGTTCTGCACCTGGGGGG - Intronic
967890275 3:194359844-194359866 CTGGTTGTTCTGCAGCTGGATGG + Exonic
971486205 4:27163136-27163158 ATGCCTGTACTCCAGCTGCTTGG - Intergenic
973929945 4:55782062-55782084 CTGCAGGGCCTGCAGCTGGGTGG - Intergenic
974385644 4:61200473-61200495 ATGCAGATGCTGCAGCTGGTCGG + Intergenic
974907204 4:68073097-68073119 CTGGATCTTCTGCATCTGGTTGG - Intronic
977037459 4:91973162-91973184 ATGCATATTCTGCAGCTGTTGGG + Intergenic
977173832 4:93795848-93795870 GTAAATGTACTGCAGCTAGTTGG + Intergenic
978436643 4:108692772-108692794 CTCCATGTGCTGCAGCTTGGCGG + Intergenic
982692067 4:158560096-158560118 CTGCAGGTAATGAAGCTGGCAGG + Intronic
984450963 4:179900891-179900913 CTGCCTGTACTGTAGCTGCAAGG - Intergenic
989635714 5:43530810-43530832 CTGCAGCTGCTGCAGCTGGGAGG + Intronic
990057375 5:51600360-51600382 CTGCATATATTGCTGCTTGTTGG + Intergenic
990243341 5:53837501-53837523 CTGCATGTAGTTAATCTGGTGGG + Intergenic
990655222 5:57947631-57947653 CTGTTTGCTCTGCAGCTGGTAGG + Intergenic
992547227 5:77825112-77825134 CTGCATGTCCTGCTGCTGAGAGG - Intronic
993941413 5:94063143-94063165 CTACATGTACCACAGGTGGTGGG + Intronic
998816068 5:146015289-146015311 GTGCATGTGGTGCAGTTGGTGGG - Intronic
999397511 5:151239443-151239465 ATGGATGTACTACAGGTGGTTGG + Intronic
1000200302 5:159003282-159003304 CTGCATGTTCATCAGCTTGTGGG - Intronic
1000254014 5:159520849-159520871 CACCAGGTACTGCAGCTGTTCGG - Intergenic
1001992661 5:176130934-176130956 ATGCACGTTCTGCAGTTGGTGGG + Intronic
1003412200 6:5875697-5875719 CTGAATGAACTGCACTTGGTAGG + Intergenic
1004313434 6:14565689-14565711 CTGCAGGTACTGCACCTGGAGGG - Intergenic
1006272454 6:32974659-32974681 GTGTAGGTATTGCAGCTGGTTGG - Exonic
1006383680 6:33716606-33716628 CTGCCTGGAATGCAGCTGGGTGG + Intergenic
1007399028 6:41593335-41593357 CTGGATGAACGGCAGCTGGCTGG - Intronic
1011443500 6:87412390-87412412 CTGAATATACTGCAGCTGGCAGG - Intronic
1013876826 6:114841418-114841440 ATGTATGTACTGCAGGTGATGGG - Intergenic
1014755907 6:125301859-125301881 CTGCAGTTCCTGCGGCTGGTAGG - Exonic
1018165800 6:161094303-161094325 CAGAATTTACTACAGCTGGTGGG - Intronic
1019536680 7:1533124-1533146 CCTCATCTACAGCAGCTGGTCGG - Intronic
1026438760 7:70424279-70424301 CTGCATTCACTGCTGCTTGTAGG + Intronic
1026446840 7:70492135-70492157 GTGCCTATACTGCAGCTGTTGGG - Intronic
1029469407 7:100744722-100744744 CAGCATTTACTGAAGCTGCTGGG - Intronic
1029646696 7:101861486-101861508 CGGCATGCACTGCAGATGCTGGG + Intronic
1030065488 7:105655869-105655891 GTGCATGCCCTGCAGCAGGTGGG - Intronic
1032804725 7:135342461-135342483 CTGCATGTCCAGCTGCTGGCTGG - Intergenic
1033396673 7:140980840-140980862 TTTCATGTACTGCTGGTGGTAGG - Intergenic
1035835392 8:2745399-2745421 ATGCATATTCTGCAGCTGCTGGG - Intergenic
1037779152 8:21855934-21855956 CTGCCTGTACTGCAGCTGCTGGG - Intergenic
1038611749 8:29065359-29065381 CTGCATGGGCTTCAGCTGCTCGG - Intergenic
1040574905 8:48643543-48643565 CTGCATGTCCTGCACTTGGAAGG + Intergenic
1041161288 8:55046879-55046901 ATGCATATTCTGCAGCTGTTGGG - Intergenic
1041790545 8:61691891-61691913 CTGCAACTGCTGGAGCTGGTAGG + Intronic
1045519851 8:102894255-102894277 CAACATGTACTGAAGCTGGGAGG + Intronic
1045665600 8:104481020-104481042 CTGCATGGAATGAAGCTGGATGG + Intergenic
1046820624 8:118630504-118630526 CTCCATGTTCTCCAGCTGTTGGG + Intergenic
1049278145 8:141730207-141730229 CTTCAAGGGCTGCAGCTGGTGGG - Intergenic
1058968600 9:110059629-110059651 TTGAATGTTCTGCAGCTGGCCGG - Intronic
1059466312 9:114470837-114470859 CTTCATGTCCTGGAGCTGGAAGG - Intronic
1060268501 9:122125993-122126015 CTGCAGGTACAGCAGCAGGCAGG - Intergenic
1061080260 9:128365522-128365544 GTGCATGTAATGCACCTGGCAGG + Intergenic
1061972657 9:134053349-134053371 CTGCATGTACTGCAGCTGGTTGG + Exonic
1186527180 X:10259324-10259346 GTGCAAGCCCTGCAGCTGGTAGG - Intergenic
1195528894 X:105928945-105928967 ATGCATATTCTGCAGCTGTTGGG + Intronic
1198457026 X:136826813-136826835 CTGCATATACTGCATCTTGAAGG - Intergenic