ID: 1061974905

View in Genome Browser
Species Human (GRCh38)
Location 9:134063124-134063146
Sequence CAGCTCTCAGACCATCCCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061974893_1061974905 20 Left 1061974893 9:134063081-134063103 CCACTCAGCCATGCCGAGCCAGG 0: 1
1: 0
2: 0
3: 24
4: 204
Right 1061974905 9:134063124-134063146 CAGCTCTCAGACCATCCCCTTGG No data
1061974897_1061974905 12 Left 1061974897 9:134063089-134063111 CCATGCCGAGCCAGGACAAGGGG 0: 1
1: 0
2: 4
3: 18
4: 350
Right 1061974905 9:134063124-134063146 CAGCTCTCAGACCATCCCCTTGG No data
1061974902_1061974905 2 Left 1061974902 9:134063099-134063121 CCAGGACAAGGGGCCAGCAGGGC 0: 1
1: 0
2: 6
3: 32
4: 303
Right 1061974905 9:134063124-134063146 CAGCTCTCAGACCATCCCCTTGG No data
1061974892_1061974905 21 Left 1061974892 9:134063080-134063102 CCCACTCAGCCATGCCGAGCCAG 0: 1
1: 0
2: 0
3: 9
4: 174
Right 1061974905 9:134063124-134063146 CAGCTCTCAGACCATCCCCTTGG No data
1061974899_1061974905 7 Left 1061974899 9:134063094-134063116 CCGAGCCAGGACAAGGGGCCAGC 0: 1
1: 0
2: 1
3: 15
4: 212
Right 1061974905 9:134063124-134063146 CAGCTCTCAGACCATCCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061974905 Original CRISPR CAGCTCTCAGACCATCCCCT TGG Intronic
No off target data available for this crispr