ID: 1061979150

View in Genome Browser
Species Human (GRCh38)
Location 9:134090186-134090208
Sequence AGCCGAGTGGTTATGCCCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061979150_1061979160 21 Left 1061979150 9:134090186-134090208 CCCGGGGGCATAACCACTCGGCT No data
Right 1061979160 9:134090230-134090252 TACAAGGTTGTGCATACACCAGG No data
1061979150_1061979161 22 Left 1061979150 9:134090186-134090208 CCCGGGGGCATAACCACTCGGCT No data
Right 1061979161 9:134090231-134090253 ACAAGGTTGTGCATACACCAGGG No data
1061979150_1061979156 5 Left 1061979150 9:134090186-134090208 CCCGGGGGCATAACCACTCGGCT No data
Right 1061979156 9:134090214-134090236 GCCTTGTGCCCACATGTACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061979150 Original CRISPR AGCCGAGTGGTTATGCCCCC GGG (reversed) Intergenic
No off target data available for this crispr