ID: 1061979154

View in Genome Browser
Species Human (GRCh38)
Location 9:134090209-134090231
Sequence TACATGTGGGCACAAGGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061979154_1061979161 -1 Left 1061979154 9:134090209-134090231 CCCTGGCCTTGTGCCCACATGTA No data
Right 1061979161 9:134090231-134090253 ACAAGGTTGTGCATACACCAGGG No data
1061979154_1061979160 -2 Left 1061979154 9:134090209-134090231 CCCTGGCCTTGTGCCCACATGTA No data
Right 1061979160 9:134090230-134090252 TACAAGGTTGTGCATACACCAGG No data
1061979154_1061979167 26 Left 1061979154 9:134090209-134090231 CCCTGGCCTTGTGCCCACATGTA No data
Right 1061979167 9:134090258-134090280 CACAGAGGCCAGGAAGTGGCAGG No data
1061979154_1061979164 16 Left 1061979154 9:134090209-134090231 CCCTGGCCTTGTGCCCACATGTA No data
Right 1061979164 9:134090248-134090270 CCAGGGTGTCCACAGAGGCCAGG No data
1061979154_1061979165 22 Left 1061979154 9:134090209-134090231 CCCTGGCCTTGTGCCCACATGTA No data
Right 1061979165 9:134090254-134090276 TGTCCACAGAGGCCAGGAAGTGG No data
1061979154_1061979162 11 Left 1061979154 9:134090209-134090231 CCCTGGCCTTGTGCCCACATGTA No data
Right 1061979162 9:134090243-134090265 ATACACCAGGGTGTCCACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061979154 Original CRISPR TACATGTGGGCACAAGGCCA GGG (reversed) Intergenic