ID: 1061979156

View in Genome Browser
Species Human (GRCh38)
Location 9:134090214-134090236
Sequence GCCTTGTGCCCACATGTACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061979153_1061979156 -8 Left 1061979153 9:134090199-134090221 CCACTCGGCTCCCTGGCCTTGTG No data
Right 1061979156 9:134090214-134090236 GCCTTGTGCCCACATGTACAAGG No data
1061979151_1061979156 4 Left 1061979151 9:134090187-134090209 CCGGGGGCATAACCACTCGGCTC No data
Right 1061979156 9:134090214-134090236 GCCTTGTGCCCACATGTACAAGG No data
1061979150_1061979156 5 Left 1061979150 9:134090186-134090208 CCCGGGGGCATAACCACTCGGCT No data
Right 1061979156 9:134090214-134090236 GCCTTGTGCCCACATGTACAAGG No data
1061979148_1061979156 11 Left 1061979148 9:134090180-134090202 CCAATGCCCGGGGGCATAACCAC No data
Right 1061979156 9:134090214-134090236 GCCTTGTGCCCACATGTACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061979156 Original CRISPR GCCTTGTGCCCACATGTACA AGG Intergenic
No off target data available for this crispr