ID: 1061979157

View in Genome Browser
Species Human (GRCh38)
Location 9:134090215-134090237
Sequence ACCTTGTACATGTGGGCACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061979157_1061979161 -7 Left 1061979157 9:134090215-134090237 CCTTGTGCCCACATGTACAAGGT No data
Right 1061979161 9:134090231-134090253 ACAAGGTTGTGCATACACCAGGG No data
1061979157_1061979170 30 Left 1061979157 9:134090215-134090237 CCTTGTGCCCACATGTACAAGGT No data
Right 1061979170 9:134090268-134090290 AGGAAGTGGCAGGTTAAGAAGGG No data
1061979157_1061979167 20 Left 1061979157 9:134090215-134090237 CCTTGTGCCCACATGTACAAGGT No data
Right 1061979167 9:134090258-134090280 CACAGAGGCCAGGAAGTGGCAGG No data
1061979157_1061979164 10 Left 1061979157 9:134090215-134090237 CCTTGTGCCCACATGTACAAGGT No data
Right 1061979164 9:134090248-134090270 CCAGGGTGTCCACAGAGGCCAGG No data
1061979157_1061979169 29 Left 1061979157 9:134090215-134090237 CCTTGTGCCCACATGTACAAGGT No data
Right 1061979169 9:134090267-134090289 CAGGAAGTGGCAGGTTAAGAAGG No data
1061979157_1061979160 -8 Left 1061979157 9:134090215-134090237 CCTTGTGCCCACATGTACAAGGT No data
Right 1061979160 9:134090230-134090252 TACAAGGTTGTGCATACACCAGG No data
1061979157_1061979162 5 Left 1061979157 9:134090215-134090237 CCTTGTGCCCACATGTACAAGGT No data
Right 1061979162 9:134090243-134090265 ATACACCAGGGTGTCCACAGAGG No data
1061979157_1061979165 16 Left 1061979157 9:134090215-134090237 CCTTGTGCCCACATGTACAAGGT No data
Right 1061979165 9:134090254-134090276 TGTCCACAGAGGCCAGGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061979157 Original CRISPR ACCTTGTACATGTGGGCACA AGG (reversed) Intergenic
No off target data available for this crispr