ID: 1061979159

View in Genome Browser
Species Human (GRCh38)
Location 9:134090223-134090245
Sequence TATGCACAACCTTGTACATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061979159_1061979164 2 Left 1061979159 9:134090223-134090245 CCACATGTACAAGGTTGTGCATA No data
Right 1061979164 9:134090248-134090270 CCAGGGTGTCCACAGAGGCCAGG No data
1061979159_1061979172 24 Left 1061979159 9:134090223-134090245 CCACATGTACAAGGTTGTGCATA No data
Right 1061979172 9:134090270-134090292 GAAGTGGCAGGTTAAGAAGGGGG No data
1061979159_1061979162 -3 Left 1061979159 9:134090223-134090245 CCACATGTACAAGGTTGTGCATA No data
Right 1061979162 9:134090243-134090265 ATACACCAGGGTGTCCACAGAGG No data
1061979159_1061979170 22 Left 1061979159 9:134090223-134090245 CCACATGTACAAGGTTGTGCATA No data
Right 1061979170 9:134090268-134090290 AGGAAGTGGCAGGTTAAGAAGGG No data
1061979159_1061979165 8 Left 1061979159 9:134090223-134090245 CCACATGTACAAGGTTGTGCATA No data
Right 1061979165 9:134090254-134090276 TGTCCACAGAGGCCAGGAAGTGG No data
1061979159_1061979171 23 Left 1061979159 9:134090223-134090245 CCACATGTACAAGGTTGTGCATA No data
Right 1061979171 9:134090269-134090291 GGAAGTGGCAGGTTAAGAAGGGG No data
1061979159_1061979167 12 Left 1061979159 9:134090223-134090245 CCACATGTACAAGGTTGTGCATA No data
Right 1061979167 9:134090258-134090280 CACAGAGGCCAGGAAGTGGCAGG No data
1061979159_1061979169 21 Left 1061979159 9:134090223-134090245 CCACATGTACAAGGTTGTGCATA No data
Right 1061979169 9:134090267-134090289 CAGGAAGTGGCAGGTTAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061979159 Original CRISPR TATGCACAACCTTGTACATG TGG (reversed) Intergenic
No off target data available for this crispr